Receptor-like kinase OsER1 gene for regulating and controlling pistil number and seed morphology of rice

Abstract

The invention relates to a plant receptor-like kinase gene OsER1 participating in regulation and control of rice spikelet development, and compared with a wild type, an OsER1 gene function deletion mutant for regulating and controlling rice spikelet development and seed morphology has the advantage that the number of glumes, inner and outer hulls, stamens, pistils, stigmas and lobes of oser1-T is partially deviated. As the number of pistils in one spikelet is increased, the number of seeds is increased, and phenotypes of abnormal seed forms are avoided. The research proves that the OsER1 influences the pistil number and seed morphology of rice by regulating and controlling the development of rice glumous flowers. The discovery has important significance on creation of rice genetic materials and crop genetic improvement work, and has certain application value on rice breeding work.

Description

Technical Field

[0001] The invention relates to a plant receptor kinase gene OsER1 participating in regulating rice spikelet development, belonging to the field of plant biotechnology. Background Art

[0002] Flower development is one of the most important processes in the reproductive development of angiosperms. Under appropriate conditions, the flowering signal is transmitted to the apical meristem (SAM), which is transformed into the inflorescence meristem (IM). The spikelet (lemma) meristem starts at the top and / or side of the inflorescence meristem and then transforms into four whorled flower organs. In Gramineae, spikelets are a unique inflorescence structure. Among the three elements of rice yield, the number of grains per panicle (lemma number) is one of the most important factors. Normal rice contains only one fertile floret and the number of florets in an inflorescence is constant. In 1937, a scientist proposed the "three-flowered spikelet" hypothesis of rice, believing that a pair of guard lemmas in the spikelet are formed by the degeneration of two lateral florets, that is, the original rice spikelet may be composed of three florets. Increasing the number of grains per panicle is one of the key factors to increase yield. Therefore, the "three-flowered spikelet" has potential application value in rice breeding and will provide a new way to significantly increase the "number of grains per panicle" in breeding. So which genes are involved in the differentiation of rice spikelets? What are the signaling pathways involved in the differentiation of rice spikelets? These scientific questions urgently need to be studied in depth. Summary of the invention

[0003] The invention discloses a gene OsER1 involved in regulating the development of rice spikelets. The function of the gene has important application value for the research on the development of rice spikelets and the creation of rice multi-pistil trait genetic materials.

[0004] The contents of the present invention are:

[0005] The invention discloses a receptor-like kinase OsER1 gene for regulating the number of rice pistils and seed morphology. The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0006] The method for constructing a receptor-like kinase OsER1 gene mutant for regulating rice pistil number and seed morphology specifically comprises the following steps:

[0007] (1) Construction of OsER1 gene deletion expression vector;

[0008] (2) Introduce the expression vector into Zhonghua11 to obtain a gene-edited homozygous mutant.

[0009] The expression vector in step (1) utilizes a binary system to integrate the Cas9 protein expression cassette into the binary vector, and loads a multi-cloning site BsaI of multiple sgRNA expression cassettes at a position close to the binary vector RB. The sgRNA expression cassette elements are installed on an intermediate plasmid vector, which can be spliced ​​together by enzyme cutting, ligation and PCR methods, and then assembled into the binary vector using the GoldenGate or Gibson Assembly cloning method.

[0010] The gene-edited homozygous mutant of step (2) includes an addition to the nucleotide base sequence of the target gene OsER1.

[0011] The addition is to add 1 bp base.

[0012] The gene-edited homozygous mutants include oser1-1 and oser1-2; their nucleotide sequences are: SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0013] The significant advantage of the present invention is that the newly discovered rice OsER1 gene is involved in regulating the development of spikelets, affecting the number of rice pistils and seed morphology, which is of great significance to the study of rice reproductive development, especially the regulation of spikelet development, and has certain application value for rice breeding and increasing yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 These are the structure of the OsER1 gene that regulates rice spikelet development and the results of mutant strain identification.

[0015] Figure 2 Observation of seed morphology of the T-DNA insertion mutant of the OsER1 gene and two gene-edited homozygous mutants during seed maturity.

[0016] Figure 3 Anatomical observation of the spikelet of the T-DNA insertion mutant of the OsER1 gene. DETAILED DESCRIPTION

[0017] Example 1 Obtaining mutants

[0018] 1. This study purchased the mutant from the rice T-DNA insertion mutant library of Kyung Hee University (http: / / signal.salk.edu / cgi-bin / RiceGE), and the mutant number was (PFG_3A-52002.L). The pure heterozygous genotype of the mutant was identified by the three-primer method, and the insertion site of the mutant was obtained by first-generation sequencing.

[0019] 2. Construction of CRISPR / Cas 9 vector:

[0020] The gene editing system used in this study is the CRISPR / Cas9 system modified by Liu Yaoguang's research group at South China Agricultural University in 2015. This system uses a binary system to integrate the Cas9 protein expression cassette into the binary vector, and loads the multiple cloning site Bsa I of multiple sgRNA expression cassettes near the binary vector RB. The sgRNA expression cassette elements are installed on an intermediate plasmid vector, which can be spliced ​​together by enzyme cutting and PCR methods, and then assembled into the binary vector using the Golden Gate or Gibson Assembly cloning method, ultimately achieving gene editing of the OsER1 gene. (Xie X, Ma X, Zhu Q, Zeng D, Li G, Liu YG. 2017. CRISPR-GE: A Convenient Software Toolkit for CRISPR-Based Genome Editing. Mol. Plant 10(9): 1246-1249.), (Liu W., Xie X., Ma X., Li J., Chen J., and Liu Y.-G. 2015. DSDecode: A Web-based Tool for Decoding of Sequencing Chromatograms for Genotyping of Targeted Mutations. Mol. Plant 8(9): 1431-1433.). The vector backbone is the pCAMBIA1300 plant expression vector, and the inserted target site sequence is:

[0021] ER1-UT-F:GCGACTACTGCTCGTGGCGGTTTTAGAGCTATGCTG;

[0022] ER1-UT-R:CGCCACGAGCAGTAGTTCGCTGCCACGGATCATCTGC.

[0023] Figure 1 The structure of the OsER1 gene that regulates rice spikelet development and the results of mutant strain identification are shown in the figure. As shown in the figure, the T-DNA insertion mutant and two gene-edited homozygous mutants are displayed, named oser1-T, oser1-1, and oser1-2. The subsequent results are mainly displayed with oser1-T.

[0024] Example 2 Phenotypic Observation and Statistics

[0025] 1. Observation of rice seed morphology

[0026] The wild-type DJ and ZH11, as well as the oser1-T and oser1-1 / 2 mutants were planted in an artificial intelligence greenhouse, with the following conditions: temperature 28℃~32℃, air humidity 50%, light 14h, dark 10h. When the rice grew to maturity, the seed morphology was observed. Figure 2 The seed morphology of the T-DNA insertion mutant of the OsER1 gene and two gene-edited homozygous mutants during seed maturity was observed. The genetic background of the T-DNA insertion mutant is Dongjin (DJ), and the genetic background of oser1-1 and oser1-2 is Zhonghua 11 (ZH11). The seed phenotypes of the T-DNA insertion mutant and the CRISPR knockout mutant were observed to show that their seed morphology had changed, and they were mainly divided into three types: the first type had an extra lemma, and the brown rice after shelling was consistent with the wild type; the second type was mainly characterized by the cracking of the spikelet, and the husk contained two independent seeds; the third type was the cracking of the spikelet, but a seed with two embryos was formed inside the husk. The above results indicate that the loss of OsER1 function will lead to abnormal seed morphology.

[0027] 2. Observation of rice spikelet anatomy

[0028] After heading and before flowering of wild-type DJ and oser1-T, the spikelets were placed on ice, and their spikelets were dissected from the outside to the inside using a dissecting needle and tweezers, photographed under a stereo microscope, and recorded and counted. 206, 555, and 592 spikelets of wild-type, oser1-T, and oser1-1 were counted, respectively, and the statistical results are shown in Table 1.

[0029] Table 1 Number of floral organs in spikelets of wild type and OsER1 mutant

[0030]

[0031] Figure 3 Anatomical observation of spikelets of the T-DNA insertion mutant of OsER1 gene. The abnormal spikelets of the mutant are mainly divided into three types (I, II and III). The first type (I) has an extra lemma ( Figure 3 B); the second (II) and the third (III) are in the state of open spikelets ( Figure 3 CD), the two unclosed glumes are both lemmas, and the proportion of abnormal glumes is about 10% ( Figure 3 E) After dissection of the florets, Figure 3 F and Figure 3 As shown in the P pattern, the wild type (DJ) has six stamens and two lodicules on one side (close to the lemma), and the first type (I) spikelet abnormal type has six stamens and two lodicules after dissection. Figure 3G, Q), which is consistent with the wild type; in the second and third abnormal types of spikelets, multiple glume-like pieces and lodicules are formed, and the number of stamens increases (e.g. Figure 3 HI); in oser1-T, about 25% of the spikelets had abnormal stamen numbers ( Figure 3 J).

[0032] After removing the stamens, palea and lodicules, it was found that the first type (I) had only one pistil, which was the same as the wild type, so the spikelet phenotype of this type corresponds to Figure 3 Q's pattern diagram; the second type (II) spikelets contain one pistil or two pistils, and the single pistil is larger than the wild type. After further dissection, it was found that one ovary contains two ovules, which is called "one ovary, two ovules" (Type I), which is different from Figure 3 R corresponds to about 4% of all abnormal spikelets ( Figure 3 O); after dissection, it was found that the two ovaries of the spikelets with two pistils each contained one ovule, which is called "two ovaries, two ovules" (Type II). Figure 3 S corresponds to about 5% of all abnormal spikelets; the third type (III) spikelets contain two ovaries. After dissection of these two ovaries, it was found that one ovary contained one ovule and the other contained two ovules. This is called "two ovaries, three ovules" (Type III). This proportion is relatively small, accounting for 1% of abnormal spikelets, which is similar to Figure 3 T corresponds.

[0033] Compared with the wild type, the OsER1 gene functional loss mutant that regulates rice spikelet development and seed morphology has a partial deviation in the number of glumes, palea, stamens, pistils, stigmas and lodicules of oser1-T. The increased number of pistils in one spikelet leads to an increased number of seeds and an abnormal seed morphology phenotype. This study proves that OsER1 affects the number of pistils and seed morphology of rice by regulating the development of rice spikelets. This discovery will be of great significance to the creation of rice genetic materials and crop genetic improvement, and has certain application value in rice breeding.

[0034] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A receptor-like kinase OsER1 gene that regulates rice pistil number and seed morphology, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. The method for constructing a receptor-like kinase OsER1 gene mutant for regulating rice pistil number and seed morphology as claimed in claim 1, characterized in that: The specific steps include: (1) Construction of OsER1 gene deletion expression vector; (2) Introduce the expression vector into Zhonghua11 to obtain a gene-edited homozygous mutant.

3. The method according to claim 2, characterized in that The expression vector in step (1) utilizes a binary system to integrate the Cas9 protein expression cassette into the binary vector, and loads a multiple cloning site Bsa I of multiple sgRNA expression cassettes at a position close to the binary vector RB. The sgRNA expression cassette elements are installed on an intermediate plasmid vector, which can be spliced ​​together by enzyme cutting, ligation and PCR methods, and then assembled into the binary vector using the Golden Gate or Gibson Assembly cloning method.

4. The method according to claim 2, characterized in that: The gene-edited homozygous mutant of step (2) includes an addition to the nucleotide base sequence of the target gene OsER1.

5. The method according to claim 4, characterized in that The addition is to add 1 bp base.

6. The method according to claim 4, characterized in that The gene-edited homozygous mutants include oser1-1 and oser1-2; their nucleotide sequences are: SEQ ID NO.2 and SEQ ID NO.3, respectively.

Images