Gene for improving content of polymethoxylated flavonoids in citrus and application of gene

Abstract

The invention discloses a gene for increasing the content of citrus polymethoxylated flavonoids and application of the gene. The gene for increasing the content of citrus polymethoxylated flavonoids is CrCCoAOMT, and the gene sequence of the CrCCoAOMT is shown as SEQ ID NO. 1. It is found for the first time that CrCCoAOMT can improve the content of PMFs in citrus, the obtaining efficiency of PMFs is improved from the perspective of raw materials, and assistance is added for promoting practical application and popularization of PMFs in medicine and functional food.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a gene for increasing the content of citrus polymethoxyflavonoids and an application thereof. Background Art

[0002] Polymethoxylated flavones (PMFs) are mainly found in citrus plants. They are a class of flavonoids with two or more methoxy groups (OCH3) on the benzo-γ-pyrone (15-carbon, C6–C3–C6) skeleton and a carbonyl group at the C4 position. Since the first PMF (tangeretin) was crystallized from citrus oil in 1934, a total of 135 PMFs have been obtained, including 81 polymethoxyflavones and 54 polymethoxyflavanones or polymethoxychalcone. The free hydroxyl groups limit the absorption of polyphenols in the body, accelerate metabolism and excretion, and thus the efficiency of biological effects is low. In contrast, PMFs have low polarity and a nearly planar structure, high biological membrane permeability, and are easily absorbed by the blood in the body. Studies to date have shown that PMFs have a wide range of pharmacological and biological activities, including regulating metabolic disorders, anti-atherosclerosis, anti-inflammation, neuroprotection, anti-cancer, anti-microbial and antioxidant activities, and are a class of plant metabolites with important medicinal value.

[0003] At present, it is believed that plant flavonoids are synthesized through the phenylalanine pathway, and the biosynthesis of PMFs can be divided into two stages: the first stage is that phenylalanine is converted into naringenin, the common precursor of all flavonoids, by the action of key enzymes such as phenylalanine ammonia lyase (PAL), cinnamic acid-4-hydroxylase (C4H), 4-coumaric acid: coenzyme A ligase (4CL), chalcone synthase (CHS) and chalcone isomerase (CHI); the second stage is that naringenin is converted into apigenin by the catalytic action of flavonoid synthase (FNS), and apigenin is used as the skeleton and modified multiple times by O-methyltransferase (OMT) to generate PMFs. Different OMTs have their own substrate preferences and can catalyze different sites. For example, CrOMT1 in citrus can effectively catalyze the methylation of 6-OH and 8-OH sites, while CrOMT2 catalyzes the methylation of 3'-OH, 5'-OH and 7-OH sites.

[0004] In summary, PMFs, as a class of flavonoid compounds with extensive medicinal value, has broad application prospects in the research and development of drugs and functional foods. Although there are reports of obtaining PMFs by chemical synthesis or biosynthesis, due to the existence of many by-products, environmental pollution, low biological activity, difficulties in industrial production, and immature technology, the main way to obtain PMFs is still to extract them from citrus. Therefore, exploring the key factors in the biosynthesis of PMFs and then increasing the content of PMFs in citrus has become an urgent problem to be solved. Improving the efficiency of obtaining PMFs from the perspective of raw materials will add impetus to the practical application and promotion of PMFs in drugs and functional foods. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art and provide a gene for increasing the content of polymethoxylated flavonoids in citrus and an application thereof.

[0006] The technical solution adopted by the present invention is: a gene for increasing the content of citrus polymethoxyflavonoids, the gene is CrCCoAOMT, and the gene sequence of the CrCCoAOMT is shown in SEQ ID NO.1.

[0007] Based on a general technical concept, the present invention also provides an application of the gene to increase the content of polymethoxyflavonoids in citrus.

[0008] The above application, further, the application method includes: connecting the gene fragment of CrCCoAOMT with an expression vector to obtain a recombinant vector, and transiently infecting citrus peel with the recombinant vector through Agrobacterium-mediated infection, so as to achieve the purpose of increasing the content of citrus polymethoxyflavonoids in citrus.

[0009] In the above application, further, the method of the application includes:

[0010] S1. Using CrCCoAOMT-FP and CrCCoAOMT-RP as primers, cloning the CrCCoAOMT gene fragment, the gene sequence of the CrCCoAOMT-FP is shown in SEQ ID NO.2, and the gene sequence of the CrCCoAOMT-RP is shown in SEQ ID NO.3;

[0011] S2, connecting the CrCCoAOMT gene fragment with the pMD-19T cloning vector to obtain the pMD-19T-CrCCoAOMT plasmid;

[0012] S3, the pMD-19T-CrCCoAOMT plasmid was double-digested with XbaI and EcoRI, and the obtained target fragment was connected to the pBI121 plasmid to obtain the pBI121-CrCCoAOMT expression vector;

[0013] S4. The pBI121-CrCCoAOMT expression vector is used to transiently infect citrus peels through Agrobacterium-mediated infection.

[0014] Compared with the prior art, the advantages of the present invention are:

[0015] The present invention discloses a gene CrCCoAOMT for increasing the content of polymethoxyflavonoids in citrus. CrCCoAOMT can increase the content of PMFs in citrus. After overexpression of CrCCoAOMT obtained by the present invention, the content of PMFs in citrus is increased, and the efficiency of obtaining PMFs is improved from the perspective of raw materials, thereby adding impetus to the practical application and promotion of PMFs in medicines and functional foods. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to make the purpose, technical solution and advantages of the embodiments of the present invention more clear, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0017] Figure 1 These are the results of the expression level of CrCCoAOMT in the peel of the transiently overexpressed CrCCoAOMT group and the control group in Experiment 1 of the present invention.

[0018] Figure 2 These are the results of the PMFs content in the peel of the transiently overexpressed CrCCoAOMT and the control group in Experiment 2 of the present invention. DETAILED DESCRIPTION

[0019] The present invention is further described below in conjunction with specific preferred embodiments, but the protection scope of the present invention is not limited thereby.

[0020] The materials, reagents and instruments used in the following examples can all be purchased from commercial channels. The experimental methods in the following examples are all conventional methods in the art unless otherwise specified.

[0021] Example 1

[0022] A gene for increasing the content of polymethoxyflavonoids in citrus according to the present invention: CrCCoAOMT, whose gene sequence is shown in SEQ ID NO.1, specifically:

[0023] .

[0024] The cloning method of the citrus gene CrCCoAOMT in this embodiment includes:

[0025] (1) Extraction of total RNA from citrus.

[0026] 1.1. Place the citrus sample in a mortar and add liquid nitrogen to grind it into powder.

[0027] 1.2. Take an appropriate amount of powder and place it in a 1.5mL RNase / DNase Free centrifuge tube. Quickly add 1mL pre-cooled Trizol, shake well, and let stand at room temperature for 5 minutes.

[0028] 1.3. Add 200 μL of chloroform to the centrifuge tube, shake well, let stand at room temperature for 5 minutes, and centrifuge at 4°C, 12,000 r / min for 15 minutes.

[0029] 1.4. Transfer the supernatant to a new centrifuge tube, add an equal volume of isopropanol, gently invert to mix, let stand at -20°C for 20 min, and then centrifuge at 4°C, 12,000 rpm for 10 min.

[0030] 1.5. Discard the supernatant, add 1 mL of pre-cooled 75% ethanol, wash the precipitate, and centrifuge at 4°C, 12,000 r / min for 5 min.

[0031] 1.6. Carefully discard the supernatant and leave the tube open at room temperature. After the ethanol has completely evaporated, add 20 μL RNaseFree dH2O to dissolve the precipitate.

[0032] 1.7. Take 5 μL RNA and detect it by 1% agarose gel electrophoresis.

[0033] (2) Synthesis of citrus cDNA.

[0034] Total RNA was used as a template for reverse transcription, and M-MLV(H-)Reverse Transcriptase was used to complete the operation according to the instruction manual.

[0035] (3) PCR amplification of gene CrCCoAOMT.

[0036] PCR amplification was performed using cDNA of Nanfeng mandarin orange as template and specific primers.

[0037] The specific primers used for cloning are as follows:

[0038] CrCCoAOMT-FP: GCTCTAGAATGGCTTCCAACGCAGAAG (SEQ ID NO. 2);

[0039] CrCCoAOMT-RP: CGGAATTCTCACTTGATCCGACGGCAG (SEQ ID NO. 3).

[0040] The reaction conditions are as follows:

[0041]

[0042] (4) Recovery and purification of PCR products:

[0043] After detecting the above PCR products by 1% agarose gel electrophoresis, the target fragments were recovered using a gel excision recovery kit.

[0044] (5) The target fragment is connected to the cloning vector.

[0045] The fragments recovered above were connected to the cloning vector pMD-19T, and the reaction system was as follows:

[0046]

[0047] The ligation product pMD-19T-CrCCoAOMT was obtained by ligation at 16°C for 8 h.

[0048] (6) The ligation product is used to transform Escherichia coli.

[0049] 6.1. Add 10 μL of ligation product to 200 μL of competent cells, mix thoroughly, and place in an ice-water bath for 30 minutes;

[0050] 6.2. Transfer to a 42°C water bath for 90 seconds and then place in an ice water bath for 2 minutes;

[0051] 6.3. Add 1 mL of fresh LB medium and culture at 37°C with constant temperature shaking (180 rpm) for 1.5 h;

[0052] 6.4. Centrifuge at 4000 r / min for 10 min, remove 1 mL of supernatant, and keep 200 μL of bacterial solution. Mix and suspend the solution thoroughly, then spread it evenly on LB plate (containing 100 mg / L ampicillin, 24 mg / L IPTG, and 20 mg / L X-Gal), and culture at 37°C overnight.

[0053] 6.5. Pick a single white colony and inoculate it into LB liquid culture medium (containing 100 mg / L ampicillin), and culture it at 37°C with constant temperature shaking (180 rpm) overnight.

[0054] (7) Extraction of pMD-19T-CrCCoAOMT plasmid:

[0055] According to the instructions of the plasmid mini-extraction kit, the pMD-19T-CrCCoAOMT plasmid contained in the above bacterial solution was extracted. 5 μL of the sample was taken and detected by electrophoresis using 1% agarose gel.

[0056] (8) Sequencing:

[0057] The obtained plasmid was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and the sequencing results were analyzed. The obtained result is shown in SEQ ID NO.1.

[0058] Example 2

[0059] An application of the citrus gene CrCCoAOMT of Example 1 in increasing the content of polymethoxylated flavonoids in citrus, and the application method thereof comprises:

[0060] (1) Construct the expression vector of citrus gene CrCCoAOMT.

[0061] 1.1. Enzyme digestion of pMD-19T-CrCCoAOMT plasmid: pMD-19T-CrCCoAOMT plasmid was double-digested with XbaI and EcoRI at 37°C for 6 h, and the target fragment was recovered by 1% agarose gel electrophoresis (the recovered fragment was named small fragment).

[0062] The enzyme digestion reaction system and method are as follows:

[0063]

[0064] 1.2. Double digestion of pBI121 plasmid: Double digestion of pBI121 plasmid with XbaI and EcoRI to remove GUS gene. Digestion was performed at 37°C for 6 h, and pBI121 fragments were recovered by 1% agarose gel electrophoresis.

[0065] The reaction system is as follows:

[0066]

[0067] 1.3. Ligation of the target fragment with the pBI121 vector: Using T4 DNA ligase, the target fragment recovered from the gel excision and the pBI121 vector with the GUS gene cut out were connected at 16° C. for 14 h to obtain the expression vector pBI121-CrCCoAOMT.

[0068] The reaction system is as follows:

[0069]

[0070] (2) Preparation of pBI121-CrCCoAOMT Agrobacterium engineering bacteria.

[0071] 2.1. Add 2 μL of pBI121-CrCCoAOMT plasmid to 100 μL of Agrobacterium competent cells, mix thoroughly, place in an ice-water bath for 10 min, and quickly transfer to liquid nitrogen and freeze for 5 min.

[0072] 2.2. Place the frozen mixture in a 37°C water bath for 5 min, add 1 mL of fresh YEB medium, and culture at 28°C with constant temperature shaking (180 rpm) for 3 h.

[0073] 2.3. After centrifugation, remove 1 mL of supernatant, thoroughly mix and suspend the remaining 200 μL of bacterial solution, evenly spread it on YEB solid culture medium (containing 100 mg / L streptomycin, 100 mg / L rifampicin and 50 mg / L kanamycin), and culture at 28°C for 36 h.

[0074] 2.4. PCR detection of positive clones of Agrobacterium engineering bacteria.

[0075] The colonies obtained by antibiotic screening on the above plate were picked up, placed in 5 mL YEB, and cultured at 28°C, 180 rpm for 16-17 h. 2 μL of the above bacterial solution was taken, diluted with 18 μL of ddH2O, frozen at -20°C for 30-40 min, and heated at 99°C for 10 min to fully lyse the bacteria and release DNA; PCR was performed using the above DNA as a template and CrCCoAOMT-specific primers, and the reaction conditions and reaction system were consistent with step (3) in Example 1.

[0076] (3) Prepare Agrobacterium culture solution.

[0077] 3.1. Pick Agrobacterium GV3101 containing the empty vector pBI121 and the positive clones verified by bacterial liquid PCR, and inoculate them into 5 mL YEB liquid culture medium containing 50 mg / L kanamycin and 100 mg / L rifampicin, respectively, and culture at 28°C and 180 rpm for 18 h.

[0078] 3.2. Take the above bacterial solution at a ratio of 1:50 and add it to YEB liquid culture medium containing 100 mg / L rifampicin, 50 mg / L kanamycin, 10 mmol / L MES, 20 μmol / L AS and 2 mmol / L MgSO4, and culture at 28°C and 180 rpm for 18 hours.

[0079] 3.3. Centrifuge at 4000r / min for 10min at 4℃ to collect Agrobacterium cells, resuspend them in MMA solution containing 10mmol / L MES, 10mmol / L MgCl2, and 20μmol / L AS, and adjust the OD 600 The concentration of Agrobacterium was 1.0, and the culture was carried out at 28°C and 180 rpm for more than 3 h to activate Agrobacterium.

[0080] (4) Instantaneous infection of citrus peel.

[0081] 4.1. Experimental group: Use a 1 mL sterile syringe to inject 200 μL of the activated bacterial solution containing pBI121-CrCCoAOMT into the citrus peel.

[0082] Control group: Use a 1 mL sterile syringe to inject 200 μL of the above-activated unloaded bacterial solution into the citrus peel.

[0083] After injection, the citrus fruits were stored at 25°C.

[0084] Experiment 1: Investigate the expression level of CrCCoAOMT in the peel of transiently overexpressed CrCCoAOMT and the control group.

[0085] Citrus peels that were transiently infected for 3 days were taken to extract total RNA, and reverse transcription was completed using the HiScript IIQ RT SuperMix forqPCR kit according to the instructions, and the obtained cDNA was used as a template. Real-time quantitative PCR detection was performed using specific primers for CrCCoAOMT. The kit used for real-time quantification was ChamQ Universal SYBR qPCR Master Mix, and the reaction system and conditions were referred to the instructions.

[0086] The specific primers used for real-time quantification are as follows:

[0087] qCrCCoAOMT-FP: CCTGCCCTGCCTGTCTT.

[0088] qCrCCoAOMT-RP:TGTCGTACCCGATCACCC.

[0089] Figure 1 The expression level of CrCCoAOMT in the peel of the transiently overexpressed CrCCoAOMT group and the control group. As shown in the figure, the expression level of CrCCoAOMT in the peel of the experimental group was significantly higher than that of the control group.

[0090] Experiment 2: Investigate the content of PMFs in the peel of transiently overexpressed CrCCoAOMT and the control group.

[0091] Take 1 g of citrus peel after transient expression for 3 days, add 10 ml of methanol, and ultrasonicate at 50°C for 30 min to extract the polymethoxyflavonoids in the peel.

[0092] A Prominence HPLC-20A high performance liquid chromatography system was used, with an Inert Sustain C18 column (particle size 5 μm, 4.6×250 mm) as the stationary phase; ultrapure water (solution A) and methanol (solution B) containing 0.1% formic acid as the mobile phases, and a linear gradient elution, with the elution gradient being 0-20 min, solution B 10%-20%; 20-35 min, solution B 20%-25%; 35-55 min, solution B 27%-35%; 55-65 min, solution B 35%-55%; 65-70 min, solution B 55%-75%; 70-75 min, solution B 75%; 75-78 min, solution B 75%-10%; 78-83 min, solution B 10%. Detection wavelength: 283nm and 340nm; column temperature: 35℃; injection volume: 10μL; flow rate: 1ml / min.

[0093] Figure 2The PMFs content in the peel of the transiently overexpressed CrCCoAOMT and the control group. As shown in the figure: the PMFs content in the peel of the experimental group was significantly higher than that of the control group, indicating that overexpression of CrCCoAOMT can increase the PMFs content in citrus.

[0094] The above is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as above in the preferred embodiment, it is not used to limit the present invention. Any technician familiar with the art can make many possible changes and modifications to the technical solution of the present invention by using the methods and technical contents disclosed above without departing from the spirit and technical solution of the present invention, or modify it into an equivalent embodiment of equivalent changes. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention, still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A gene for increasing the content of polymethoxylated flavonoids in citrus, characterized in that: The gene is CrCCoAOMT, and the gene sequence of CrCCoAOMT is shown in SEQ ID NO.

1.

2. Use of the gene according to claim 1 in increasing the content of polymethoxylated flavonoids in citrus.

3. The use according to claim 2, characterized in that: The application method comprises: connecting the gene fragment of CrCCoAOMT with an expression vector to obtain a recombinant vector, and transiently infecting citrus peel with the recombinant vector through Agrobacterium-mediated infection, so as to achieve the purpose of increasing the content of polymethoxyflavonoids in citrus.

4. The use according to claim 3, characterized in that: The method of application includes: S1. Using CrCCoAOMT-FP and CrCCoAOMT-RP as primers, cloning the CrCCoAOMT gene fragment, the gene sequence of the CrCCoAOMT-FP is shown in SEQ ID NO.2, and the gene sequence of the CrCCoAOMT-RP is shown in SEQ ID NO.3; S2, connecting the CrCCoAOMT gene fragment with the pMD-19T cloning vector to obtain the pMD-19T-CrCCoAOMT plasmid; S3, the pMD-19T-CrCCoAOMT plasmid was double-digested with XbaI and EcoRI to obtain the target fragment, which was ligated to the pBI121 plasmid to obtain the pBI121-CrCCoAOMT expression vector; S4. The pBI121-CrCCoAOMT expression vector is used to transiently infect citrus peels through Agrobacterium-mediated infection.

Images