Genetic engineering strain and application thereof in D2P

Abstract

The invention provides a gene engineering strain and application thereof in D2P, and particularly, the gene engineering strain is obtained by modifying a gene of a Ubp family originally existing in eukaryotic cells, the expression or activity of Ubp in the gene engineering strain is reduced, the IVTT activity of a strain lysis buffer can be effectively improved, and the D2P production capacity is remarkably improved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a genetically engineered strain and its application in D2P. Background Art

[0002] In vitro cell-free protein synthesis system refers to an in vitro system that uses exogenous mRNA or DNA as a template and uses the enzyme system of cell extracts to synthesize proteins. Compared with the traditional in vivo recombinant expression system, the cell-free protein reaction system has many advantages, such as the ability to express cytotoxic proteins or special proteins containing non-natural amino acids, and its ease of operation can be used for high-throughput drug screening and proteomics research. Currently, commonly used cell-free protein synthesis systems include prokaryotic Escherichia coli systems, eukaryotic wheat germ extracts, rabbit reticulocyte lysates, and yeast cell extract systems. Among them, yeast cells can be obtained in large quantities through fermentation, combining the protein modification function of eukaryotic systems with the advantages of large-scale industrial applications. However, there is currently no truly industrializable in vitro cell-free protein synthesis system on the Chinese market. Low protein synthesis capacity and expensive synthesis costs are one of the main factors restricting this technology. There is still huge room for optimization of the supporting technical processes and background strains of the in vitro cell-free protein synthesis system. Summary of the invention

[0003] The object of the present invention is to provide a genetically engineered strain for increasing and improving the protein expression level of a cell-free protein expression (DNA to Protein, D2P) system.

[0004] The first aspect of the present invention provides a genetically engineered strain, characterized in that the endogenous ubiquitin-specific protease (Ubp) gene of the genetically engineered strain is modified, and the expression or activity of Ubp in the genetically engineered strain is reduced;

[0005] Preferably, the Ubp is selected from: one or more of UBP1, UBP2, UBP3, UBP5, UBP6, UBP7, UBP8, UBP9, UBP10, UBP11, UBP12, UBP13, UBP14, UBP15, UBP16, more preferably UBP1 and / or UBP1.

[0006] In the present invention, the “reduction” refers to reducing the expression or activity of the Ubp to meet the following conditions:

[0007] The ratio of B1 / B0 is ≤30%; wherein B1 is the expression or activity of Ubp in the genetically engineered strain after transformation; B0 is the expression or activity of Ubp before transformation; preferably, the "reduction" refers to reducing the expression or activity of the Ubp to meet the following conditions: the ratio of B1 / B0 is ≤10%; more preferably, the "reduction" refers to reducing the expression or activity of the Ubp to meet the following conditions: the ratio of B1 / B0 is ≤5%; more preferably, the "reduction" refers to reducing the expression or activity of the Ubp to meet the following conditions: the ratio of B1 / B0 is ≤2%; more preferably, the "reduction" refers to reducing the expression or activity of the Ubp to meet the following conditions: the ratio of B1 / B0 is selected from 0-2%.

[0008] In another preferred embodiment, the expression or activity of Ubp in the strain is reduced by a method selected from the group consisting of gene mutation, gene knockout, gene interruption, RNA interference technology, Crispr technology, or a combination thereof.

[0009] The genetically engineered strain is a yeast derived from one or more sources selected from the group consisting of: Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces; preferably Kluyveromyces, more preferably Kluyveromyces lactis. In some preferred examples, the Kluyveromyces is one or more types of genetically engineered Kluyveromyces lactis (K. lactis), and the genetic engineering modification is used to improve its in vitro protein expression activity.

[0010] Preferably, the Ubp is derived from Saccharomyces cerevisiae, Pichia pastoris and / or Kluyveromyces.

[0011] The Kluyveromyces yeast is selected from one of Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces dobsonii or any combination thereof.

[0012] Preferably, the Ubp is selected from any one of the following amino acid sequences:

[0013] (a) an amino acid sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.45;

[0014] (b) an amino acid sequence having an identity of ≥60% with the amino acid sequence encoding the polypeptide represented by any one of SEQ ID NO.1 to SEQ ID NO.45, preferably, a polypeptide having an identity of ≥75% (preferably ≥85%, more preferably ≥90% or ≥95% or ≥98% or ≥99%);

[0015] (c) and / or a sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequence shown in any one of SEQ ID NO.1 to SEQ ID NO.45, wherein the number of the substituted, deleted or added amino acids may be 1-10, preferably 1-5.

[0016] Preferably, the coding sequence of Ubp is selected from any one of the following sequences;

[0017] (a) a polynucleotide encoding a polypeptide as shown in any one of SEQ ID NO.1 to SEQ ID NO.45;

[0018] (b) a polynucleotide having an identity of ≥30% with the nucleotide sequence encoding the polypeptide shown in any one of SEQ ID NO.1 to SEQ ID NO.45, preferably, a polynucleotide having an identity of ≥75% (preferably ≥85%, more preferably ≥90% or ≥95% or ≥98% or ≥99%);

[0019] (c) a polynucleotide having 1 to 20, preferably 1 to 10, nucleotides truncated or added to the 5' end and / or 3' end of the nucleotide sequence encoding the polypeptide shown in any one of SEQ ID NO. 1 to SEQ ID NO. 45;

[0020] (d) A polynucleotide complementary to the polynucleotide described in any one of (a) to (c).

[0021] More preferably, the coding sequence of Ubp is selected from any one of the following sequences;

[0022] (a) the nucleotide sequence shown in any one of SEQ ID NO.46 to SEQ ID NO.47;

[0023] (b) a polynucleotide having a nucleotide sequence identity of ≥30% to the nucleotide sequence shown in any one of SEQ ID NO.46 to SEQ ID NO.47, preferably, an identity of ≥75% (preferably ≥85%, more preferably ≥90% or ≥95% or ≥98% or ≥99%);

[0024] (c) a polynucleotide having 1 to 20, preferably 1 to 10 nucleotides truncated or added to the 5' end and / or 3' end of the polynucleotide represented by any one of SEQ ID NO. 46 to SEQ ID NO. 47;

[0025] (d) A polynucleotide complementary to the polynucleotide described in any one of (a) to (c).

[0026] The second aspect of the present invention provides the use of the genetically engineered strain of the first aspect, characterized in that it is used to improve the efficiency of in vitro protein synthesis.

[0027] The third aspect of the present invention provides an in vitro cell-free protein synthesis system, characterized in that the in vitro cell-free protein synthesis system comprises a lysate or a lysate extract prepared from the strain provided in the first aspect.

[0028] Preferably, the in vitro cell-free protein synthesis system further comprises one or more components selected from the following group:

[0029] (b) polyethylene glycol;

[0030] (c) optionally exogenous sucrose;

[0031] and (d) optionally a solvent, said solvent being water or an aqueous solvent;

[0032] Further preferably, the in vitro cell-free protein synthesis system further comprises one or more components selected from the following group:

[0033] (e1) substrate for RNA synthesis;

[0034] (e2) substrates for protein synthesis;

[0035] (e3) magnesium ion;

[0036] (e4) potassium ion;

[0037] (e5) buffer;

[0038] (e6) RNA polymerase;

[0039] and (e7) an energy regeneration system; more preferably, the energy regeneration system is a creatine phosphate / creatine phosphate enzyme system;

[0040] Further preferably, the in vitro cell-free protein synthesis system further comprises one or more components selected from the following group:

[0041] (e8) heme; and (e9) spermidine.

[0042] The fourth aspect of the present invention provides a method for synthesizing proteins in vitro, characterized in that it comprises the steps of: (i) providing the in vitro cell-free protein synthesis system described in the third aspect above, and adding exogenous DNA molecules for guiding protein synthesis; (ii) incubating the in vitro cell-free protein synthesis system of step (i) for a period of time T1 under suitable conditions, thereby synthesizing the protein encoded by the exogenous DNA; preferably, the method for synthesizing proteins in vitro also comprises: (iii) optionally isolating or detecting the exogenous protein encoded by the exogenous DNA from the in vitro cell-free protein synthesis system.

[0043] The in vitro protein synthesis system, template, plasmid, target protein, in vitro protein synthesis reaction (incubation reaction), various preparation methods, various detection methods and other technical elements of the present invention can also be independently selected from the following documents to select appropriate implementation methods or implementation methods, including but not limited to CN111484998A, CN106978349A, CN108535489A, CN108690139A, CN108949801 A, CN108642076A, CN109022478A, CN109423496A, CN109423497A, CN109423509A, CN109837293A, CN109971783A, CN109988801A, CN109971775A, CN110093284A, CN110408635A, CN110408636A, CN110551745A, CN110551700A, CN110551785A, CN110819647A, CN110845622A, CN110938649A, CN110964736A and other documents. Unless otherwise inconsistent with the purpose of the present invention, these documents and the documents cited are cited in their entirety and for all purposes.

[0044] The beneficial effects of the present invention are:

[0045] (1) The present invention verifies for the first time that knocking out the Ubp gene can improve the protein synthesis capacity of an in vitro cell-free protein synthesis system through gene-directed modification and activity assay;

[0046] (2) The present invention uses CRISPR-Cas9 gene editing technology to knock out Ubp, thereby changing the ability to synthesize protein in vitro;

[0047] (3) The effect of gene knockout on protein expression was verified through an in vitro cell-free protein synthesis system, and relying on the advantages of low cost and convenient experiments of the cell-free protein system, an experimental research platform was provided for gene-directed modification;

[0048] (4) The formed in vitro cell-free protein synthesis system can further achieve the purpose of reducing costs and simplifying operation. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 This is an amino acid sequence alignment of the ubiquitin-specific protease ubp1 of K. lactis and Saccharomyces cerevisiae. In the K. lactis genome, the amino acid sequence of the ubiquitin-specific protease ubp1 of K. lactis has certain similarities with that of the Saccharomyces cerevisiae protease.

[0050] Figure 2This is an amino acid sequence alignment of K. lactis and the ubiquitin-specific protease ubp5. In the K. lactis genome, the amino acid sequence of the K. lactis and the ubiquitin-specific protease ubp5 of Saccharomyces cerevisiae have certain similarities.

[0051] Figure 3 Schematic diagram of C-ubp1-gRNA1 map. This plasmid carries the K.lactis GAP promoter and CYC1 terminator, and has a kana selection marker.

[0052] Figure 4 It is a schematic diagram of the C-Ubp5-gRNA map.

[0053] Figure 5 Figure 1 is a schematic diagram of the donor spectrum of d176 UBP1. The 778 bp upstream of the start codon of K1 Ubp is Homologous Reorganization arm 1, and the 714 bp downstream of the stop codon is Homologous Reorganization arm 2.

[0054] Figure 6 The figure is a schematic diagram of the donor spectrum of d174 UBP5. The 781 bp upstream of the start codon of KlUbp is Homologous Reorganization arm 1, and the 735 bp downstream of the stop codon is Homologous Reorganization arm 2.

[0055] Figure 7 This is a comparison of the amount of green fluorescent protein synthesized by the ΔUbp1, ΔUbp5 strains and the wild-type strain in the in vitro cell-free protein synthesis system. DETAILED DESCRIPTION

[0056] After extensive and in-depth research, the inventors found that cells with Ubp1 and Ubp5 gene knockout can significantly improve the protein synthesis capacity of the in vitro cell-free protein synthesis system and increase the expression yield of exogenous proteins compared with wild-type unmodified cells.

[0057] The advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0058] the term

[0059] Engineered strains

[0060] The "engineered strain" and "genetically engineered strain" described in the present invention are used interchangeably and both refer to the engineered strain for improving the efficiency of in vitro protein synthesis of the present invention, i.e., the strain described in the first aspect of the present invention. The genetically engineered strain is a yeast derived from one or more sources selected from the group consisting of Saccharomyces cerevisiae, Pichia pastoris, and Kluyveromyces; preferably Kluyveromyces, and more preferably Kluyveromyces lactis.

[0061] Ubiquitination is an important biological process that regulates protein stability, function, and interactions. However, ubiquitination can also lead to protein degradation and inactivation.

[0062] Proteases are special enzymes that can recognize and remove ubiquitin tags on proteins. A variety of proteases have been discovered, such as Ubp, UCH, OTU, etc. These proteases have different substrate specificities and deubiquitination mechanisms, and can selectively remove different types of ubiquitin tags.

[0063] Ubp (Ubiquitin-specific protease) gene family

[0064] Ubiquitin-specific proteases (UBPs, also denoted herein as Ubps) are a unique class of hydrolases that specifically remove polypeptides covalently linked to the C-terminal glycine of ubiquitin via peptide or isopeptide bonds. UBPs help regulate the ubiquitin proteolytic pathway by generating free ubiquitin monomers from the initial translation products, recycling ubiquitin during the degradation of ubiquitin-protein conjugates, and / or by removing ubiquitin from specific targets, thereby potentially preventing protein degradation.

[0065] The functional group regions of the gene family encoding this enzyme are relatively conserved among eukaryotes.

[0066] Based on the alignment of Ubp protein sequences of S. cerevisiae, related Ubp protein sequences with similar structures were found in other yeasts, such as Figure 1 and Figure 2 As shown, it can be determined that the gene numbers of Ubp1 and Ubp5 in yeast cells such as K. lactis are KLLA0E08801g and KLLA0E10275g, respectively.

[0067] The following lists the enzyme sequence information that may increase the expression level of D2P after knockout. The sequence information of Ubp of Saccharomyces cerevisiae is shown in Table 1; the sequence information of Ubp of Kluyveromyces lactis determined based on the Ubp protein sequence alignment of Saccharomyces cerevisiae (S.cerevisiae) is shown in Table 2; the sequence information of Ubp of Kluyveromyces marxianus determined based on the Ubp protein sequence alignment of Saccharomyces cerevisiae (S.cerevisiae) is shown in Table 3.

[0068] Table 1 Saccharomyces cerevisiae Ubp involved in the present invention

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078] Table 2 Ubp of Kluyveromyces lactis of the present invention

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086] Table 3 Ubp of the present invention

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096] D2P

[0097] The concept of "D2P" in the present invention includes but is not limited to IVTT reaction (in vitro transcription and translation reaction). In the present invention, IVTT reaction is preferred. IVTT reaction, corresponding to IVTT system, is the process of transcribing and translating DNA into protein in vitro. Therefore, we also refer to this type of in vitro protein synthesis system as D-to-P system, D_to_P system, DNA-to-Protein system; the corresponding in vitro protein synthesis method is also called D2P method, D-to-P method, D_to_P method, DNA-to-Protein method, which has the same meaning as "in vitro cell-free protein synthesis system", "in vitro expression system", "in vitro protein synthesis system", "in vitro protein synthesis reaction system", "cell-free protein synthesis system" and other expressions. Protein in vitro synthesis system, in vitro protein synthesis system, cell-free system, cell-free protein synthesis system, cell-free in vitro protein synthesis system, in vitro cell-free protein synthesis system, in vitro cell-free synthesis system, CFS system (cell-free system), CFPS system (cell-free protein synthesis system) and other descriptions. Including in vitro translation system, in vitro transcription and translation system (IVTT system), etc. We also call the in vitro protein synthesis system a "protein synthesis factory". In vitro protein synthesis reaction refers to the reaction of synthesizing proteins in an in vitro cell-free synthesis system, which at least includes the translation process.

[0098] Foreign DNA

[0099] The exogenous DNA comes from prokaryotes or eukaryotes; in another preferred embodiment, the exogenous DNA comes from animals, plants, or pathogens; in another preferred embodiment, the exogenous DNA comes from mammals, preferably primates, rodents, including humans, mice, and rats.

[0100] Foreign protein

[0101] The exogenous protein is selected from the following group of exogenous proteins: luciferin protein, or luciferase (such as firefly luciferase), green fluorescent protein, yellow fluorescent protein, aminoacyl tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable region of antibody, luciferase mutant, α-amylase, enterobactin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, interleukin-1β, lysozyme, serum albumin, single-chain antibody fragment (scFV), thyroxine transporter, tyrosinase, xylanase, or a combination thereof. However, the above is only an exemplary introduction to exogenous proteins, and does not only include the above exogenous proteins; it can be any protein that can be expressed exogenously.

[0102] In vitro protein synthesis system

[0103] The in vitro protein synthesis system, template, plasmid, target protein, in vitro protein synthesis reaction (incubation reaction), various preparation methods, various detection methods and other technical elements of the present invention can also be independently selected from the following documents to select appropriate implementation methods or implementation methods, including but not limited to CN111484998A, CN106978349A, CN108535489A, CN108690139A, CN108949801 A, CN108642076A, CN109022478A, CN109423496A, CN109423497A, CN109423509A, CN109837293A, CN109971783A, CN109988801A, CN109971775A, CN110093284A, CN110408635A, CN110408636A, CN110551745A, CN110551700A, CN110551785A, CN110819647A, CN110845622A, CN110938649A, CN110964736A and other documents. Unless otherwise inconsistent with the purpose of the present invention, these documents and the documents cited are cited in their entirety and for all purposes.

[0104] In a feasible embodiment, the in vitro protein synthesis system is not particularly limited. In the present invention, the in vitro protein synthesis system comprises:

[0105] (a) Genetically engineered strain cell extracts;

[0106] (b) polyethylene glycol;

[0107] (c) optionally exogenous sucrose; and

[0108] (d) an optional solvent, wherein the solvent is water or an aqueous solvent.

[0109] In a particularly preferred embodiment, the in vitro protein synthesis system provided by the present invention comprises: genetically engineered strain cell extract, 4-hydroxyethylpiperazineethanesulfonic acid, potassium acetate, magnesium acetate, adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytosine triphosphate (CTP), thymidine triphosphate (TTP), amino acid mixture, creatine phosphate, dithiothreitol (DTT), creatine phosphate kinase, RNA enzyme inhibitor, luciferin, luciferase DNA, RNA polymerase. In the present invention, RNA polymerase is not particularly limited and can be selected from one or more RNA polymerases, and a typical RNA polymerase is T7 RNA polymerase.

[0110] In the present invention, the proportion of the yeast cell extract in the in vitro protein synthesis system is not particularly limited. Usually, the yeast cell extract accounts for 20-70% of the in vitro protein synthesis system, preferably 30-60%, and more preferably 40-50%.

[0111] Genetically engineered strain cell extracts

[0112] In the present invention, the genetically engineered strain cell extract does not contain intact cells, and a typical cell extract includes ribosomes, transfer RNA, aminoacyl tRNA synthetase, initiation factors and elongation factors required for protein synthesis, and termination release factors for protein translation. In addition, the cell extract also contains some other proteins in the cytoplasm of the genetically engineered strain, especially soluble proteins.

[0113] In the present invention, the preparation method of the genetically engineered cell extract is not limited. A preferred preparation method comprises the following steps:

[0114] (i) providing a genetically engineered strain cell with the Ubp gene knocked out provided in the first aspect of the present invention;

[0115] (ii) washing the genetically engineered strain cells to obtain washed genetically engineered strain cells;

[0116] (iii) disrupting the washed genetically engineered strain cells to obtain a crude extract of the genetically engineered strain;

[0117] (iv) performing solid-liquid separation on the crude extract of the genetically engineered strain to obtain a liquid portion, which is a cell extract of the genetically engineered strain.

[0118] In the present invention, the solid-liquid separation method is not particularly limited, and a preferred method is centrifugation.

[0119] In a preferred embodiment, the centrifugation is performed in a liquid state.

[0120] In the present invention, the centrifugation conditions are not particularly limited, and a preferred centrifugation condition is 5000-100000×g, preferably 8000-30000×g.

[0121] In the present invention, the centrifugation time is not particularly limited, and a preferred centrifugation time is 0.5 min-2 h, preferably 20 min-50 min.

[0122] In the present invention, the centrifugation temperature is not particularly limited. Preferably, the centrifugation is performed at 1-10°C, more preferably, at 2-6°C.

[0123] In the present invention, the washing treatment method is not particularly limited. A preferred washing treatment method is to use a washing liquid at a pH of 7-8 (preferably 7.4). The washing liquid is not particularly limited. Typically, the washing liquid is selected from the following group: potassium 4-hydroxyethylpiperazineethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof.

[0124] In the present invention, the cell disruption treatment method is not particularly limited. A preferred cell disruption treatment includes high-pressure disruption and freeze-thaw (such as liquid nitrogen cryogenic) disruption.

[0125] The nucleoside triphosphate mixture in the in vitro protein synthesis system is adenosine triphosphate, guanosine triphosphate, cytosine triphosphate and uridine triphosphate. In the present invention, the concentration of various mononucleotides is not particularly limited, and usually the concentration of each mononucleotide is 0.5-5mM, preferably 1.0-2.0mM.

[0126] The amino acid mixture in the in vitro protein synthesis system may include natural or non-natural amino acids, and may include D-type or L-type amino acids. Representative amino acids include (but are not limited to) 20 natural amino acids: glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and histidine. The concentration of each amino acid is generally 0.01-0.5 mM, preferably 0.02-0.2 mM, such as 0.05, 0.06, 0.07, 0.08 mM.

[0127] In a preferred embodiment, the in vitro protein synthesis system further contains polyethylene glycol or its analogs. The concentration of polyethylene glycol or its analogs is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or its analogs is 0.1-8%, preferably 0.5-4%, more preferably 1-2%, based on the total weight of the protein synthesis system. Representative examples of PEG include (but are not limited to): PEG3000, PEG8000, PEG6000 and PEG3350. It should be understood that the system of the present invention may also include polyethylene glycols of various other molecular weights (such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc.).

[0128] In a preferred embodiment, the in vitro protein synthesis system further contains sucrose. The concentration of sucrose is not particularly limited, and generally, the concentration of sucrose is 0.03-40wt%, preferably 0.08-10wt%, and more preferably 0.1-5wt%, based on the total weight of the protein synthesis system.

[0129] A particularly preferred in vitro protein synthesis system contains the following components in addition to yeast extract: 22 mM 4-hydroxyethylpiperazineethanesulfonic acid, pH 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4 mM nucleoside triphosphate mixture, 0.08-0.24 mM amino acid mixture, 25 mM creatine phosphate, 1.7 mM dithiothreitol, 0.27 mg / mL creatine phosphate kinase, 1%-4% polyethylene glycol, 0.5%-2% sucrose, 8-20 ng / μl firefly luciferase DNA, and 0.027-0.054 mg / mL T7 RNA polymerase.

[0130] The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions, such as the experimental conditions described in documents such as "Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989)" and "Cell-free Protein Synthesis Laboratory Manual" "Edited by Alexander S. Spirin and James R. Swartz. Cell-free protein synthesis: methods and protocols [M]. 2008", or according to the conditions recommended by the manufacturer, or according to the conditions guided by the specific embodiments described above. Unless otherwise specified, the percentages and parts mentioned in the present invention are weight percentages and weight parts.

[0131] Unless otherwise specified, the reagents and materials in the examples of the present invention are all commercially available products.

[0132] The present invention uses Kluyveromyces lactis (K. lactis) as an example, but the same design, analysis and experimental methods are also applicable to other yeasts and other lower eukaryotic cells and higher animal cells. The gene modification method in the present invention is CRISPR-Cas9 technology, but it is not limited thereto, and can be any known and existing gene modification method.

[0133] Example 1 Knockout of Ubp gene by CRISPR-Cas9

[0134] 1.1Ubp sequence retrieval and construction of CRISPR gRNA plasmid

[0135] According to the sequence alignment of Ubp1 and Ubp5 proteins of Saccharomyces cerevisiae (e.g. Figure 1 and Figure 2 As shown), the gene numbers of Ubp1 and Ubp5 in K.lactis cells are determined to be KLLA0E08801g and KLLA0E10275g, respectively. Select the PAM sequence (NGG) near the 5' of the coding sequence, and determine the corresponding gRNA sequence. The principle of gRNA selection in this embodiment is: moderate GC content (40%-60%), avoiding the presence of poly T (6U) structure. In this embodiment, the sequence of KlUbp1 gene gRNA is gcctaacttctctaaaatcgtgg, and the sequence of KlUbp5 gene gRNA is gctttcagctgtagcgtcgaagg (the nucleic acid coding sequences of KlUbp1 and KlUbp5 genes are shown in Table 4).

[0136] Table 4 Nucleic acid coding sequences of Ubp1 and Ubp5 genes of Kluyveromyces lactis

[0137]

[0138]

[0139]

[0140] The plasmid construction and transformation method of KlUbp1 gRNA were as follows: primers C-189-F: AATCgcctaacttctctaaaatcg and C-189-R: AAACcgattttagagaagttaggc

[0141] Using the pCas9 plasmid as a template, PCR amplification was performed. Take 17 μL of the amplified product, add 0.2 μL Dpn I, 2 μL 10× digestion buffer, mix well and place in a 37°C water bath for 3 hours. Take 10 μL of the product treated with Dpn I and add it to 50 μL DH5α competent cells, place on ice for 30 minutes, heat shock at 42°C for 45 seconds, add 1 mL LB liquid culture medium and shake culture at 37°C for 1 hour, spread on Kan-resistant LB solid culture, and invert at 37°C until a single clone grows. Pick two single clones and shake culture in LB liquid culture medium. After PCR test is positive and sequencing is confirmed, extract the plasmid and save it. It is named C-Ubp1-gRNA with the structure as shown below. Figure 3 shown.

[0142] The construction method of KlUbp5 gRNA is as follows: Use primers C-185-F: AAACtcgacgctacagctgaaagc and C-185-R: AATCgctttcagctgtagcgtcga, and use pCAS plasmid as template for PCR amplification. The transformation and identification methods are the same as above. The positive plasmid is named C-Ubp5-gRNA, and the structure is as follows Figure 4 shown.

[0143] 1.2 Construction and amplification of Ubp1 knockout donor DNA

[0144] PCR amplification was performed with Kluyveromyces lactis, K. lactis Y-1140 using primers 2020ken-840-F: gcaacctcagcaacaagagcaatgag and 2020ken-840-Rgatgcgtgaaattgccaataatgtataattgaacgaaacgactagcg and 2020ken-841-F: gtcgtttcgttcaattatacattattggcaatttcacgcatctagttacatagatac and 2020ken-841-R: gatcgatgagccgacactcacactatatgg, and 17 μL of the amplification product was taken to obtain donor d-176, as shown in FIG. Figure 5 shown.

[0145] 1.2.1 Ubp5 knockout donor d-174

[0146] Using Kluyveromyces lactis genomic DNA as a template, PCR amplification was performed with primers 2020ken-836-F: ggcactacacagaagtcaaaggatccag and 2020ken-836-R: gtttcttcgaacactgattaccgtggttggtgaaaagagtgtaaaatcc, and the product was named d174-H1; using Kluyveromyces lactis genomic DNA as a template, PCR amplification was performed with primers 2020ken-837-F: caccaaccacggtaatcagtgttcgaagaaacaccagatc and 2021ken-247-R: gggaccaagtggatgaacagctccag, and the product was named d174-H2;

[0147] Add 50 μL PFU to each of the amplified products d174-H1 and d174-H1, mix well and perform the PCR program. After completion, the product is named d174. Figure 6 shown.

[0148] 1.3K.lactis ubp1 knockout donor electroporation

[0149] Take out the competent medium from the -80℃ refrigerator, thaw on ice, add 200ng plasmid C-Ubp1-gRNA, 1000ng d-176 donor DNA fragment obtained by 200ng plasmid genome amplification through primers, mix well and transfer all into the electroporation cup, and bathe on ice for 2min; put the electroporation cup into the electroporator for electroporation (parameters are 1.5kV, 200Ω, 25μF); immediately add 700μL YPD after the electroporation, incubate at 30℃, 200rpm shaker for 1~3h; take 2~200μL and inoculate on YPD (containing G418 resistance) plate, and culture at 30℃ for 2~3 days until single colonies appear.

[0150] 1.3-1K.lactis ubp5 knockout donor electroporation

[0151] Take out the competent medium from the -80℃ refrigerator, thaw on ice, add 200ng plasmid C-Ubp5-gRNA, 1000ng d-174 donor DNA fragment obtained by genomic amplification of 200ng plasmid through primers, mix well and transfer all into the electroporation cup. The subsequent process is the same as <1.3K.lactis ubp1 knockout donor electroporation>.

[0152] 1.4 Positive identification

[0153] 12-24 single clones were picked from the plate after cell transformation, and the cell genome was used as a template to perform PCR detection on the samples using the identification primers 2021ken-247-F: gattccgattactgagtgaggcgg and 2021ken-247-R: gggaccaagtggatgaacagctccag. The positive strain band was 3281bp, and the negative strain band was 965bp. The positive cell line identified by sequencing was named d176.

[0154] Example 2 In vitro cell-free protein synthesis system

[0155] 2.1 Preparation of cell extract (cell lysate)

[0156] The method for preparing the cell extract comprises the following steps:

[0157] (i) providing cells, wherein the cells are the ΔUbp1 cell line prepared in Example 1;

[0158] (ii) washing the cells to obtain washed cells;

[0159] (iii) subjecting the washed cells to cell disruption to obtain a crude cell extract;

[0160] (iv) subjecting the crude cell extract to solid-liquid separation to obtain a liquid portion, namely, a cell extract (cell lysate).

[0161] The solid-liquid separation method is not particularly limited, and the method selected in this embodiment is centrifugation. The centrifugation conditions are 30000×g, the centrifugation time is 30 min, and the centrifugation is carried out at 4°C.

[0162] The washing treatment method is not particularly limited. The washing treatment method selected in this embodiment is to use a washing liquid at a pH of 7.4. The washing liquid is not particularly limited. The washing liquid is typically selected from the following group: potassium 4-hydroxyethylpiperazineethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof. Potassium acetate is selected in this embodiment.

[0163] The cell disruption treatment method is not particularly limited. A preferred cell disruption treatment includes high-pressure disruption and freeze-thaw (such as liquid nitrogen cryogenic) disruption.

[0164] 2.2 Preparation of in vitro cell-free protein synthesis system

[0165] Final concentrations are 22 mM 4-hydroxyethylpiperazineethanesulfonic acid at pH 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4 mM nucleoside triphosphate mixture (adenosine triphosphate, guanosine triphosphate, cytosine triphosphate, and uridine triphosphate), 0.08-0.24 mM amino acid mixture (glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine), 25 mM creatine phosphate, 1.7 mM dithiothreitol, 0.027-0.054 mg / mL LT7 RNA polymerase, 0.27 mg / mL creatine kinase, 1%-4% polyethylene glycol, 0.5%-2% sucrose, and finally 50% volume of cell extract are added.

[0166] 2.3 In vitro cell-free protein synthesis reaction

[0167] 15 ng / μL enhanced green fluorescent protein DNA was added to the above system, mixed well and placed in an environment of 20-30°C for reaction for 3 hours.

[0168] Enhanced green fluorescent protein (eGFP) activity assay: After the reaction is completed, add 10 μL of reaction solution to a 96-well white plate or a 384-well white plate, and immediately place it on an Envision 2120 multifunctional microplate reader (Perkin Elmer). Read the readings to detect the activity of enhanced green fluorescent protein. The relative fluorescence unit (RFU) is used as the activity unit. Figure 7 shown.

[0169] Among them, ΔUbp1 represents the Ubp1(d-176) knockout Kluyveromyces lactis cell line, wherein ΔUbp5 represents the Ubp5(d-174) knockout Kluyveromyces lactis cell line, PC represents the corresponding wild-type Kluyveromyces lactis cell line, and PC-1 and PC-2 are two parallel experiments.

[0170] When the reaction time was 3h, the average RFU of ΔUbp1 was 2823, and the average RFU of PC was 865, which was about 3.26 times that of PC. This comparative data shows that knocking out the Ubp1 gene by gene editing technology can significantly improve the protein synthesis capacity of the in vitro cell-free protein synthesis system. The average RFU of ΔUbp5 was 2244, which was about 2.5 times that of PC.

[0171] The ΔDUG strain of Kluyveromyces lactis in which glutamate protease (Glu-C) was knocked out by the same knockout method was used as a control. Glutamate protease (Glu-C) is an endonuclease, and glutamate protease is a group of proteolytic enzymes containing glutamic acid residues in the active site. That is, this strain degrades proteins containing glutamate rather than ubiquitin. As a control example with the same protease knockout, the RFU value of this strain at 3 hours was 477, which was significantly lower than that of the wild-type Kluyveromyces lactis cell line, and was reduced by about 44% compared to PC.

[0172] The preferred specific embodiments of the present invention are described in detail above. It should be understood that a person skilled in the art can make many modifications and changes based on the concept of the present invention without creative work. Therefore, any technical solution that can be obtained by a person skilled in the art through logical analysis, reasoning or limited experiments based on the concept of the present invention on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. A genetically engineered strain, characterized in that: The endogenous ubiquitin-specific protease (Ubp) gene of the genetically engineered strain is modified, and the expression or activity of Ubp in the genetically engineered strain is reduced; Preferably, the Ubp is selected from one or more of UBP1, UBP2, UBP3, UBP5, UBP6, UBP7, UBP8, UBP9, UBP10, UBP11, UBP12, UBP13, UBP14, UBP15 and UBP16.

2. The genetically engineered strain according to claim 1, characterized in that The "reduction" means that the expression or activity of the Ubp is reduced to meet the following conditions: the ratio of B1 / B0 is ≤30%; wherein B1 is the expression or activity of Ubp in the genetically engineered strain; B0 is the expression or activity of Ubp before the modification; preferably, the "reduction" means that the expression or activity of the Ubp is reduced to meet the following conditions: the ratio of B1 / B0 is ≤10%; more preferably, the "reduction" means that the expression or activity of the Ubp is reduced to meet the following conditions: the ratio of B1 / B0 is ≤5%; more preferably, the "reduction" means that the expression or activity of the Ubp is reduced to meet the following conditions: the ratio of B1 / B0 is ≤2%; more preferably, the "reduction" means that the expression or activity of the Ubp is reduced to meet the following conditions: the ratio of B1 / B0 is selected from 0-2%.

3. The genetically engineered strain according to claim 2, characterized in that The genetically engineered strain is derived from one or more sources selected from the group consisting of: Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces.

4. The genetically engineered strain according to claim 3, characterized in that The Kluyveromyces yeast is selected from one of Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces dobsonii or any combination thereof.

5. The genetically engineered strain according to any one of claims 1 to 4, characterized in that: The Ubp amino acid sequence is selected from any one of the following: (a) an amino acid sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.45; (b) an amino acid sequence having an identity of ≥60% with any one of SEQ ID NO.1 to SEQ ID NO.45, preferably a polypeptide having an identity of ≥75% (preferably ≥85%, more preferably ≥90% or ≥95% or ≥98% or ≥99%); (c) and / or a sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequence shown in any one of SEQ ID NO.1 to SEQ ID NO.45, wherein the number of the substituted, deleted or added amino acids may be 1-10, preferably 1-5.

6. The genetically engineered strain according to claim 1, characterized in that: Preferably, the coding sequence of Ubp is selected from any one of the following sequences; (a) a polynucleotide encoding a polypeptide as shown in any one of SEQ ID NO.1 to SEQ ID NO.45; (b) a polynucleotide having an identity of ≥30% with the nucleotide sequence encoding the polypeptide shown in any one of SEQ ID NO.1 to SEQ ID NO.45, preferably, a polynucleotide having an identity of ≥75% (preferably ≥85%, more preferably ≥90% or ≥95% or ≥98% or ≥99%); (c) a polynucleotide having 1 to 20, preferably 1 to 10, nucleotides truncated or added to the 5' end and / or 3' end of the nucleotide sequence encoding the polypeptide shown in any one of SEQ ID NO. 1 to SEQ ID NO. 45; (d) a polynucleotide complementary to the polynucleotide described in any one of (a) to (c); Preferably, the coding sequence of Ubp is selected from any one of the following sequences; (a) the nucleotide sequence shown in any one of SEQ ID NO.46 to SEQ ID NO.47; (b) a polynucleotide having an identity of ≥30% with the nucleotide sequence shown in any one of SEQ ID NO.46 to SEQ ID NO.47, preferably a polynucleotide having an identity of ≥75% (preferably ≥85%, more preferably ≥90% or ≥95% or ≥98% or ≥99%); (c) a polynucleotide having 1 to 20, preferably 1 to 10 nucleotides truncated or added to the 5' end and / or 3' end of the polynucleotide represented by any one of SEQ ID NO. 46 to SEQ ID NO. 47; (d) A polynucleotide complementary to the polynucleotide described in any one of (a) to (c).

7. The genetically engineered strain according to claim 1, characterized in that: The expression or activity of Ubp in the strain is reduced by a method selected from the group consisting of gene mutation, gene knockout, gene interruption, RNA interference technology, Crispr technology, or a combination thereof.

8. Use of the genetically engineered strain according to any one of claims 1 to 7 for improving the efficiency of in vitro protein synthesis.

9. An in vitro cell-free protein synthesis system, characterized in that: The characteristic is that The in vitro cell-free protein synthesis system comprises a cell extract prepared from the genetically engineered strain according to any one of claims 1 to 7.

10. The synthesis system according to claim 9, characterized in that The in vitro cell-free protein synthesis system further comprises one or more components selected from the group consisting of: (b) polyethylene glycol; (c) optional exogenous sucrose; and (d) optional solvent, wherein the solvent is water or an aqueous solvent; Preferably, the in vitro cell-free protein synthesis system further comprises one or more components selected from the group consisting of: (e1) a substrate for synthesizing RNA; (e2) a substrate for synthesizing protein; (e3) magnesium ions; (e4) potassium ions; (e5) a buffer; (e6) RNA polymerase; and (e7) an energy regeneration system. More preferably, the in vitro cell-free protein synthesis system further comprises one or more components selected from the following group: (e8) heme; and (e9) spermidine.

11. A method for in vitro cell-free protein synthesis, characterized in that: The method comprises the following steps: (i) providing the in vitro cell-free protein synthesis system according to any one of claims 9 to 10, and adding an exogenous DNA molecule for directing protein synthesis; (ii) incubating the in vitro cell-free protein synthesis system of step (i) under suitable conditions for a period of time T1, thereby synthesizing the protein encoded by the exogenous DNA; preferably, the method for in vitro protein synthesis also includes: (iii) optionally isolating or detecting the protein encoded by the exogenous DNA from the in vitro cell-free protein synthesis system; preferably, in step (ii), the reaction temperature is 20-37°C, preferably, 20-25°C; further preferably, in step (ii), the reaction time is 1-72h, preferably, 2-23h.

Images