Insect-resistant and herbicide-resistant transgenic sorghum event BrsT01 as well as detection method and application thereof

Abstract

The invention discloses an insect-resistant and herbicide-resistant transgenic sorghum event BrsT01 as well as a detection method and application thereof. The insect-resistant and herbicide-resistant transgenic sorghum BrsT01 is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC No.46082. The invention also establishes a PCR detection method for detecting whether a plant sample to be detected is derived from the transgenic sorghum BrsT01, and the detection method can identify the junction region of the inserted exogenous DNA molecule and the plant genome DNA, and further can be used for accurately and rapidly identifying whether the plant sample contains the DNA molecule of the specific transgenic sorghum event BrsT01. Therefore, the breeding efficiency is improved, and a foundation is laid for research on cultivation of insect-resistant and herbicide-resistant sorghum varieties with excellent characters.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering technology, mainly to transgenic plants and detection methods thereof, and in particular to a method for detecting an insect-resistant and herbicide-resistant transgenic sorghum event BrsT01 and whether a biological sample contains a specific transgenic sorghum event nucleotide sequence. Background Art

[0002] Weeds not only directly reduce sorghum yields by competing with sorghum for light, water and fertilizer, but also cause pests and diseases to reduce yields by providing parasitic and overwintering sites for many pests and diseases. Therefore, weed control in sorghum is an important measure to ensure high and stable yields.

[0003] Glufosinate is the abbreviation of ammonium glufosinate. It is a broad-spectrum contact herbicide used to control the growth of a wide range of weeds after crop growth. The active ingredient of glufosinate is L-phosphinothricin, an inhibitor of glutamine synthase. Glutamine synthase catalyzes the synthesis of glutamine from glutamate and ammonia. When its activity is inhibited, it will lead to the accumulation of ammonia and the reduction of glutamate levels, thereby inhibiting photosynthesis and causing the death of plants within a few days. Glufosinate acetyltransferase can detoxify glufosinate into an inactive compound through acetylation, thus avoiding damage to plants. The glufosinate acetyl-CoA transferase (PAT) encoded by the bar gene is derived from Streptomyces hygroscopicus. Introducing the bar gene into crops can give crops tolerance to glufosinate.

[0004] In recent years, sorghum insect pests have continued to occur, especially Lepidoptera pests such as sorghum borer, cotton bollworm, fall armyworm, armyworm, etc., which have caused a decline in sorghum yield and quality. In severe cases, the harvest may be completely lost. Therefore, sorghum pest control is also an important measure to ensure high and stable sorghum yields.

[0005] Cry insecticidal protein is the most widely used Bt insecticidal protein. Cry1Ab protein is one of them, which is highly targeted to Lepidoptera insects such as sorghum borer. Cry insecticidal protein is initially ingested by insects in the form of protoxin, and then the insecticidal crystal protein is dissolved and activated under high pH conditions to become an activated monomer insecticidal protein of about 60-68kDa in size. The activated Cry insecticidal protein binds to alkaline phosphatase and aminopeptidase N in the midgut epithelial cells of the target pests, thereby enriching the activated toxin on the microvilli of the midgut cells. The toxin binds to the receptor cadherin with high affinity to form a quadruple oligomer perforated structure. After the oligomer is inserted into the cell membrane, a transmembrane pore is formed, which causes the target pest's intestine to swell and lyse, and the osmotic pressure in the body is unbalanced, resulting in the death of the target pest.

[0006] Vegetative insecticidal proteins (VIP) are a new type of insecticidal protein produced by Bacillus thuringiensis (Bt) during the vegetative growth stage. They have strong insecticidal activity against many important lepidopteran pests and are mainly divided into three types: VIP1, VIP2 and VIP3. Among them, VIP3 has a broad spectrum of insecticidal activity against lepidopteran insects. VIP3 is a soluble protein that can act directly without being digested in the insect midgut, and ultimately causes the death of the insect by inducing apoptosis of midgut cells.

[0007] Therefore, by introducing the bar gene, Cry1Ab gene and Vip3A gene into sorghum plants for expression through transgenic methods, sorghum can acquire resistance to lepidopteran insects and tolerance to glufosinate herbicide, thereby obtaining transformant events with commercial application prospects. By using conventional breeding methods such as backcrossing, the obtained transformant events can be transferred to sorghum with different genetic backgrounds, and insect-resistant and herbicide-resistant sorghum varieties with the transgenic expression characteristics of the original transformant events can be bred. Summary of the invention

[0008] The technical problem to be solved by the present invention is how to accurately and quickly identify whether a plant sample contains a specific transgenic sorghum event.

[0009] In order to solve the above problems, the present invention provides a method for breeding insect-resistant and / or herbicide-tolerant sorghum, comprising the following steps: using sorghum obtained from a transgenic sorghum event or its progeny as a parent material and hybridizing with another sorghum variety that does not have insect resistance and / or glufosinate tolerance to obtain insect-resistant and / or herbicide-tolerant sorghum having higher insect resistance and / or glufosinate tolerance than the other sorghum variety;

[0010] The transgenic sorghum event is the act of inserting exogenous DNA molecules into the target sorghum genome to obtain insect-resistant and / or herbicide-resistant transgenic sorghum;

[0011] The upstream flanking sequence of the exogenous DNA molecule in the insect-resistant and / or herbicide-tolerant transgenic sorghum is any DNA fragment extending from the upstream insertion site in the upstream direction thereof;

[0012] The downstream flanking sequence of the exogenous DNA molecule in the insect-resistant and / or herbicide-tolerant transgenic sorghum is any DNA fragment extending from the downstream insertion site in the downstream direction;

[0013] The upstream insertion site is a site corresponding to the last nucleotide in the DNA molecule shown in positions 1-637 of SEQ ID No.1 contained in the target sorghum genome;

[0014] The downstream insertion site is a site corresponding to the first nucleotide in the DNA molecule shown in positions 12224-12541 of SEQ ID No.1 contained in the target sorghum genome;

[0015] The exogenous DNA molecule includes a gene encoding phosphinothricin acetyl-CoA transferase, a Vip3A insect-resistant gene and / or a Cry1Ab insect-resistant gene.

[0016] In the above method, the upstream insertion site can be specifically the 637th position of SEQ ID No. 1. The downstream insertion site can be specifically the 12224th position of SEQ ID No. 1.

[0017] In the above method, the phosphinothricin acetyl-CoA transferase encoding gene encodes phosphinothricin acetyl-CoA transferase, and the phosphinothricin acetyl-CoA transferase is any one of the following proteins:

[0018] The phosphinothricin acetyl-CoA transferase encoding gene encodes phosphinothricin acetyl-CoA transferase, and the phosphinothricin acetyl-CoA transferase is any one of the following proteins:

[0019] A1) a protein whose coding sequence is the reverse complementary sequence of positions 908-1459 of SEQ ID No.1,

[0020] A2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein described in A1) and having an identity of 80% or more with the protein described in A1) and capable of regulating plant herbicide resistance,

[0021] A3) connecting the N-terminus or / and C-terminus of A1) or A2) to a protein tag to obtain a fusion protein;

[0022] The Vip3A insect-resistant gene encodes a Vip3A protein, and the Vip3A protein is any of the following proteins:

[0023] B1) a protein whose coding sequence is the reverse complementary sequence of positions 2780-5158 of SEQ ID No. 1,

[0024] B2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein described in B1) and having an identity of 80% or more with the protein described in B1) and capable of regulating plant resistance to insects,

[0025] B3) connecting the N-terminus or / and C-terminus of B1) or B2) to a protein tag to obtain a fusion protein;

[0026] The Cry1Ab insect-resistant gene encodes the Cry1Ab protein, and the Cry1Ab protein is any of the following proteins:

[0027] C1) a protein encoding the sequence of positions 9228 to 11684 of SEQ ID No. 1,

[0028] C2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein described in C1) and having an identity of more than 80% with the protein described in C1) and capable of regulating plant resistance to insects,

[0029] C3) A fusion protein obtained by connecting the N-terminus and / or C-terminus of C1) or C2) to a protein tag.

[0030] In the above proteins, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0031] In the above-mentioned proteins, identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be obtained.

[0032] In the above proteins, the above 80% identity may be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0033] The coding sequence (CDS) of the coding strand of the phosphinothricin acetyl-CoA transferase encoding gene is the reverse complementary sequence of positions 908-1459 of SEQ ID No. 1 (that is, the nucleotide sequence of the non-coding strand of the phosphinothricin acetyl-CoA transferase encoding gene is positions 908-1459 of SEQ ID No. 1).

[0034] The coding sequence (CDS) of the coding strand of the Vip3A insect-resistant gene is the reverse complementary sequence of positions 2780-5158 of SEQ ID No. 1 (ie, the nucleotide sequence of the non-coding strand of the Vip3A insect-resistant gene is positions 2780-5158 of SEQ ID No. 1).

[0035] The coding sequence (CDS) of the coding chain of the Cry1Ab insecticide gene is positions 9228-11684 of SEQ ID No.1.

[0036] In the above method, the nucleotide sequence of one strand of the exogenous DNA molecule may be nucleotides 638 to 12223 of SEQ ID No. 1. The nucleotide sequence of the other strand of the exogenous DNA molecule may be reverse complementary to nucleotides 638 to 12223 of SEQ ID No. 1. The upstream flanking sequence is specifically shown in nucleotides 1 to 637 of SEQ ID No. 1. The downstream flanking sequence is specifically shown in nucleotides 12224 to 12541 of SEQ ID No. 1.

[0037] In the present application, the transgenic sorghum event can be the act of inserting an exogenous DNA molecule into the target sorghum genome to obtain insect-resistant and / or herbicide-resistant transgenic sorghum; specifically, it can be the act of inserting an exogenous DNA molecule whose nucleotide sequence is positions 638-12223 of SEQ ID No.1 between positions 59570307-59570370 of chromosome 8 of the sorghum variety P184 genome, replacing the 62bp nucleotide sequence between positions 59570307-59570370 of chromosome 8 of the sorghum variety P184 genome, to obtain insect-resistant and / or herbicide-resistant transgenic sorghum.

[0038] In the above method, the sorghum obtained from the transgenic sorghum event contains a specific DNA fragment; the specific DNA fragment contains the DNA molecules at positions 625 to 650 in SEQ ID No.1 and / or the DNA molecules at positions 12211 to 12236 in SEQ ID No.1.

[0039] The sorghum obtained from the transgenic sorghum event can specifically be sorghum (Sorghum bicolor) BrsT01, whose deposit number in the General Microbiological Center of China Microorganism Culture Collection is CGMCC No.46082.

[0040] The present invention also provides a method for producing insect-resistant and / or herbicide-resistant transgenic sorghum, comprising the following steps: inserting the above-mentioned exogenous DNA molecule into the target sorghum genome to obtain insect-resistant and / or herbicide-resistant transgenic sorghum;

[0041] The upstream flanking sequence of the exogenous DNA molecule in the insect-resistant and / or herbicide-tolerant transgenic sorghum is any DNA fragment extending from the upstream insertion site in the upstream direction thereof;

[0042] The downstream flanking sequence of the exogenous DNA molecule in the insect-resistant and / or herbicide-tolerant transgenic sorghum is any DNA fragment extending from the downstream insertion site in the downstream direction;

[0043] The upstream insertion site is a site corresponding to the last nucleotide in the DNA molecule shown in positions 1-637 of SEQ ID No.1 contained in the target sorghum genome;

[0044] The downstream insertion site is a site corresponding to the first nucleotide in the DNA molecule shown in positions 12224-12541 of SEQ ID No.1 contained in the target sorghum genome;

[0045] The exogenous DNA molecule includes a gene encoding phosphinothricin acetyl-CoA transferase, a Vip3A insect-resistant gene and / or a Cry1Ab insect-resistant gene.

[0046] In the above method, the upstream insertion site can be specifically the 637th position of SEQ ID No.1; the downstream insertion site can be specifically the 12224th position of SEQ ID No.1.

[0047] In the above method, the insect-resistant and / or herbicide-resistant transgenic sorghum may specifically be sorghum (Sorghumbicolor) BrsT01, whose deposit number at the General Microbiological Center of China Microorganism Culture Collection Administration is CGMCC No.46082.

[0048] The present invention also provides a recombinant DNA molecule, wherein the recombinant DNA molecule comprises a nucleic acid fragment, and the nucleic acid fragment is any one of the following:

[0049] K1) the nucleic acid fragment is a double-stranded DNA fragment or a single-stranded DNA fragment, the nucleotide sequence of one strand of the double-stranded DNA fragment is sequence 1; the nucleotide sequence of the single-stranded DNA fragment is the same as the nucleotide sequence of any strand of the double-stranded DNA fragment;

[0050] K2) the nucleic acid fragment is a double-stranded DNA fragment or a single-stranded DNA fragment, the nucleotide sequence of one strand of the double-stranded DNA fragment is selected from any sequence of the fragment containing the upstream insertion site and / or the downstream insertion site in sequence 1; the nucleotide sequence of the single-stranded DNA fragment is the same as the nucleotide sequence of any strand of the double-stranded DNA fragment;

[0051] K3) the nucleic acid fragment is a double-stranded DNA fragment or a single-stranded DNA fragment, the nucleotide sequence of one strand of the double-stranded DNA fragment is selected from any sequence of 20 nt to 637 nt in length in positions 1 to 637 of SEQ ID No. 1, and the nucleotide sequence of the single-stranded DNA fragment is the same as the nucleotide sequence of any strand of the double-stranded DNA fragment;

[0052] K4) the nucleic acid fragment is a double-stranded DNA fragment or a single-stranded DNA fragment, the nucleotide sequence of one strand of the double-stranded DNA fragment is selected from any fragment of 20 bp to 318 bp in length selected from positions 12224 to 12541 of SEQ ID No. 1, and the nucleotide sequence of the single-stranded DNA fragment is the same as the nucleotide sequence of any strand of the double-stranded DNA fragment;

[0053] K5) the nucleic acid fragment is a double-stranded DNA fragment or a single-stranded DNA fragment, the nucleotide sequence of one strand of the double-stranded DNA fragment is selected from any sequence of nucleotides 638 to 12223 of SEQ ID No. 1, and the nucleotide sequence of the single-stranded DNA fragment is the same as the nucleotide sequence of any strand of the double-stranded DNA fragment;

[0054] In the above recombinant DNA molecule, the length of the double-stranded DNA fragment in the nucleic acid fragment K2) can be 20bp, 21bp, 22bp, 23bp, 24bp, 25bp, 26bp, 27bp, 28bp, 29bp, 30bp, 60bp, 90bp, 100bp, 637bp, 645bp, 650bp or 1081bp, etc. In some embodiments of the present invention, the length of the double-stranded DNA fragment in the nucleic acid fragment K2) is specifically 26bp, 645bp or 1081bp. In some embodiments of the present invention, the double-stranded DNA fragment in the nucleic acid fragment K2) is specifically a fragment in which the nucleotide sequence of one chain is the 625th to 650th positions in SEQ ID No.1, a fragment in which the nucleotide sequence of one chain is the 12211th to 12236th positions in SEQ ID No.1, a fragment in which the nucleotide sequence of one chain is the 1st to 1081st positions in SEQ ID No.1, and a fragment in which the nucleotide sequence of one chain is the 11897th to 12541th positions in SEQ ID No.1 (length is 645bp).

[0055] The length of the double-stranded DNA fragment in the nucleic acid fragment K3) may be 20bp, 21bp, 22bp, 23bp, 24bp, 25bp, 26bp, 27bp, 28bp, 29bp, 30bp, 60bp, 90bp, 100bp or 637bp. In one embodiment of the present invention, the nucleic acid fragment K3) is a single-stranded DNA fragment, specifically 5'-SBF1 (the nucleotide sequence is the single-stranded DNA at positions 157 to 177 in SEQ ID No. 1).

[0056] The length of the double-stranded DNA fragment in the nucleic acid fragment K4) may be 20bp, 21bp, 22bp, 23bp, 24bp, 25bp, 26bp, 27bp, 28bp, 29bp, 30bp, 60bp, 90bp, 100bp or 318bp. In one embodiment of the present invention, the nucleic acid fragment K4) is a single-stranded DNA fragment, specifically 3'SBR1 (the reverse complementary sequence of the single-stranded DNA at positions 12275-12296 in SEQ ID No. 1).

[0057] The length of the double-stranded DNA fragment in the nucleic acid fragment K5) can be 20bp, 21bp, 22bp, 23bp, 24bp, 25bp, 26bp, 27bp, 28bp, 29p, 30bp, 60bp, 90bp, 100bp, 11586bp. In one embodiment of the present invention, the nucleic acid fragment K5) is a single-stranded DNA fragment, specifically 5'-SBR1 (the reverse complementary sequence of the single-stranded DNA at positions 964 to 987 in SEQ ID No.1). In one embodiment of the present invention, the nucleic acid fragment K5) is a single-stranded DNA fragment, specifically 3'-SBF1 (the nucleotide sequence is the single-stranded DNA at positions 11620 to 11641 in SEQ ID No.1).

[0058] The present invention also protects the use of the above recombinant DNA molecule in any of the following:

[0059] D1) detecting or assisting in detecting whether the sample to be tested is derived from the transgenic sorghum event;

[0060] D2) Detect or assist in detecting whether the sample to be tested is derived from the genetically modified sorghum BrsT01. The classification name of BrsT01 is sorghum (Sorghum bicolor), and its deposit number in the General Microbiological Center of the China Microbiological Culture Collection Administration is CGMCC No. 46082;

[0061] D3) Breeding insect-resistant and / or herbicide-tolerant transgenic sorghum;

[0062] D4) detecting or assisting in detecting whether the plant sample is derived from the insect-resistant and / or herbicide-tolerant sorghum;

[0063] D5) detecting or assisting in detecting whether the plant sample is derived from the insect-resistant and / or herbicide-tolerant transgenic sorghum.

[0064] The present invention also provides a method for detecting or assisting in detecting whether a plant sample to be tested is derived from the transgenic sorghum event, wherein the method is M1, M2 or M3, and M1 comprises the following steps:

[0065] M11) using the genomic DNA of the plant sample to be tested as a template and using the primer combination to perform PCR amplification to obtain a PCR product,

[0066] M12) determining whether the plant sample to be tested is derived from the transgenic sorghum event according to the size of the PCR product in the following manner: if the PCR product contains a DNA fragment of an expected size, the plant sample to be tested is derived from the transgenic sorghum event; if the PCR product does not contain a DNA fragment of the expected size, the plant sample to be tested is not derived from the transgenic sorghum event;

[0067] The primer composition comprises the following F1) or F2) or F3):

[0068] F1) a 5'-end transformant detection primer pair, wherein the upstream primer of the 5'-end transformant detection primer pair is designed based on the nucleotide sequence of the fragment from position 1 to position 637 of SEQ ID No. 1, and the downstream primer is designed from the exogenous DNA molecule;

[0069] F2) a 3'-end transformant detection primer pair, wherein the upstream primer of the 3'-end transformant detection primer pair is designed based on the exogenous DNA molecule, and the downstream primer is designed based on the nucleotide sequence of the fragment of positions 12224-12541 of SEQ ID No.1;

[0070] F3) the 5' end transformant detection primer pair and the 3' end transformant detection primer pair;

[0071] The M2 comprises the following steps: sequencing the genomic DNA of the plant sample to be tested, and determining whether the plant sample to be tested is derived from the transgenic sorghum event according to the sequencing result;

[0072] The M3 comprises the following steps: performing Southern hybridization on the genomic DNA of the plant sample to be tested using a probe that can specifically bind to the recombinant DNA molecule, and determining whether the plant sample to be tested is derived from the transgenic sorghum event based on the hybridization result.

[0073] In the above method for detecting or assisting in detecting whether the plant sample to be tested is derived from the transgenic sorghum event, the 5'-end transformant detection primer pair can be a primer pair used to detect whether the sorghum genome contains a fragment of positions 625 to 650 of SEQ ID No.1. The upstream primer of the 5'-end transformant detection primer pair can be 5'-SBF1 (the nucleotide sequence is the single-stranded DNA of positions 157 to 177 in SEQ ID No.1), and the downstream primer of the 5'-end transformant detection primer pair can be 5'-SBR1 (the reverse complementary sequence of the single-stranded DNA of positions 964 to 987 in SEQ ID No.1). The 3'-end transformant detection primer pair can be a primer pair used to detect whether the sorghum genome contains a fragment of positions 12211 to 12236 of SEQ ID No.1. The upstream primer of the 3'-end transformant detection primer pair can be specifically 3'-SBF1 (single-stranded DNA at positions 11620-11641 in SEQ ID No. 1), and the downstream primer of the 3'-end transformant detection primer pair can be specifically 3'SBR1 (reverse complementary sequence of single-stranded DNA at positions 12275-12296 in SEQ ID No. 1).

[0074] The primer combination can be used to prepare a kit for detecting or assisting in detecting the transgenic sorghum event BrsT01, wherein the kit contains the primer combination described above.

[0075] The present invention also provides a method for detecting or assisting in detecting whether a plant sample to be tested is derived from the insect-resistant and / or herbicide-resistant transgenic sorghum, wherein the method is G1, G2 or G3, and G1 comprises the following steps:

[0076] G11) using the genomic DNA of the plant sample to be tested as a template and using the primer combination to perform PCR amplification to obtain a PCR product,

[0077] G12) determining whether the plant sample to be tested is derived from the insect-resistant and / or herbicide-tolerant transgenic sorghum according to the size of the PCR product in the following manner: if the PCR product contains a DNA fragment of an expected size, the plant sample to be tested is derived from the insect-resistant and / or herbicide-tolerant transgenic sorghum; if the PCR product does not contain a DNA fragment of the expected size, the plant sample to be tested is not derived from the insect-resistant and / or herbicide-tolerant transgenic sorghum;

[0078] The G2 comprises the following steps: sequencing the genomic DNA of the plant sample to be tested, and determining whether the plant sample to be tested is derived from the insect-resistant and / or herbicide-resistant transgenic sorghum according to the sequencing result;

[0079] The G3 comprises the following steps: performing Southern hybridization on the genomic DNA of the plant sample to be tested using a probe that can specifically bind to the recombinant DNA molecule of claim 4, and determining whether the plant sample to be tested is derived from the insect-resistant and / or herbicide-resistant transgenic sorghum according to the hybridization result.

[0080] In the above-mentioned method for detecting or assisting in detecting whether the plant sample to be tested is derived from the transgenic sorghum event and the method for detecting or assisting in detecting whether the plant sample to be tested is derived from the insect-resistant and / or herbicide-resistant transgenic sorghum, whether the plant sample to be tested is derived from the transgenic sorghum event or the insect-resistant and / or herbicide-resistant transgenic sorghum is determined according to the sequencing results. Specifically, if the sequencing results indicate that the plant sample to be tested contains the recombinant DNA molecule, the plant sample to be tested is derived from the transgenic sorghum event or from the insect-resistant and / or herbicide-resistant transgenic sorghum; if the sequencing results indicate that the plant sample to be tested does not contain the above-mentioned recombinant DNA molecule, the plant sample to be tested is not derived from the transgenic sorghum event or from the insect-resistant and / or herbicide-resistant transgenic sorghum. Determine whether the plant sample to be tested is derived from the transgenic sorghum event or the insect-resistant and / or herbicide-resistant transgenic sorghum based on the hybridization result. Specifically, if the hybridization result is that the probe binds to the genomic DNA, the plant sample to be tested is derived from the transgenic sorghum event or from the insect-resistant and / or herbicide-resistant transgenic sorghum; if the hybridization result is that the probe does not bind to the genomic DNA, the plant sample to be tested is not derived from the transgenic sorghum event or from the insect-resistant and / or herbicide-resistant transgenic sorghum.

[0081] The present invention also protects the primer composition specific to the above recombinant DNA molecule.

[0082] The application of the primer combination in any of the following items is also within the protection scope of the present invention:

[0083] J1) detecting or assisting in detecting whether the sample to be tested is derived from the transgenic sorghum event;

[0084] J2) Detect or assist in detecting whether the sample to be tested is derived from sorghum (Sorghum bicolor) BrsT01, whose deposit number at the General Microbiological Center of China Microbiological Culture Collection is CGMCC No.46082;

[0085] J3) Breeding transgenic sorghum that is insect-resistant and / or herbicide-tolerant;

[0086] J4) detecting or assisting in detecting whether the plant sample is derived from the insect-resistant and / or herbicide-tolerant sorghum;

[0087] J5) detecting or assisting in detecting whether the plant sample is derived from the insect-resistant and / or herbicide-tolerant transgenic sorghum.

[0088] The present invention also provides a processed product obtained from the above transgenic sorghum event or prepared from the above insect-resistant and / or herbicide-resistant transgenic sorghum.

[0089] The processed products do not belong to plants as defined in the Chinese Patent Law. They have no reproductive capacity and do not have the ability to survive by synthesizing carbohydrates and proteins from inorganic substances such as water, carbon dioxide and inorganic salts through photosynthesis.

[0090] The processed product can be flour, food (such as food produced by heat processing or cold processing, food produced by steaming or baking, such as bread, steamed bread, biscuits, noodles, etc., for example, fermented products, including beverages, alcoholic beverages, such as beer, liquor, alcohol, such as biofuels, etc.

[0091] The processed product can be food, cosmetics or fillers. The food can be sorghum flour, sorghum noodles, sorghum cakes and / or sorghum oil.

[0092] The breeding of insect-resistant and / or herbicide-tolerant transgenic sorghum may be specifically embodied as follows: sexually hybridizing the transgenic sorghum event BrsT01 or its progeny as the male parent with the female sorghum plant to produce a variety of first-generation progeny plants; performing insect resistance identification and glufosinate tolerance analysis on the first-generation progeny plants, screening out progeny plants with insect resistance and glufosinate tolerance, thereby breeding insect-resistant and herbicide-tolerant sorghum varieties. It may further include backcrossing the progeny plants with insect resistance and glufosinate tolerance with the female sorghum plant or other parent sorghum plants, and then screening the progeny by identifying insect resistance, glufosinate tolerance or identifying molecular markers related to the trait (such as specific DNA fragments contained in the transgenic sorghum event BrsT01), thereby obtaining insect-resistant and herbicide-tolerant sorghum plants.

[0093] Any of the above-mentioned insect-resistant and herbicide-resistant transgenic sorghum includes plants and seeds of transgenic sorghum event BrsT01 (transgenic sorghum with a deposit number of CGMCC No. 46082) and plant cells or regenerable parts thereof. The plant parts of the transgenic sorghum event BrsT01 include but are not limited to cells, pollen, ovules, flowers, buds, roots, stems, inflorescences, leaves and products from the transgenic sorghum event BrsT01.

[0094] The offspring of any of the above-mentioned insect-resistant and herbicide-resistant transgenic sorghums may be transgenic materials derived from the insect-resistant and herbicide-resistant transgenic sorghum as a parent, including derived offspring obtained by mutagenizing the insect-resistant and herbicide-resistant transgenic sorghum or hybridizing with other sorghums, or offspring derived from the mutagenized or hybridized offspring.

[0095] Any of the plant samples mentioned above includes not only all plant varieties that can be mated with sorghum, such as wild-type sorghum or its variants, but also cells, tissues and organs (such as seeds, leaves, fruits, flowers, stems and roots) derived from the plants and propagation materials (such as pollen, ovules, roots, root tips, hypocotyls, cotyledons, stems, leaves, flowers, anthers, seeds, meristematic cells, protoplasts and cell tissue culture) derived from the plants, but also processed products (agricultural products or commodities) with sorghum as the main raw material, such as sorghum flour, sorghum cakes, cosmetics or fillers, etc.

[0096] The invention provides an insect-resistant and herbicide-resistant transgenic sorghum BrsT01, wherein the insect-resistant and herbicide-resistant transgenic sorghum BrsT01 is obtained by inserting the exogenous DNA molecule shown in the 638-12223 positions of SEQ ID No.1 into the 59570307-59570370 positions of chromosome 8 of the genome of sorghum variety P184, and replacing the 62bp base sequence between the 59570307-59570370 positions of chromosome 8. The transgenic sorghum event BrsT01 has been deposited in the General Microbiological Center of China Microbiological Culture Collection Committee, and the deposit number is CGMCC No.46082. Experiments have proved that the transgenic sorghum event BrsT01 has higher resistance to lepidopteran insects such as cotton bollworm, corn borer and fall armyworm than wild sorghum, and has good tolerance to glufosinate herbicide. The present invention also establishes a PCR detection method for detecting whether the plant sample to be tested is derived from the transgenic sorghum BrsT01. The detection method can identify the junction area between the inserted exogenous DNA molecule and the plant genomic DNA, and can be further used to accurately and quickly identify whether the plant sample contains the DNA molecule of a specific transgenic sorghum event BrsT01, laying the foundation for the research on breeding insect-resistant and herbicide-resistant sorghum varieties with excellent traits.

[0097] Each transformant event has a specific exogenous insertion sequence and a junction sequence of the plant genome. The transformant event can be specifically and accurately identified by using the exogenous insertion sequence and the junction sequence of the plant genome as the detection target. The presence of the target transformant can be detected by transformant-specific PCR detection or Southern hybridization.

[0098] Collection Instructions

[0099] Classification: Sorghum

[0100] Latin name: Sorghum bicolor

[0101] Reference biological material: BrsT01

[0102] Depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0103] Abbreviation of depository institution: CGMCC

[0104] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0105] Date of deposit: July 3, 2024

[0106] CGMCC No.46082 BRIEF DESCRIPTION OF THE DRAWINGS

[0107] Figure 1 Schematic diagram of the structure of the plant expression vector pC33-VC.

[0108] Figure 2 To identify the insect resistance of transgenic sorghum BrsT01 CGMCC No.46082.

[0109] Figure 3 Schematic diagram of the structure used to detect the transgenic insertion sequence and sorghum genome integration site in transgenic sorghum BrsT01.

[0110] Figure 4 It is used to specifically detect the 5' end of the insertion site of transgenic sorghum BrsT01 CGMCC No.46082.

[0111] Figure 5 It is a sensitive PCR test for the 5' end of the insertion site of transgenic sorghum BrsT01 CGMCC No.46082.

[0112] Figure 6 It is used to specifically detect the 3' end of the insertion site of transgenic sorghum BrsT01 CGMCC No.46082.

[0113] Figure 7 It is a specific PCR sensitivity detection of the 3' end of the insertion site of transgenic sorghum BrsT01 CGMCC No.46082. DETAILED DESCRIPTION

[0114] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0115] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0116] For the operation steps not described in detail in the following examples, refer to the corresponding part of the third edition of "Molecular Cloning Laboratory Manual" (written by J. Sambrook and DW Russell, Science Press) or refer to the instructions of the kits used.

[0117] The reagent materials and sources involved in the following examples are as follows:

[0118] The pCloneEZ-TOPO cloning vector is a product of Sino-US Taihe Biotechnology (Beijing) Co., Ltd., with the product catalog number C5851.

[0119] The pJET-T TA cloning vector was purchased from Haiji Biotechnology Co., Ltd. with the catalog number D1901A.

[0120] The plasmid extraction kit is a product of Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number: DP103-03.

[0121] The DNA extraction kit is a product of Beijing Bomade Technology Development Co., Ltd., and the product catalog number is DN1501.

[0122] 2×EasyTaq PCR SuperMix is ​​a product of Beijing Quanshijin Biotechnology Co., Ltd., with the catalog number AS111-01.

[0123] The agarose gel purification and recovery kit is a product of Beijing Bomade Technology Development Co., Ltd., and the product catalog number is DR0101.

[0124] E. coli competent cells are products of Beijing Quanshijin Biotechnology Co., Ltd., with the catalog number of CD201-01.

[0125] Exonuclease ExoI is a product of NEB, with catalog number M0293V.

[0126] The pCamBIA3300 vector is a product of Beijing Crespo Biotechnology Co., Ltd., with the product catalog number being VT11938.

[0127] The YEB medium and its formula involved in the following examples are as follows: 1 g yeast extract, 5 g peptone, 5 g sucrose and 0.98 g MgSO4 were added to 800 mL deionized water in sequence. The mixture was thoroughly mixed with a magnetic stirrer, the pH was adjusted to 7.0, the volume was fixed to 1 L, and the temperature was 121 ° C, 1.034 × 10 5Sterilize with high temperature and high pressure for 15 min. After sterilization, store at 4°C. Add 1.25% agar powder to solid YEB medium before autoclaving.

[0128] The sorghum variety P184 involved in the following examples has been preserved in the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences for a long time and is included in GenBank with the accession number GenBank PQ444209.

[0129] Example 1. Acquisition and character identification of transgenic sorghum event BrsT01

[0130] 1.1 Obtaining transgenic sorghum plants by Agrobacterium-mediated transgenesis

[0131] 1.1.1 Construction of plant expression vector pC33-VC

[0132] 1) The gene sequences of maize ubiquitin promoter, nos terminator, insect-resistant genes Cry1Ab and Vip3A were queried from the NCBI website, and the gene sequences were optimized according to the preferred codons of plants, and the maize ubiquitin promoter, nos terminator, and codon-optimized Cry1Ab and Vip3A genes were artificially synthesized. In order to construct the vector, EcoRI and SpeI restriction sites and linker regions were added to the 5' end of the ubiquitin promoter, and a BamHI restriction site was added to the 3' end; a SacI restriction site was added to the 5' end of the nos terminator, and an EcoRI restriction site was added to the 3' end; a BamHI restriction site was added to the 5' end of the codon-optimized Cry1Ab and Vip3A genes, and a SacI restriction site was added to the 3' end.

[0133] 3) Primers were designed based on the ubiquitin promoter, nos terminator and optimized Cry1Ab gene sequence, and the fusion gene fragment ubi-Cry1Ab-nos was obtained by fusion PCR method, which was connected to the pJET-T TA cloning vector. After correct sequencing, the intermediate vector pJET-ubi-Cry1Ab was obtained.

[0134] 4) Primers were designed based on the ubiquitin promoter, nos terminator and optimized Vip3A gene sequence, and the fusion gene fragment ubi-Vip3A-nos was obtained by fusion PCR. After correct sequencing, it was connected to the pJET-T TA cloning vector to obtain the intermediate vector pVip3A.

[0135] 5) pJET-ubi-Cry1Ab and pVip3A were double-digested with BamHI and SacI, the target fragments were recovered respectively, and then connected to form the intermediate vector pJET-ubi-Vip3A.

[0136] 6) The pCamBIA3300 vector and the pJET-ubi-cry1Ab vector were digested with EcoRI, and the vector backbone of about 8.5 kb and the target fragment of about 4.8 kb of the Cry1Ab expression frame were connected to form the intermediate plant expression vector pC33-C.

[0137] 7) Based on the pC33-C vector sequence, homologous recombination specific primers Vip3A-F1 and Vip3A-R1 were designed, and the Vip3A expression cassette was amplified using pJET-ubi-Vip3A as a template, and the PCR product was recovered by gel.

[0138] 8) The pC33-C plasmid DNA was digested with SpeI, and the vector backbone fragment of about 13 kb was recovered by gel. The pC33-C vector backbone and the Vip3A expression frame fragment were connected using Takara's In-Fusion HD Cloning kits to obtain the plant expression vector pC33-VC.

[0139] The schematic diagram of the plant expression vector pC33-VC is as follows Figure 1 As shown. In this expression vector, the target gene bar is driven by the 35S promoter, and the expression is terminated by 35SPloyA. The Cry1Ab and Vip3A genes are driven by the ubiquitin promoter, and the expression is terminated by the nos terminator. pC33-VC is a recombinant vector obtained by replacing the DNA fragment between the Right border and the Left border of the pCamBIA3300 vector with an exogenous DNA molecule (T-DNA) having a nucleotide sequence shown at positions 638-12223 of SEQ ID No.1, while keeping the other nucleotide sequences of the pCamBIA3300 vector unchanged.

[0140] pC33-VC is an exogenous DNA molecule (T-DNA) containing the nucleotide sequence of SEQ ID No. 1, which is shown at positions 638 to 12223. Positions 727 to 901 of SEQ ID No. 1 are polyA nucleotide sequences; positions 908 to 1459 are the nucleotide sequences of the non-coding chain of the bar gene (phosphinothricin acetyl-CoA transferase encoding gene), and the bar gene encodes the following protein: the coding sequence (CDS) is SEQ ID The reverse complementary sequence of No.1 at positions 908-1459 encodes a protein composed of 183 amino acid residues; positions 1504-2181 are the CaMV35S promoter nucleotide sequence, positions 2511-2763 are the reverse complementary sequence of the nos terminator sequence, positions 2780-5158 are the nucleotide sequence of the non-coding chain of the Vip3A gene sequence, positions 5177-7173 are the reverse complementary sequence of the ubiquitin promoter sequence of the Vip3A gene, positions 7220-9209 are the ubiquitin promoter sequence of the Cry1Ab gene, positions 9228-11684 are the Cry1Ab gene sequence, and positions 11701-11953 are the nos terminator sequence.

[0141] 1.1.2 Preparation of Agrobacterium tumefaciens culture

[0142] The plant expression vector pC33-VC obtained in 1.1.1 was transformed into Agrobacterium tumefaciens EHA105 by freeze-thaw method. Pick a single colony of Agrobacterium EHA105 containing the plant expression vector pC33-VC and culture it in YEB medium at 28°C overnight. Pipette 1mL of bacterial solution and inoculate it into 100mL YEB medium and continue to culture at 28°C for 4-6 hours until the OD value is 0.6-0.8 for later use.

[0143] 1.1.3 Preparation of transgenic sorghum

[0144] Take the sorghum ears 9-12 days after pollination, remove the outer bracts, sterilize in 70% ethanol for 1 minute, and peel the immature embryos with a scalpel. Using the immature embryos as explants, the T-DNA in the plant expression vector pC33-VC was transferred into the genome of the recipient material sorghum variety P184 by Agrobacterium-mediated method to obtain T0 generation transgenic sorghum plants (numbered BrsT01). The specific operation steps of Agrobacterium-mediated genetic transformation of sorghum refer to the method in the literature "Jia Aimin, Zhang Ling, Jiang Qin, Hu Chong, Liu Jian. Study on Agrobacterium-mediated transformation of 2mG2-epsps gene into immature embryos of sorghum inbred line 18-599R, 2015, 33(3): 245-250".

[0145] 1.2 PCR detection of transgenic sorghum positive plants

[0146] The genomic DNA of BrsT01 was extracted using the new plant genomic DNA extraction kit of Beijing Kangwei Reagent Biotechnology Co., Ltd. in step 1.

[0147] Primers bar-F and bar-R were designed based on the bar gene sequence. The primer sequences are as follows:

[0148] bar-F: 5'-CGAGACAAGCACGGTCAACTTCCGTA-3';

[0149] bar-R: 5'-TGAAGTCCAGCTGCCAGAAACCCACG-3'.

[0150] Primers CRY1Ab-F1 and CRY1Ab-R1 were designed based on the Cry1Ab gene sequence. The primer sequences are as follows:

[0151] CRY1Ab-F1: 5'-TACGACTCCCGCACCTACCCGA-3';

[0152] CRY1Ab-R1: 5'-ACGTGGCTGAGCCTGTGGGAGA-3'.

[0153] Primers JC-Vip-F1 and JC-Vip-R1 were designed based on the Vip3A gene sequence. The primer sequences are as follows:

[0154] Vip-F1: 5'-AGATGATGAAGTTATCGCCCCAGGCT-3';

[0155] Vip-R1: 5'-CTCATCACCCTCACTTGCAAGTCAT-3'.

[0156] PCR amplification was performed using bar-F / bar-R, CRY1Ab-F1 / RY1Ab-R1 and Vip-F1 / Vip-R1 as primers and genomic DNA of transgenic sorghum plants as template. The PCR amplification program was as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 sec, 62°C annealing for 30 sec, 72°C amplification for 30 sec, 30 cycles; 72°C extension for 10 min.

[0157] At the same time, non-transgenic sorghum recipient material P184 and plant expression vector pC33-VC were used as controls.

[0158] The results showed that the target bands of approximately 419 bp, 551 bp and 490 bp could be amplified using the genomic DNA of the transgenic sorghum BrsT01 plant and the plant expression vector pC33-VC as templates, while no target bands were amplified in the non-transgenic control P184.

[0159] 1.3 Identification of insect resistance and analysis of glufosinate resistance in transgenic sorghum BrsT01

[0160] The T0 generation transgenic sorghum plants identified as positive by PCR were self-pollinated to obtain T1 generation transgenic sorghum. The surviving plants in the T1 generation transgenic sorghum line were self-pollinated to harvest seeds (called T2 generation seeds), and the seeds of the T2 generation transgenic sorghum line BrsT01 plants were deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on July 3, 2024, and the classification name was Sorghum bicolor, and the deposit number was CGMCC No. 46082, hereinafter referred to as Sorghum CGMCC No. 46082.

[0161] The experiment was repeated three times, and each repetition was as follows: When sorghum CGMCC No.46082 was in the 5-leaf stage, leaves of 5 sorghum CGMCC No.46082 and sorghum variety P184 were collected, and 3 leaves were collected from each plant and placed on a culture medium covered with moist filter paper. One leaf was placed in each culture dish and inoculated with 3 2nd-instar cotton bollworms, 3 corn borers, and 3 fall armyworms. When inoculating with insects, it was necessary to confirm that the larvae were in good vitality; after inoculation, the culture dishes were sealed and placed at room temperature of 25-28℃. The inoculation situation was recorded, and the results showed that the leaves of the non-transgenic recipient sorghum variety P184 material inoculated with cotton bollworms, corn borers, and fall armyworms were heavily eaten, while the leaves of sorghum CGMCC No.46082 were in good condition, and the larvae died (Table 1), indicating that sorghum CGMCC No.46082 has insect resistance to lepidopterans cotton bollworms, corn borers, and fall armyworms ( Figure 2 ). Figure 2 The middle control represents sorghum variety P184, and BrsT01 represents sorghum CGMCC No.46082.

[0162] Table 1 Identification of insect resistance of transgenic sorghum BrsT01

[0163]

[0164] The experiment was repeated 3 times, and each repetition was as follows: At the 5-leaf stage of sorghum CGMCC No. 46082, 2000 ppmol of glufosinate solution (10 mL of glufosinate with an active ingredient of 200 g / L was added to 1 L of water to obtain 2000 ppmol of glufosinate solution) was sprayed on the T1 generation transgenic sorghum, and the non-transgenic receptor material P184 was used as a control. An investigation was conducted 2 weeks later, and it was found that all the non-transgenic receptor material P184 sprayed with 2000 ppmol of the herbicide glufosinate died, while the survival rate of sorghum CGMCC No. 46082 was 100%, and the growth of the surviving plants was not inhibited.

[0165] Example 2: Molecular Characterization of Transgenic Sorghum Event BrsT01

[0166] 2.1 Cloning of the 5' flanking sequence of the integration site of the foreign gene in the recipient genome

[0167] 1. Use the new plant genomic DNA extraction kit of Beijing Kangwei Reagent Biotechnology Co., Ltd. to extract genomic DNA from sorghum CGM CC No.46082 leaves, and dilute the extracted DNA with water to a final concentration of 100 ng / μL.

[0168] 2. Design the following primers based on the known sequences near the left border of T-DNA in the plant expression vector used for sorghum transformation: F1, F2, F3, R2, R3, AD1, AD2, AD3 and AD4. All primers were synthesized by Shanghai Bioengineering Co., Ltd. The primers were dissolved in water to a final concentration of 100 μM. The specific primer sequences are as follows:

[0169] F1: 5'-gaggcacagggcttcaagagcgtg-3';

[0170] F2: 5'-gtccggtcctgcccgtcaccga-3';

[0171] F3: 5'-ggtttcgctcatgtgttgagc-3';

[0172] R2: 5'-tcaagagcgtggtcgctgtcatcg-3';

[0173] R3: 5'-ggcatgacgtgggtttctggcagc-3';

[0174] AD1: 5'-ggtttctggcagctggacBDDNNNTGGT-3';

[0175] AD2: 5'-ggtttctggcagctggacDVBNNNCTAG-3';

[0176] AD3: 5'-ggtttctggcagctggacBHHNNNACCT-3';

[0177] AD4: 5'-ggtttctggcagctggacHBHNNNCTC-3'.

[0178] Among them, D represents a or g or t; B represents g or c or t; H represents a or c or t; N represents a or g or c or t; V represents a or g or c.

[0179] 3. Add 2.5 μL of plant genomic DNA, 1 μL of upstream primer F1 (100 pM), 2 μL of random primer AD1 or AD2 or AD3 or AD4 (100 pM), 10 μL of 2×Mix PCR reaction solution to the PCR reaction tube, and finally add water to a final volume of 20 μL. After the reaction solution is mixed evenly, place it in a PCR instrument for PCR reaction. The reaction conditions are: 95℃6min; 94℃30sec, 58℃40sec, 72℃3min, 5 cycles; 94℃30sec, 25℃3min, 72℃3min, 1 cycle; 94℃30s, 58℃40sec, 72℃3min, 94℃30sec, 58℃40sec72℃3min, 94℃30s, 45℃40sec, 72℃3min8 cycles; 72℃6min, 12℃∞.

[0180] 4. Add 6 μL of the amplified product from step 3, 0.2 μL of exonuclease ExoI, 1 μL of reaction buffer and 2.8 μL of ddH2O to the PCR reaction tube. Mix the reaction solution evenly and place it in a PCR instrument for PCR reaction. The reaction conditions are: 37°C for 1.5 hours and 80°C for 20-30 minutes.

[0181] 5. Add 2 μL of the amplified product from step 4, 1 μL of upstream primer F2 (100 pM), 1 μL of downstream primer R2 (100 pM), 10 μL of 2×Buffer reaction solution, 0.8 μL of dNTP, 0.8 μL of enzyme, and finally add water to a final volume of 20 μL. After the reaction solution is mixed evenly, place it in a PCR instrument for PCR reaction. The reaction conditions are: 95℃6min; 94℃30sec, 60℃40s, 72℃3min, 5 cycles; 94℃30sec, 60℃40sec, 72℃3min, 30 cycles; 72℃6min, 12℃∞.

[0182] 6. Add 2 μL of the amplified product from step 5, 1.5 μL of upstream primer F3 (100 pM), 1.5 μL of downstream primer R3 (100 pM), 20 μL of 2×Buffer reaction solution, 1.6 μL of dNTP, 1.6 μL of enzyme, and finally add water to a final volume of 40 μL. After the reaction solution is mixed evenly, place it in a PCR instrument for PCR reaction. The reaction conditions are: 95℃6min; 94℃30sec, 54℃40sec, 72℃3min, 30 cycles; 72℃6min, 12℃∞.

[0183] 7. Perform electrophoresis on the fourth round of PCR reaction products and recover DNA bands larger than the known fragments. Connect the recovered DNA bands to the pCloneEZ-TOPO vector and select positive clones for sequencing.

[0184] 8. Through comparison and analysis by DNAman software, it was found that the obtained DNA fragment was a known sequence on the vector from the 3rd to 179th position from the 5' end. The DNA sequence shown in positions 180-816 was BLASTed on the NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PAGE_TYPE=BlastSearch&PROG_DEF=blastn&BLAST_SPEC=GDH_GCF_000003195.3) website, and it was found that this sequence could be aligned to chromosome 8 of the sorghum genome. The comparison results proved that the 5' flanking sequence of the insertion site of the exogenous gene in the transgenic sorghum BRST01 in the sorghum genome was obtained. The nucleotide sequence of the 5' flanking sequence is shown in SEQ ID No.1, positions 1-637.

[0185] 2.2 Cloning of the 3' flanking sequence of the integration site of the foreign gene in the recipient genome

[0186] The upstream sequence primer RB-F (5'-GGTTC ACTGGTTAAGGAATCTC-3') of the 3' flanking sequence was designed based on the sequence of BTx623 sorghum published online, and the primer RB-R (5'-ACAGCCACCACT TCTCCCTGGA-3') was designed based on the vector sequence of the right border of the inserted sequence. The genomic DNA of the transgenic sorghum BrsT01 leaf was used as a template, and the primers RB-F and RB-R were used for PCR amplification to obtain the 318 bp flanking sequence at the 3' end of the inserted sequence. The nucleotide sequence of the 3' end flanking sequence is shown in SEQ ID No. 1, positions 12224-12541.

[0187] 2.3 Molecular characteristics of the insect-resistant and herbicide-tolerant transgenic sorghum event BrsT01 CGMCC No.46082

[0188] The upstream and downstream flanking sequences of the insertion site obtained in step 1 and step 2 were compared with the published BTx623 sorghum genome sequence (Sorghum_bicolor_NCBIv3: https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PAGE_TYPE=BlastS earch&PROG_DEF=blastn&BLAST_SPEC=GDH_GCF_000003195.3), and it was found that sorghum CGMCC No.46082 was an exogenous DNA molecule shown in positions 638-12223 of SEQ ID No.1 (SEQ IDNo.1 is polyA nucleotide sequence at positions 727-901, bar gene non-coding nucleotide sequence at positions 908-1459, CaMV35S promoter nucleotide sequence at positions 1504-2181, nos terminator reverse complementary sequence at positions 2511-2763, Vip3A gene non-coding nucleotide sequence at positions 2780-5158, Vip3A gene ubiquitin promoter reverse complementary sequence at positions 5177-7173, Cry1Ab gene ub The transgenic sorghum was obtained by inserting the iquitin promoter sequence, the 9228-11684th position was the Cry1Ab gene sequence, and the 11701-11953th position was the nos terminator sequence) into the 59570307-59570370th position of chromosome 8 of the sorghum variety P184 genome, replacing the 62bp base sequence between the 59570307-59570370th position of chromosome 8 (the replaced sequence was TGTGGAAGCATGATAAAGGGGAGATGTGTTCTCTTGTTTTGGTTTTCTTCCGA ATGAATACT).

[0189] The transgenic sorghum event BrsT01 is the behavior of inserting the exogenous DNA molecule shown in positions 638-12223 of SEQ ID No.1 into the nucleotides 59570307-59570370 of chromosome 8 of the genome of sorghum variety P184, replacing the 62bp nucleotide sequence between positions 59570307-59570370 of chromosome 8 to obtain insect-resistant and herbicide-resistant transgenic sorghum.

[0190] Sorghum CGMCC No.46082 contains A 1-12541 Double-stranded DNA molecules ( Figure 3 ), A 1-12541The nucleotide sequence of one strand is SEQ ID No.1. In SEQ ID No.1, positions 638-12223 are foreign DNA molecules, position 637 is the upstream insertion site of the foreign DNA molecule (also known as the 5' end insertion site), position 12224 is the downstream insertion site of the foreign DNA molecule (also known as the 3' end insertion site), positions 1-637 are upstream flanking sequences (i.e., the sequence of the sorghum variety P184 genome), and positions 12224-12541 are downstream flanking sequences (i.e., the sequence in the sorghum variety P184 genome). The DNA molecule shown in SEQ ID No.1 contains two double-stranded DNA fragments including the upstream insertion site, namely A 625-650 and A 1-1081 , A 625-650 The nucleotide sequence of one strand is the 625th to 650th position in SEQ ID No.1 (5'-tcagtcttgcatctgtggtg taaaca-3'), A 1-1081 The nucleotide sequence of one strand is 1-1081 of SEQ ID No.1. The DNA molecule shown in SEQ ID No.1 contains two double-stranded DNA fragments including the downstream insertion site, namely A 12211-12236 and A 11897-12541 , A 12211-12236 The nucleotide sequence of one strand is shown in SEQ ID No. 1, positions 12211 to 12236 (5'-ttcagtttaaacttatgcatagccaa-3'), A 11897-12541 The nucleotide sequence of one strand is 11897-12541 of SEQ ID No. 1. 625-650 , A 1-1081 , A 12211-12236 and A 11897-12541 It can be used to identify whether the sorghum to be tested is derived from the transgenic sorghum event BrsT01, sorghum CGMCC No.46082 or their progeny.

[0191] Example 3: Analysis of the copy number of exogenous genes in the recipient genome

[0192] The hybridization kit used was the Southern hybridization kit DIG High Primer DNA Labeled and Detection Starter Kit Ⅱ produced by Roche, and the probe labeling used was the PCR DIG Probe Synthesis Kit kit that labeled the digoxigenin probe by PCR.

[0193] Extract genomic DNA from sorghum CGMCC No.46082 leaves, and perform single restriction digestion overnight with NcoI and HindIII, respectively. The total amount of genome in each restriction digestion reaction is more than 100 μg. After electrophoresis, transfer, wash and pre-hybridize. Using the plant expression vector pC33-VC plasmid as a template, PCR amplification was performed using Cry1Ab-F (5'-TACGACTCCCGCACCTACCCGA-3') and Cry1Ab-R (5'-ACGTGGCTGAGCCTGTGGGAGA-3') as primers. The amplified DNA fragment of 551 bp (i.e., SEQ ID No.1, positions 9975-10525) was recovered and sequenced as a labeled probe. Label the probe according to the instructions of the kit. In order to calculate the yield of the labeled probe, the OD of the probe solution was measured using a Thermo Scientific NanoDrop 2000C. 260 The absorbance value was calculated to obtain the mass concentration. After pre-hybridization, the labeled probe was added for hybridization at 55°C overnight. After overnight, 200 μL / cm2 of low stringency membrane wash solution was used. 2 Add to the hybridization bottle, wash the membrane at 42℃ for 5 minutes once, for a total of 2 times. After the low-stringency membrane wash is completed, wash the membrane with 30-50mL of high-stringency membrane wash solution at 65℃ for 15 minutes, and repeat once. Transfer the nylon membrane to a plate, pour in 30mL of membrane wash solution, and rinse at room temperature for 2 minutes. Pour out the membrane wash solution, add 30mL of blocking solution, and block at room temperature for at least 30 minutes. Pour out the blocking solution, add 20mL of antibody diluted at 1:10,000, and incubate at room temperature for about 30 minutes. Pour out the antibody dilution solution, wash the membrane with about 100mL of membrane wash solution for 15 minutes, and repeat once. Pour out the membrane wash solution, add 30mL of detection solution, and shake gently at room temperature for 3 minutes. Take out the nylon membrane and lay it flat on plastic wrap with the DNA side facing up. Every 100cm 2 Use 1mL of CSPD for the nylon membrane, carefully and evenly drip it onto the nylon membrane to completely wet the membrane surface. Cover with plastic wrap, gently remove bubbles and excess CSPD solution, carefully wrap the plastic wrap and transfer to the slide holder, incubate at 37°C for 10 minutes. In a dark room, place the X-ray film in the slide holder, contact it with the membrane, and expose the X-ray film for 1-10 minutes (depending on the exposure intensity). Take out the X-ray film, immerse it in the developer for about 1 minute, until clear bands appear, quickly transfer it to the fixer for about 5-10 minutes, then rinse the film with clean water, dry it and store it.

[0194] Southern analysis showed that only one DNA band could be obtained by hybridization after the genomic DNA of transgenic sorghum BrsT01 was digested with NcoI and HindIII, which proved that the exogenous gene in transgenic sorghum BrsT01 was inserted as a single copy.

[0195] Example 4: Establishment of a specific PCR detection system for herbicide-tolerant transgenic sorghum BrsT01 transformants

[0196] 4.1 Establishment of 5' end transformant specific PCR detection system

[0197] 1. Based on the flanking sequence at the 5' end of the exogenous gene insertion site of sorghum CGMCC No.46082, primers 5'-SBF1 and 5'-SBR1 for site-specific PCR detection of exogenous genes were designed.

[0198] 5′-SBF1 is a single-stranded DNA with the following nucleotide sequence: 5′-CCATTCTTGTTCTCCCGTGGC-3′;

[0199] 5'-SBR1 is a single-stranded DNA having the following nucleotide sequence: 5'-GGCATGACGTGGGTTTCTGGCAGC-3'. That is, 5'-SBF1 is a single-stranded DNA having a nucleotide sequence of positions 157 to 177 in SEQ ID No.1, and 5'-SBR1 is a single-stranded DNA having a nucleotide sequence that is reverse complementary to positions 964 to 987 in SEQ ID No.1.

[0200] Using the genomic DNA of sorghum CGMCC No.46082 as a template, 5'-SBF1 and 5'-SBR1 can be amplified to obtain double-stranded DNA fragment A 157-987 , A 157-987 The nucleotide sequence of one chain is from position 157 to position 987 of SEQ ID No. 1. 157-987 Contains A 625-650 5'-SBF1 and 5'-SBR1 can specifically PCR amplify the region near the upstream insertion site in the genome of sorghum CGMCC No.46082.

[0201] 2. Use the plant genomic DNA extraction kit to extract the leaf DNA of herbicide-resistant transgenic sorghum BrsT01 CGMCCNo.46082, non-transgenic recipient sorghum P184, soybean Zhongliandou 1505, rice Huahui No.1, cotton Zhongmiansuo 41, herbicide-resistant rapeseed MON88302, and corn Yufeng 303D. The specific operation is carried out according to the instructions of the kit. The extracted DNA is diluted with water to a final concentration of 100ng / μL.

[0202] 3. Using the DNA extracted in step 2 as a template, and using the 5'-SBF1 and 5'-SBR1 in step 1 in 4.1 as primers, perform PCR specific amplification of the region near the upstream insertion site in the genome of sorghum CGMCC No.46082. The reaction system is: 0.5μL Taq Polymerase (5U / μL), 5.0μL 10×PCR Buffer (Mg 2+ Plus), 5.0μL dNTP (2.5mM), 1μL each of 5'-SBF1 and 5'-SBR1 (10.0μM), 1μL template DNA, and make up the volume to 50μL with sterile ddH2O. The reaction conditions are: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30sec, 62℃ annealing for 30sec, 72℃ amplification for 30sec, 30 cycles; 72℃ extension for 10min.

[0203] 4. PCR products were detected by electrophoresis on 1% agarose gel.

[0204] The results showed that only when the genomic DNA of herbicide-tolerant transgenic sorghum BrsT01 CGMCC No.46082 was used as a template, the target DNA band of 831 bp could be amplified, while the corresponding target bands could not be amplified in other samples ( Figure 4 ). The target DNA band of 831 bp was recovered and sequenced, and its nucleotide sequence was shown at positions 157 to 987 in SEQ ID No.1.

[0205] 4.2 Sensitivity detection of 5' end transformants

[0206] The genomic DNA of sorghum P184 and the genomic DNA of transgenic sorghum BrsT01 were mixed according to mass percentage to prepare DNA solutions with transgenic sorghum BrsT01 DNA contents of 100%, 20%, 5%, 2%, 1%, 0.5%, 0.1% and 0% in sequence. PCR amplification was performed using the specific detection primers 5'-SBF1 / 5'-SBR1 with different concentrations of DNA solutions as templates, and the sensitivity of the analysis was analyzed by 1.0% agarose gel electrophoresis.

[0207] The results showed that primers 5'-SBF1 / 5'-SBR1 could still amplify a specific fragment of 831 bp when the concentration of transgenic sorghum BrsT01 DNA was diluted to 0.1% ( Figure 5 ). This shows that the detection sensitivity of the 5' end transformant can reach 0.1%.

[0208] 4.3 Establishment of 3' end transformant specific PCR detection system

[0209] 1. According to the flanking sequence at the 3' end of the exogenous gene insertion site of the herbicide-resistant transgenic BrsT01 CGMCC No.46082, primers 3'-SBF1 (single-stranded DNA at positions 11620 to 11641 in SEQ ID No.1) and 3'SBR1 (the reverse complementary sequence of the single-stranded DNA at positions 12275 to 12296 in SEQ ID No.1) for site-specific PCR detection of the exogenous gene were designed.

[0210] 3'-SBF1: 5'-ACAGCCACCACTTCTCCCTGGA-3';

[0211] 3'SBR1: 5'-GGTATGGCTTGTATTTAACAAG-3'.

[0212] Using the genomic DNA of sorghum CGMCC No.46082 as a template, 3'-SBF1 and 3'-SBR1 can be amplified to obtain double-stranded DNA fragment A 11620-12296 , A 11620-12296 The nucleotide sequence of one chain is from position 11620 to position 12296 of SEQ ID No. 1. 11620-12296 Contains A 12211-12236 3'-SBF1 and 3'-SBR1 can specifically PCR amplify the region near the downstream insertion site in the genome of sorghum CGMCC No.46082.

[0213] 2. Use the plant genomic DNA extraction kit to extract the leaf DNA of herbicide-resistant transgenic sorghum BrsT01 CGMCCNo.46082, non-transgenic recipient sorghum P184, soybean Zhongliandou 1505, rice Huahui No.1, cotton Zhongmiansuo 41, herbicide-resistant rapeseed MON88302, and corn Yufeng 303D. The specific operation is carried out according to the instructions of the kit. The extracted DNA is diluted with water to a final concentration of 100ng / μL.

[0214] 3. Using the DNA extracted in step 2 as a template, and using 3'-SBF1 and 3'SBR1 in step 1 as primers, perform 5' flanking sequence-specific PCR detection. The reaction system is: 0.5 μL Taq Polymerase (5U / μL), 5.0 μL 10×PCRBuffer (Mg 2+ Plus), 5.0μL dNTP (2.5mM), 1μL each of 3'-SBF1 and 3'SBR1 (10.0μM), 1μL template DNA, and make up the volume to 50μL with sterile ddH2O. The reaction conditions are: 95℃5min; 95℃30sec, 62℃30sec, 72℃30sec, 30 cycles; 72℃10min.

[0215] 4. PCR products were detected by electrophoresis on 1% agarose gel.

[0216] The results showed that only the genomic DNA of herbicide-tolerant transgenic sorghum BrsT01 CGMCC No.46082 was used as a template to amplify the target DNA band of 677 bp, while the corresponding target bands could not be amplified in other samples ( Figure 6 ). The 677 bp target DNA band was recovered and sequenced, and its nucleotide sequence is shown in positions 11619-12296 of SEQ ID No.1.

[0217] 4.4 Sensitivity detection of 3' end transformants

[0218] The genomic DNA of sorghum P184 and the genomic DNA of transgenic sorghum BrsT01 were mixed according to mass percentage to prepare DNA solutions with transgenic sorghum BrsT01 DNA contents of 100%, 20%, 5%, 2%, 1%, 0.5%, 0.1% and 0% in sequence. PCR amplification was performed using the specific detection primers 3'-SBF1 / 3'SBR1 with different concentrations of DNA solutions as templates, and the sensitivity of the analysis was analyzed by 1.0% agarose gel electrophoresis.

[0219] The results showed that the primer 3'-SBF1 / 3'SBR1 could still amplify a specific fragment of 677 bp when the concentration of transgenic BrsT01 DNA was diluted to 0.1% ( Figure 7 ). This shows that the detection sensitivity of the 3' end transformant can reach 0.1%.

[0220] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A method for breeding insect-resistant and / or herbicide-tolerant sorghum, comprising the following steps: using sorghum obtained from a transgenic sorghum event or its progeny as a parent material and hybridizing with another sorghum variety that does not have insect resistance and / or glufosinate tolerance to obtain an insect-resistant and / or herbicide-tolerant sorghum having higher insect resistance and / or glufosinate tolerance than the other sorghum variety; The transgenic sorghum event is the act of inserting exogenous DNA molecules into the target sorghum genome to obtain insect-resistant and / or herbicide-resistant transgenic sorghum; The upstream flanking sequence of the exogenous DNA molecule in the insect-resistant and / or herbicide-tolerant transgenic sorghum is any DNA fragment extending from the upstream insertion site in the upstream direction thereof; The downstream flanking sequence of the exogenous DNA molecule in the insect-resistant and / or herbicide-tolerant transgenic sorghum is any DNA fragment extending from the downstream insertion site in the downstream direction; The upstream insertion site is a site corresponding to the last nucleotide in the DNA molecule shown in positions 1-637 of SEQ ID No.1 contained in the target sorghum genome; The downstream insertion site is a site corresponding to the first nucleotide in the DNA molecule shown in positions 12224-12541 of SEQ ID No.1 contained in the target sorghum genome; The exogenous DNA molecule includes a gene encoding phosphinothricin acetyl-CoA transferase, a Vip3A insect-resistant gene and / or a Cry1Ab insect-resistant gene.

2. The method according to claim 1, characterized in that: The phosphinothricin acetyl-CoA transferase encoding gene encodes phosphinothricin acetyl-CoA transferase, and the phosphinothricin acetyl-CoA transferase is any one of the following proteins: A1) a protein whose coding sequence is the reverse complementary sequence of positions 908-1459 of SEQ ID No.1, A2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein described in A1) and having an identity of 80% or more with the protein described in A1) and capable of regulating plant herbicide resistance, A3) connecting the N-terminus or / and C-terminus of A1) or A2) to a protein tag to obtain a fusion protein; The Vip3A insect-resistant gene encodes a Vip3A protein, and the Vip3A protein is any of the following proteins: B1) a protein whose coding sequence is the reverse complementary sequence of positions 2780-5158 of SEQ ID No. 1, B2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein described in B1) and having an identity of 80% or more with the protein described in B1) and capable of regulating plant resistance to insects, B3) connecting the N-terminus or / and C-terminus of B1) or B2) to a protein tag to obtain a fusion protein; The Cry1Ab insect-resistant gene encodes the Cry1Ab protein, and the Cry1Ab protein is any of the following proteins: C1) a protein encoding the sequence of positions 9228 to 11684 of SEQ ID No. 1, C2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein described in C1) and having an identity of more than 80% with the protein described in C1) and capable of regulating plant resistance to insects, C3) A fusion protein obtained by connecting the N-terminus and / or C-terminus of C1) or C2) to a protein tag.

3. A method for producing insect-resistant and / or herbicide-tolerant transgenic sorghum, comprising the following steps: inserting the exogenous DNA molecule described in claim 1 or 2 into the genome of target sorghum to obtain insect-resistant and / or herbicide-tolerant transgenic sorghum; The upstream flanking sequence of the exogenous DNA molecule in the insect-resistant and / or herbicide-tolerant transgenic sorghum is any DNA fragment extending from the upstream insertion site in the upstream direction thereof; The downstream flanking sequence of the exogenous DNA molecule in the insect-resistant and / or herbicide-tolerant transgenic sorghum is any DNA fragment extending from the downstream insertion site in the downstream direction; The upstream insertion site is a site corresponding to the last nucleotide in the DNA molecule shown in positions 1-637 of SEQ ID No.1 contained in the target sorghum genome; The downstream insertion site is a site corresponding to the first nucleotide in the DNA molecule shown in positions 12224-12541 of SEQ ID No.1 contained in the target sorghum genome; The exogenous DNA molecule includes a gene encoding phosphinothricin acetyl-CoA transferase, a Vip3A insect-resistant gene and / or a Cry1Ab insect-resistant gene.

4. A recombinant DNA molecule comprising a nucleic acid fragment, wherein the nucleic acid fragment is any one of the following: K1) the nucleic acid fragment is a double-stranded DNA fragment or a single-stranded DNA fragment, the nucleotide sequence of one strand of the double-stranded DNA fragment is sequence 1; the nucleotide sequence of the single-stranded DNA fragment is the same as the nucleotide sequence of any strand of the double-stranded DNA fragment; K2) the nucleic acid fragment is a double-stranded DNA fragment or a single-stranded DNA fragment, the nucleotide sequence of one strand of the double-stranded DNA fragment is selected from sequence 1 and any sequence of the fragment containing the upstream insertion site and / or the downstream insertion site; the nucleotide sequence of the single-stranded DNA fragment is the same as the nucleotide sequence of any strand of the double-stranded DNA fragment; K3) the nucleic acid fragment is a double-stranded DNA fragment or a single-stranded DNA fragment, the nucleotide sequence of one strand of the double-stranded DNA fragment is selected from any sequence of 20 nt to 637 nt in length in positions 1 to 637 of SEQ ID No. 1, and the nucleotide sequence of the single-stranded DNA fragment is the same as the nucleotide sequence of any strand of the double-stranded DNA fragment; K4) the nucleic acid fragment is a double-stranded DNA fragment or a single-stranded DNA fragment, the nucleotide sequence of one strand of the double-stranded DNA fragment is selected from any fragment of 20 bp to 318 bp in length selected from positions 12224 to 12541 of SEQ ID No. 1, and the nucleotide sequence of the single-stranded DNA fragment is the same as the nucleotide sequence of any strand of the double-stranded DNA fragment; K5) The nucleic acid fragment is a double-stranded DNA fragment or a single-stranded DNA fragment, the nucleotide sequence of one strand of the double-stranded DNA fragment is selected from any sequence of nucleotides 638-12223 of SEQ ID No.1, and the nucleotide sequence of the single-stranded DNA fragment is the same as the nucleotide sequence of any strand of the double-stranded DNA fragment.

5. Use of the recombinant DNA molecule according to claim 4 in any of the following: D1) detecting or assisting in detecting whether the sample to be tested is derived from the transgenic sorghum event of claim 1 or 3; D2) Detect or assist in detecting whether the sample to be tested is derived from the genetically modified sorghum BrsT01. The classification name of BrsT01 is sorghum (Sorghum bicolor), and its deposit number in the General Microbiological Center of the China Microbiological Culture Collection Administration is CGMCC No. 46082; D3) Breeding insect-resistant and / or herbicide-tolerant transgenic sorghum; D4) detecting or assisting in detecting whether the plant sample is derived from the insect-resistant and / or herbicide-tolerant sorghum according to claim 1 or 2; D5) detecting or assisting in detecting whether the plant sample is derived from the insect-resistant and / or herbicide-tolerant transgenic sorghum as claimed in claim 3.

6. A method for detecting or assisting in detecting whether a plant sample to be tested is derived from the transgenic sorghum event of claim 1 or 2, wherein the method is M1, M2 or M3, wherein M1 comprises the following steps: M11) using the genomic DNA of the plant sample to be tested as a template and using the primer combination to perform PCR amplification to obtain a PCR product, M12) determining whether the plant sample to be tested is derived from the transgenic sorghum event according to the size of the PCR product in the following manner: if the PCR product contains a DNA fragment of an expected size, the plant sample to be tested is derived from the transgenic sorghum event; if the PCR product does not contain a DNA fragment of the expected size, the plant sample to be tested is not derived from the transgenic sorghum event; The primer composition comprises the following F1) or F2) or F3): F1) a 5'-end transformant detection primer pair, wherein the upstream primer of the 5'-end transformant detection primer pair is designed based on the nucleotide sequence of the fragment from position 1 to position 637 of SEQ ID No. 1, and the downstream primer is designed and obtained based on the exogenous DNA molecule described in claim 1 or 2; F2) a 3'-end transformant detection primer pair, wherein the upstream primer of the 3'-end transformant detection primer pair is designed according to the exogenous DNA molecule described in claim 1 or 2, and the downstream primer is designed according to the nucleotide sequence of the fragment of positions 12224-12541 of SEQ ID No.1; F3) the 5' end transformant detection primer pair and the 3' end transformant detection primer pair; The M2 comprises the following steps: sequencing the genomic DNA of the plant sample to be tested, and determining whether the plant sample to be tested is derived from the transgenic sorghum event of claim 1 or 2 according to the sequencing result; The M3 comprises the following steps: performing Southern hybridization on the genomic DNA of the plant sample to be tested using a probe that can specifically bind to the recombinant DNA molecule of claim 4, and determining whether the plant sample to be tested is derived from the transgenic sorghum event of claim 1 or 2 based on the hybridization result.

7. A method for detecting or assisting in detecting whether a plant sample to be tested is derived from the insect-resistant and / or herbicide-tolerant transgenic sorghum of claim 3, wherein the method is G1, G2 or G3, wherein G1 comprises the following steps: G11) using the genomic DNA of the plant sample to be tested as a template and using the primer combination to perform PCR amplification to obtain a PCR product, G12) determining whether the plant sample to be tested is derived from the insect-resistant and / or herbicide-resistant transgenic sorghum according to the size of the PCR product in the following manner: if the PCR product contains a DNA fragment of the expected size, the plant sample to be tested is derived from the insect-resistant and / or herbicide-resistant transgenic sorghum; if the PCR product does not contain the DNA fragment of the expected size, the plant sample to be tested is not derived from the insect-resistant and / or herbicide-resistant transgenic sorghum; The primer composition comprises the following F1) or F2) or F3): F1) a 5'-end transformant detection primer pair, wherein the upstream primer of the 5'-end transformant detection primer pair is designed based on the nucleotide sequence of the fragment from position 1 to position 637 of SEQ ID No. 1, and the downstream primer is designed and obtained based on the exogenous DNA molecule described in claim 1 or 2; F2) a 3'-end transformant detection primer pair, wherein the upstream primer of the 3'-end transformant detection primer pair is designed according to the exogenous DNA molecule described in claim 1 or 2, and the downstream primer is designed according to the nucleotide sequence of the fragment of positions 12224-12541 of SEQ ID No.1; F3) the 5' end transformant detection primer pair and the 3' end transformant detection primer pair; The G2 comprises the following steps: sequencing the genomic DNA of the plant sample to be tested, and determining whether the plant sample to be tested is derived from the insect-resistant and / or herbicide-resistant transgenic sorghum according to the sequencing result; The G3 comprises the following steps: performing Southern hybridization on the genomic DNA of the plant sample to be tested using a probe that can specifically bind to the recombinant DNA molecule of claim 4, and determining whether the plant sample to be tested is derived from the insect-resistant and / or herbicide-resistant transgenic sorghum according to the hybridization result.

8. A primer composition, characterized in that The primer composition is specific to the recombinant DNA molecule described in claim 4; the primer composition is the primer composition described in claim 6.

9. A processed product, characterized in that: The processed product is prepared from sorghum obtained from the transgenic sorghum event described in claim 1 or 2 or from the insect-resistant and / or herbicide-resistant transgenic sorghum described in claim 3. The processed products do not belong to plants as defined in the Chinese Patent Law. They have no reproductive capacity and do not have the ability to survive by synthesizing carbohydrates and proteins from inorganic substances such as water, carbon dioxide and inorganic salts through photosynthesis. The processed product can be flour, food (such as food made by hot processing or cold processing, food made by steaming or baking, such as bread, steamed buns, biscuits, noodles, etc., for example, fermented products, including beverages, alcoholic beverages, such as beer, liquor, alcohol, such as biofuels, etc. The processed product can be food, cosmetics or fillers. The food can be sorghum flour, sorghum noodles, sorghum cakes and / or sorghum oil.

10. Use of the primer combination described in claim 6 in any of the following: J1) detecting or assisting in detecting whether the sample to be tested is derived from the transgenic sorghum event of claim 1 or 2; J2) Detect or assist in detecting whether the sample to be tested is derived from sorghum (Sorghum bicolor) BrsT01, whose deposit number at the General Microbiological Center of China Microbiological Culture Collection is CGMCC No.46082; J3) Breeding transgenic sorghum that is insect-resistant and / or herbicide-tolerant; J4) detecting or assisting in detecting whether a plant sample is derived from the insect-resistant and / or herbicide-tolerant sorghum according to claim 1 or 2; J5) Detecting or assisting in detecting whether a plant sample is derived from the insect-resistant and / or herbicide-tolerant transgenic sorghum as claimed in claim 3.

Images