Application and method of OsProT2 gene in regulation and control of cadmium content, cadmium tolerance and yield of rice

Abstract

The invention belongs to the field of crop genetic breeding, and relates to application and a method of an OsProT2 gene in regulation and control of cadmium content, cadmium tolerance and yield of rice. The OsProT2 is knocked out, it is found that the Cd content of the overground part and root of rice is remarkably increased through the knockout strain, and the plant height and root growth of the rice under Cd stress are promoted; meanwhile, the Pro content of the overground part of the rice seedling is remarkably improved, the Pro content of the root of the rice seedling is reduced, the yield of the knockout strain is also improved, and a new gene resource is provided for cultivating high-yield and stress-tolerant rice varieties.

Description

Technical Field

[0001] The present invention belongs to the field of crop genetic breeding and relates to OsProT2 New applications of genes. Background Art

[0002] Cadmium (Cd) is a highly toxic heavy metal element that is widely present in nature. Due to the discharge of industrial "three wastes", sewage irrigation, and the use of cadmium-containing fertilizers and pesticides, a large amount of cadmium enters the soil environment, and rice has a strong ability to absorb and accumulate cadmium. Many studies have shown that when rice grows in cadmium-contaminated soil, its roots absorb cadmium and transport it to the aboveground part through the wood, and eventually accumulate in the rice. Eating rice with excessive cadmium content can cause serious harm to human health. Cadmium can accumulate in the human kidneys, liver and other organs. Long-term exposure may cause kidney diseases such as renal tubular damage and renal failure. It may also cause bone diseases such as osteoporosis and osteomalacia, which seriously affect food safety and human health.

[0003] Rice is one of the most important food crops in the world, providing staple food for about half of the world's population. With the continuous growth of the global population and the improvement of people's living standards, the demand for rice production is also increasing. Ensuring the steady growth of rice production is of irreplaceable importance to solving the problem of global food security. However, the increase in rice production faces many challenges. On the one hand, the area of ​​arable land is decreasing year by year, making the increase in yield per unit area a key way to meet the growing demand for food. On the other hand, rice is affected by a variety of biological and abiotic stresses during its growth. Biological stresses such as the invasion of pests and diseases will directly damage rice plants and reduce yields; abiotic stresses include drought, floods, high temperatures, low temperatures, and poor soil, which will affect the growth and development of rice, photosynthesis, nutrient absorption and other physiological processes, thereby restricting the increase in yield. For example, in arid areas, insufficient water leads to the stunting of rice growth, the reduction of the number of panicles, and the reduction of thousand-grain weight; in high temperature environments, the pollen vitality of rice decreases and the fruiting rate decreases.

[0004] In terms of regulating cadmium content in rice, some genes related to cadmium absorption, transport and detoxification have been identified. For example, some transporter genes such as OsNRAMP5 It was found that these genes are involved in the absorption of cadmium by rice, but regulating these single genes alone is often difficult to effectively regulate cadmium content without affecting other important agronomic traits of rice. Moreover, the stability of the regulatory effects of some genes in different rice varieties and under different environmental conditions needs further in-depth research.

[0005] The enhancement of rice tolerance under Cd stress is often caused by reduced Cd absorption or activated stress signals. There are no reports on promoting rice growth and increasing yield while increasing Cd content under Cd stress. Proline is an important stress response substance in rice. It is unclear whether the transport of proline and the genes that mediate proline transport can be used to regulate the Cd content and tolerance of rice plants under Cd stress, and its effect remains to be explored. Summary of the invention

[0006] In order to solve the above technical problems, the present invention proposes a OsProT2 Application and methods of genes in regulating rice cadmium content, cadmium tolerance and yield.

[0007] The technical solution of the present invention is achieved in this way: OsProT2 The application of genes in regulating Cd content in rice OsProT2 The gene nucleotide sequence has a similarity of more than 90% with the sequence shown in SEQ ID No.1.

[0008] Furthermore, the above OsProT2 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0009] The above application is silent OsProT2 The function of the gene is to achieve the purpose of increasing the Cd content in rice.

[0010] OsProT2 Application of genes in improving rice yield.

[0011] The above application is through silence OsProT2 The function of genes is achieved to increase rice yield.

[0012] The present application also provides a method for cultivating rice tolerant to cadmium stress by inhibiting or knocking out the OsProT2 Gene expression was regulated to obtain rice tolerant to cadmium stress.

[0013] The method for cultivating rice tolerant to cadmium stress is designed OsProT2 Gene knockout target site, construction OsProT2 The CRISPR-Ca9 knockout vector of the gene was used to obtain rice tolerant to cadmium stress using Agrobacterium-mediated genetic transformation.

[0014] Furthermore, the above rice is a japonica rice variety.

[0015] When the rice variety is ZH11, the sequence of the knockout target site is shown as SEQ ID No.2; when the rice variety is Nipponbare, the sequence of the knockout target site is shown as SEQ ID No.3.

[0016] When the target site sequence is shown as SEQ ID No.2, the oligonucleotide sequences used to construct the knockout vector are shown as SEQ ID No.4 and SEQ ID No.5; when the target site sequence is shown as SEQ ID No.3, the oligonucleotide sequences used to construct the knockout vector are shown as SEQ ID No.6 and SEQ ID No.7.

[0017] The present application also provides a primer set for identifying rice tolerant to cadmium stress cultivated using the above method. When the rice variety is ZH11, the primer set sequence is shown in SEQ ID No.8 and SEQ ID No.9; when the rice variety is Nipponbare, the primer set sequence is shown in SEQ ID No.10 and SEQ ID No.11.

[0018] The present invention has the following beneficial effects: 1. This application is constructed by OsProT2 Knockout mutant material confirmed OsProT2 The encoded transporter protein can regulate the Cd or Pro content in rice. OsProT2 Gene, the Cd content in the aboveground and roots of rice seedlings increased significantly during the Cd stress period, promoting the plant height and root growth of rice under Cd stress; at the same time, it significantly increased the Pro content in the aboveground part of rice seedlings and reduced the Pro content in the roots of rice seedlings. OsProT2 It may negatively regulate the Cd content in plants. OsProT2 The reduced Pro content in the roots of the mutant resulted in an increase in Cd content.

[0019] 2. OsProT2 It is a gene encoding a proline transporter that can promote the distribution of proline to the roots. The silencing of this gene function leads to a decrease in the proline content in the roots, thereby promoting the absorption of Cd. The silencing of this gene function also leads to an increase in the proline content in the aboveground part, thereby increasing Cd tolerance and promoting growth. The increase in the proline content in the aboveground part promotes rice growth, and a higher yield can be obtained at the harvest time, providing a new gene resource for the cultivation of high-yield and stress-resistant rice varieties. Compared with existing technologies, the use of silencing OsProT2 Gene, can achieve the change of proline distribution in roots and aboveground parts, so as to simultaneously increase Cd content and promote growth under Cd stress; moreover, this technology silences OsProT2 The gene can increase yield while improving Cd tolerance. OsProT2 It was found that the yield of the knockout lines was increased, providing new genetic resources for breeding high-yield and stress-resistant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 In order to use CRISPR technology to construct a OsProT2 Knock out genetic material.

[0022] Figure 2 Four different treatments: normal hydroponics, 0.5 mM Pro, 10 μM Cd, and 0.5 mM Pro+10 μM Cd. OsProT2 Phenotype diagram of mutant plants; Figure (A) is a statistical diagram of plant height of mutants under different treatments; Figure (B) is a statistical diagram of root length of mutants under different treatments; Figures (CF) are normal hydroponic, 0.5 mM Pro, 10 μM Cd and 0.5 mM Pro+10 μM Cd treatments respectively prot2 Phenotype diagram of the mutant with two leaves and one heart.

[0023] Figure 3 Processed for Cd or Cd+Pro OsProT2 Figure 2. Cd content in mutant plants; Figure (A) is OsProT2 (ZH11) mutant seedling cadmium content and individual plant cadmium content, Figure (B) OsProT2 (NIP) mutant seedling cadmium content and individual plant cadmium content.

[0024] Figure 4 Normal hydroponic culture or 10 μM Cd treatment OsProT2 Pro content in mutant plants. OsProT2 Pro content in the aboveground part of (ZH11) mutant seedlings. Figure (B) OsProT2 (ZH11) mutant seedling root Pro content; Figure (C) OsProT2 (D) Pro content in the aboveground part of the (NIP) mutant seedlings. OsProT2 Pro content in roots of (NIP) mutant seedlings.

[0025] Figure 5 for OsProT2 (ZH11) Field phenotype of mutant material. The scale bar in Figure (A) is 10 cm.

[0026] Figure 6 for OsProT2 (NIP) Field phenotype of mutant material. The scale bar in Figure (A) is 10 cm. DETAILED DESCRIPTION

[0027] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] Unless otherwise specified, the experimental methods used in the following experimental examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified. Example

[0029] 1. Test Materials In November 2020 and April 2018, CRISPR-Cas9 gene editing technology was used to edit the ZH11 and NIP varieties, respectively. OsProT2 Gene sequence analysis showed that the ZH11 knockout target site was designed as SEQ ID No. 2: ttaggctggattggtgggac, and the Nipponbare knockout target site was designed as SEQ ID No. 3: gacactgtccaggtctccga.

[0030] Oligonucleotides SEQ ID No.4: TGATTGTTAGGCTGGATTGGTGGGA (ZH11-CrProT2-UP) and SEQ ID No.5: AAACTCCCACCAATCCAGCCTAACA (ZH11-CrProT2-LOW) were synthesized, primer dimers were prepared according to conventional methods and ligated into vector BGK032 (for vector information and construction methods, see the literature description Lu, Yuming et al. Genome-wide Targeted Mutagenesis in Rice Using the CRISPR / Cas9 System, Molecular Plant, Volume 10, Issue 9, 1242 – 1245), and the CRISPR-Cas9 knockout vector in the ZH11 background was obtained.

[0031] Oligonucleotides SEQ ID No.6: TGTGTGACACTGTCCAGGTCTCCG (NIP-CrProT2-UP) and SEQ ID No.7: AAACCGGAGACCTGGACAGTGTCCA (NIP-CrProT2-LOW) were synthesized, primer dimers were prepared according to conventional methods and ligated into vector BGK03 (for vector information and construction methods, see the literature description Lu, Yuming et al. Genome-wide Targeted Mutagenesis in Rice Using the CRISPR / Cas9 System, Molecular Plant, Volume 10, Issue 9, 1242 – 1245) to obtain the CRISPR-Cas9 knockout vector in the Nipponbare background.

[0032] We commissioned BioGene to carry out genetic transformation on ZH11 and NIP to obtain T0 transgenic seedlings. After the test tube seedlings grew stably, we amplified the target fragments and sequenced the transgenic strains to screen and obtain effective knockout mutant materials.

[0033] 2. Identification of mutant materials DNA extraction: using TGFast TM Plant Genome Rapid Extraction Kit (Catalog Number: TM0301) was used and the procedure was followed according to the instruction manual.

[0034] Identification of mutant genotype: Design a pair of specific primers for the target site of CRISPR material: ZH11 Background: SEQ ID No.8: TCGATCCTTAAGTCTTCCTAGCC(Cr-ProT2-ZH11F3); SEQ ID No.9: GCAGAGCCCATGTAAGCGAATACA(Cr-ProT2-ZH11R3); Japanese sunny background: SEQ ID No.10: TGGCTAAGGAACAACCAGTGT(GP3748-3018-F); SEQ ID No. 11: GCTACTTTTGTGGGGGTGCT (GP3748-3018-R).

[0035] The mutant genotype was detected. Using DNA as a template, PCR amplified the gene fragment, and after entrusting Qingke Biotechnology Company to sequence it, the amplified fragment sequence was compared using SnapGene software, and the mutant genotype was screened. OsProT2For mutant plants with a deletion or increase in the gene target site sequence that is not an integer multiple of 3, the ZH11 background mutant was named C④-16 (2bp deletion), C9 (59bp deletion), C13 (1bp deletion), and the Nipponbare background mutant was named LH34 (1bp insertion). Figure 1 shown.

[0036] Application example: Rice cultivation 1. Hydroponics in the seedling stage Seed germination: Soak the rice seeds in tap water for 2-3 days to allow them to fully absorb water until they turn white. Then spread them evenly in a germination dish and culture them in a 30°C incubator in the dark for 1-2 days until the seeds grow young embryos and radicles.

[0037] Seedling culture: Seeds with consistent germination were selected and planted in a 96-well plant hydroponic box. They were cultured normally for 3 days in an artificial climate chamber simulating natural light conditions (14 h, 30 ℃ during the day, 10 h, 26 ℃ at night, and light intensity of 30 000 Lx) using Yoshida rice nutrient solution, and the treatment solution was changed. The treatment solution was a normal nutrient solution with different concentrations of CdCl2 and proline added, of which CK was a normal nutrient solution; Cd treatment was a normal nutrient solution with 10 μM CdCl2 added, Pro treatment was a normal nutrient solution with 0.5 mM Pro added; Cd+Pro treatment was a normal nutrient solution with 10 μM CdCl2 and 0.5 mMPro added. The indicators were observed and measured when the seeds were cultured to the two-leaf and one-heart stage.

[0038] Table 5 Composition of normal nutrient solution for rice 2. Determination of growth indicators at the seedling stage Plant height measurement: Use a ruler to measure the distance from the base of the plant to the tip of the highest leaf, which is the plant height.

[0039] Root length measurement: Use a ruler to measure the distance from the base of the plant to the top of the root tip, which is the root length.

[0040] Phenotypic photos: obtained directly by taking photos.

[0041] like Figure 2 We found that compared with the control, the mutant OsProT2 In normal hydroponic culture, 10 μM Cd and 0.5 mMPro+10 μM Cd treatments, the plant height was significantly higher than the control, and the root length was also significantly longer than the control. Among them, under normal hydroponic conditions, compared with the wild type ZH11, prot2 The plant heights of the mutants were extended by 8.99%, 7.09%, and 5.66%, respectively. prot2The root lengths of the mutants were extended by 19.30%, 23.34%, and 10.43%, respectively; under cadmium stress, compared with the wild type ZH11, prot2 The plant heights of the mutants were extended by 16.51%, 18.43%, and 23.50, respectively. prot2 The root lengths of the mutants were extended by 152.95%, 157.74%, and 163.87% respectively; under Pro+Cd conditions, compared with the wild type ZH11, prot2 The plant heights of the mutants were extended by 14.76%, 12.77%, and 14.89, respectively. prot2 The root lengths of the mutants were elongated by 20.29%, 23.31%, and 21.69%, respectively.

[0042] Determination of Cd ion content: Will prot2 (ZH11) mutant materials C④-16, C13, C9 and wild-type ZH11, and prot2 (NIP) Mutant material LH34 and wild-type NIP were taken out of the hydroponic box, soaked in ultrapure water for about 30 s, repeated 3 times, washed away impurities, and then soaked in 5 mM EDTA-2Na solution for 15 min to completely remove ions on the plant surface. New ultrapure water was used to wash 3 times to wash away the EDTA-2Na solution on the plant surface. The plant was dried with a paper towel, and the aboveground part of the seedling (all parts of the plant 2 cm above the root base) and the root were taken to a 10 mL centrifuge tube, and then fixed in a 105 ℃ oven for 30 min, and then dried in an 85 ℃ oven for 3 d. Steel balls were placed in the centrifuge tube containing the dried sample, and the high-throughput grinder was used to grind it at 40 HZ for 12 min. 0.05 g of powder sample was weighed and placed in a cell flow tube that is resistant to high temperature and acid and alkali. 1 mL of nitric acid was added to each sample tube, and after shaking and mixing, it was placed in a fume hood for overnight static digestion. The digested sample was placed in a 100 ℃ water bath and boiled until the sample was clear and transparent. The digested samples were diluted 10 times with ultrapure water for testing, and the Cd ion content was determined using an inductively coupled plasma mass spectrometer (PerkinElmer NexION 300).

[0043] The results are as follows Figure 3 As shown in Figure 2, under Cd stress, whether or not exogenous proline was applied, OsProT2 The Cd content in the shoots and roots of the mutant was increased. prot2 The Cd content in the aboveground part of the mutants increased by 319.01%, 288.55%, and 207.50%, respectively. prot2 The Cd content in the roots of the mutants increased by 179.74%, 179.19%, and 103.60%, respectively; compared with the wild type Nipponbare, prot2 The Cd content in the aboveground part of the mutant increased by 56.11%. prot2 The Cd content in the roots of the mutant increased by 37.35%; under the Cd+Pro treatment, compared with the wild type ZH11, prot2 The Cd content in the aboveground part of the mutants increased by 34.95%, 45.46%, and 41.36%, respectively. prot2 The Cd content in the roots of the mutants increased by 19.74%, 21.14%, and 23.67%, respectively; compared with the wild type Nipponbare, prot2 The Cd content in the aboveground part of the mutant increased by 52.30%. prot2 The Cd content in the roots of the mutant increased by 33.44%.

[0044] Proline content determination: Will prot2 (ZH11) mutant materials C④-16, C13, C9 and wild-type ZH11, and prot2 (NIP) mutant material LH34 and wild-type NIP were taken out of the hydroponic box when they had two leaves and one heart in normal culture and Cd treatment, and soaked in ultrapure water for about 30 seconds, repeated 3 times, washed to remove impurities, and dried the plants with paper towels. The aboveground part of the seedlings (all parts of the plant 2 cm above the root base) and the roots were taken to 10 mL centrifuge tubes, and then fixed in a 105 ℃ oven for 30 minutes and then dried in an 85 ℃ oven for 3 days. Steel balls were placed in the centrifuge tube containing the dried samples, and crushed for 12 minutes using a high-throughput grinder at 40 HZ. The proline content was determined by referring to the UV spectrophotometer method. 0.1 g of powder samples were weighed and placed in large test tubes, 5 mL of 3% sulfosalicylic acid was added, and the tubes were covered with glass balls, and extracted in a boiling water bath for 10 minutes. Remove the test tube, wait for it to cool to room temperature, then pipette 2 mL of the supernatant into another stoppered test tube, add 2 mL of glacial acetic acid and 3 mL of color developing solution, and heat in a boiling water bath for 40 min. Remove and cool, add 5 mL of toluene to each tube and shake thoroughly to extract the red substance. Let it stand, wait for the toluene layer to separate, and use the blank tube as a control, and compare the color at a wavelength of 520 nm.

[0045] The results are as follows Figure 4 As shown, in both cases compared with wild type OsProT2 The Pro content in the aboveground part of the mutants was significantly increased, while the Pro content in the roots was significantly decreased. prot2 The Pro content in the aboveground part of the mutants increased by 33.72%, 29.36%, and 47.74%, respectively. prot2 The Pro contents in the roots of the mutants decreased by 16.67%, 33.73%, and 22.95%, respectively; compared with the wild-type Nipponbare, prot2 The Pro content in the aboveground part of the mutant increased by 12.71%. prot2The Pro content in the mutant roots was reduced by 41.41% under Cd stress conditions compared with the wild type ZH11. prot2 The Pro content in the aboveground part of the mutants increased by 42.73%, 48.38%, and 68.25%, respectively. prot2 The Pro contents in the roots of the mutants decreased by 9.40%, 21.78%, and 37.78%, respectively; compared with the wild-type Nipponbare, prot2 The Pro content in the aboveground part of the mutant increased by 11.05%. prot2 The Pro content in the roots of the mutant was reduced by 23.95%, suggesting that increasing the Pro content in the aboveground parts and reducing the Pro content in the roots were beneficial to increasing Cd tolerance and plant Cd content.

[0046] 3. Determination of agronomic traits in the field Soak the rice seeds in tap water for 2-3 days to fully absorb water until they turn white, then evenly spread them in a germination dish and culture them in a dark incubator at 30°C for 1-2 days until the seeds grow tender embryos and radicles. Sow them in the soil on March 26, 2024, transplant them on April 27, 2024, and manage them with water, fertilizer, pests and diseases normally until harvest.

[0047] Single plant yield determination: The harvested seeds are threshed and dried, and then the rice yield is statistically analyzed using the SC-G automatic seed meter.

[0048] The yield performance during the harvest period is as follows Figure 5 As shown, OsProT2 (ZH11) mutant has increased yield per plant. OsProT2 Loss of gene function can increase yield. OsProT2 The (NIP) mutant also showed similar behavior ( Figure 6 ), compared with wild-type NIP, OsProT2 The plant weight of the (NIP) mutant increased compared with the wild-type ZH11 and NIP. prot2 The yield of the mutants increased by more than 20%.

[0049] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. OsProT2 The application of genes in regulating the cadmium content of rice is characterized by: Said OsProT2 The gene nucleotide sequence has a similarity of more than 90% with the sequence shown in SEQ ID No.

1.

2. according to claim 1 OsProT2 The application of genes in regulating the cadmium content of rice is characterized by: Said OsProT2 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

3. The method according to claim 1 or 2 OsProT2 The application of genes in regulating the cadmium content of rice is characterized by: The application is through silence OsProT2 The function of the gene is to achieve the purpose of increasing the cadmium content in rice.

4. OsProT2 Application of genes in improving rice yield.

5. According to claim 4 OsProT2 The application of the gene in increasing rice yield is characterized in that: Steps: Through silence OsProT2 The function of genes is achieved to increase rice yield.

6. A method for cultivating rice tolerant to cadmium stress, characterized in that: By suppressing or knocking out OsProT2 Gene expression was regulated to obtain rice tolerant to cadmium stress.

7. A method for cultivating rice tolerant to cadmium stress, characterized in that: Steps: Design OsProT2 Gene knockout target site, construction OsProT2 The CRISPR-Ca9 knockout vector of the gene was used to obtain rice tolerant to cadmium stress using Agrobacterium-mediated genetic transformation.

8. The method for cultivating rice tolerant to cadmium stress according to claim 7, characterized in that: The rice is a japonica rice variety.

9. The method for cultivating rice tolerant to cadmium stress according to claim 8, characterized in that: When the rice variety is ZH11, the knockout target site sequence is shown in SEQ ID No. 2; When the rice variety is Nipponbare, the knockout target site sequence is shown as SEQ ID No.

3.

10. The method for cultivating rice tolerant to cadmium stress according to claim 9, characterized in that: When the knockout target site sequence is shown as SEQ ID No.2, the oligonucleotide sequences used to construct the knockout vector are shown as SEQ ID No.4 and SEQ ID No.5; when the knockout target site sequence is shown as SEQ ID No.3, the oligonucleotide sequences used to construct the knockout vector are shown as SEQ ID No.6 and SEQ ID No.7.

Images