Method for simultaneously adjusting plant height and flowering time of soybeans and application of method

Abstract

The invention relates to the technical field of biology, and particularly provides a method for simultaneously adjusting soybean plant height and flowering time and application of the method. The method comprises the following steps: knocking out any one or more of the following genes in soybeans: GmPHDLa, GmPHDLb, GmPHDLc or GmPHDLd; wherein the nucleotide sequence of the GmPHDLa gene is SEQ ID NO: 1; the nucleotide sequence of the GmPHDLb gene is SEQ ID NO: 2; the nucleotide sequence of the GmPHDLc gene is SEQ ID NO: 3; and the nucleotide sequence of the GmPHDLd gene is SEQ ID NO: 4. When the gene in the soybean is knocked out, the plant height of the soybean is reduced, and the flowering time is delayed. The plant height and the flowering time of the soybeans are regulated and controlled, so that the plants are more suitable for the local growth environment, and the yield of the soybeans is increased.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for simultaneously regulating soybean plant height and flowering time and application thereof. Background Art

[0002] Dwarf plants can make full use of arable land, enhance photosynthetic efficiency, resist lodging, and resist diseases and pests, thereby increasing yields and increasing the output value per unit area. Therefore, dwarf breeding and cultivation have become a hot research direction for crops today. Especially in the face of extreme climates, soybean plants have several advantages when they are shorter: on the one hand, they can improve the efficiency of water and nutrient absorption; on the other hand, they can reduce losses caused by lodging and ensure yield stability. In some cases, slower growth rates may extend the growth period, allowing plants to obtain more photosynthetic products in a suitable environment, which also helps to increase production. At the same time, in agricultural production, shorter plants are easier to manage mechanically, are easy to operate, and reduce production costs. Overall, the dwarf cultivation characteristics of soybeans can enhance the crop's resistance to adversity, resource utilization, and economic benefits under certain conditions.

[0003] Flowering is a key link in the plant growth cycle, and plants need to integrate internal factors with external signals to determine the best flowering period. This process is essential for plant reproduction, and in crops, it is directly related to yield. Delaying the flowering time of soybeans also has many benefits: on the one hand, it can better adapt to adverse environments such as drought and low temperatures, and reduce the risk of flowering under harsh climatic conditions; on the other hand, selecting late-flowering varieties according to the climatic conditions of different regions can improve the adaptability of planting. Therefore, the late flowering characteristics of soybeans have significant advantages in agricultural production, especially in responding to climate change and increasing crop yields.

[0004] At present, the known genes that control soybean plant height include Dt1, Dt2 and DW1, and the genes that regulate soybean flowering time include E1, GmFT2a and GmFT5a. However, in addition to these known genes, there are many other genes, especially those that can regulate plant height and flowering time at the same time, which are rarely discovered. Summary of the invention

[0005] The main purpose of the present invention is to provide a method for simultaneously regulating soybean plant height and flowering time and its application, so as to solve the problem that there is a lack of methods for simultaneously regulating soybean plant height and delaying soybean flowering time in the prior art.

[0006] To achieve the above object, according to a first aspect of the present invention, a method for simultaneously regulating soybean plant height and flowering time is provided, the method comprising: knocking out any one or more of the following genes in soybean: GmPHDLa, GmPHDLb, GmPHDLc or GmPHDLd;

[0007] Wherein, the nucleotide sequence of the GmPHDLa gene is SEQ ID NO: 1;

[0008] The nucleotide sequence of the GmPHDLb gene is SEQ ID NO: 2;

[0009] The nucleotide sequence of the GmPHDLc gene is SEQ ID NO: 3;

[0010] The nucleotide sequence of the GmPHDLd gene is SEQ ID NO:4.

[0011] Furthermore, gene editing is used to perform knockout to obtain soybeans with any one or more of the following genes knocked out: GmPHDLa, GmPHDLb, GmPHDLc or GmPHDLd.

[0012] Furthermore, the CRISPR-Cas9 gene editing system was used for knockout.

[0013] Furthermore, the CRISPR-Cas9 gene editing system includes sgRNA; sgRNA includes:

[0014] sgRNA1 or sgRNA2 targeting the GmPHDLa gene;

[0015] sgRNA5 or sgRNA2 targeting the GmPHDLb gene;

[0016] sgRNA3 or sgRNA4 targeting the GmPHDLc gene;

[0017] sgRNA6 or sgRNA4 targeting the GmPHDLd gene;

[0018] Among them, the nucleotide sequence of sgRNA1 is SEQ ID NO: 5; the nucleotide sequence of sgRNA2 is SEQ ID NO: 6; the nucleotide sequence of sgRNA3 is SEQ ID NO: 7; the nucleotide sequence of sgRNA4 is SEQ ID NO: 8; the nucleotide sequence of sgRNA5 is SEQ ID NO: 59; and the nucleotide sequence of sgRNA6 is SEQ ID NO: 66.

[0019] Further, the GmPHDLa gene is knocked out by any of the following methods: deleting the T base at position 9344 of the nucleotide sequence of the GmPHDLa gene;

[0020] The A base at position 10054 of the nucleotide sequence of the GmPHDLa gene is missing;

[0021] There is a deletion of 28 bases from position 10041 to 10068 in the nucleotide sequence of the GmPHDLa gene;

[0022] Or 662 bases from position 9413 to 10074 of the nucleotide sequence of the GmPHDLa gene are deleted.

[0023] Further, the GmPHDLb gene is knocked out by any of the following methods: adding an A base between the 3486th and 3487th positions of the nucleotide sequence of the GmPHDLb gene;

[0024] The A base at position 3486 and the G base at position 3487 of the nucleotide sequence of the GmPHDLb gene are missing;

[0025] There is a deletion of 10 bases from position 3477 to 3486 in the nucleotide sequence of the GmPHDLb gene;

[0026] Or the C base at position 2716 in the nucleotide sequence of the GmPHDLb gene is deleted.

[0027] Further, the GmPHDLc gene is knocked out by any of the following methods: adding a T base between the 2735th and 2736th positions of the nucleotide sequence of the GmPHDLc gene;

[0028] Add a T base between positions 2576 and 2577 in the nucleotide sequence of the GmPHDLc gene;

[0029] The T base at position 2576 of the nucleotide sequence of the GmPHDLc gene is deleted;

[0030] Or, 5 bases from position 2576 to position 2580 of the nucleotide sequence of the GmPHDLc gene are deleted.

[0031] Further, the GmPHDLd gene is knocked out by any of the following methods: deleting three bases from position 2494 to position 2496 of the nucleotide sequence of the GmPHDLd gene;

[0032] There is a deletion of 3 bases from position 2654 to 2656 in the nucleotide sequence of the GmPHDLd gene;

[0033] There is a deletion of 4 bases from position 2655 to 2658 in the nucleotide sequence of the GmPHDLd gene;

[0034] There is a deletion of 7 bases from position 2491 to 2497 in the nucleotide sequence of the GmPHDLd gene;

[0035] There is a deletion of 10 bases from position 2494 to 2503 in the nucleotide sequence of the GmPHDLd gene;

[0036] A 37-base deletion was found at positions 2494 to 2530 in the nucleotide sequence of the GmPHDLd gene;

[0037] Add 33 bases between positions 2495 and 2496 of the nucleotide sequence of the GmPHDLd gene;

[0038] Or, 9 bases from position 2484 to position 2492 of the nucleotide sequence of the GmPHDLd gene are deleted.

[0039] Furthermore, the method includes: knocking out the following gene combination in soybean: GmPHDLc+GmPHDLd or GmPHDLa+GmPHDLb+GmPHDLc+GmPHDLd.

[0040] Furthermore, the GmPHDLc+GmPHDLd genes were knocked out in the following manner: one T base was added between the 2576th and 2577th positions of the nucleotide sequence of the GmPHDLc gene and 10 bases were deleted from the 2494th to the 2503rd positions of the nucleotide sequence of the GmPHDLd gene.

[0041] Furthermore, the following method was used to knock out the GmPHDLa+GmPHDLb+GmPHDLc+GmPHDLd genes:

[0042] 1) A 28-base deletion from position 10041 to 10068 in the nucleotide sequence of the GmPHDLa gene;

[0043] Add an A base between positions 3486 and 3487 of the nucleotide sequence of the GmPHDLb gene;

[0044] Add a T base between positions 2735 and 2736 of the nucleotide sequence of the GmPHDLc gene;

[0045] and a 4-base deletion from position 2655 to 2658 of the nucleotide sequence of the GmPHDLd gene;

[0046] or

[0047] 2) 662 bases from position 9413 to 10074 of the nucleotide sequence of the GmPHDLa gene were deleted;

[0048] There is a deletion of 10 bases from position 3477 to 3486 in the nucleotide sequence of the GmPHDLb gene;

[0049] Add a T base between positions 2735 and 2736 of the nucleotide sequence of the GmPHDLc gene;

[0050] And a 4-base deletion from position 2655 to 2658 in the nucleotide sequence of the GmPHDLd gene.

[0051] In order to achieve the above object, according to a second aspect of the present invention, there is provided an application of the above method for simultaneously regulating soybean plant height and flowering time in soybean planting.

[0052] By applying the technical scheme of the present invention, any one or more of the following genes in soybean are knocked out: GmPHDLa, GmPHDLb, GmPHDLc or GmPHDLd; wherein the nucleotide sequence of the GmPHDLa gene is SEQ ID NO: 1; the nucleotide sequence of the GmPHDLb gene is SEQ ID NO: 2; the nucleotide sequence of the GmPHDLc gene is SEQ ID NO: 3; and the nucleotide sequence of the GmPHDLd gene is SEQ ID NO: 4.

[0053] Beneficial technical effects: When the above gene in soybean is knocked out, the height of soybean plant becomes shorter and the flowering time of soybean is delayed. By regulating the height of soybean plant, the plant can be more adapted to the local growth environment, improve yield and quality, and help improve soybean production efficiency. Delaying the flowering time of soybean helps to increase the time of plant vegetative growth and increase the biomass of soybean, thereby further increasing soybean yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the accompanying drawings:

[0055] Figure 1 A phylogenetic tree analysis of proteins encoded by the GmPHDLa / b / c / d genes according to an embodiment of the present invention is shown.

[0056] Figure 2 A map of the empty vector pCAMBIA3300-GmU6 according to an embodiment of the present invention is shown.

[0057] Figure 3 A schematic diagram of the GmPHDLa / b / c / d gene knockout target sequence according to an embodiment of the present invention is shown; wherein (+) represents the positive strand; and (-) represents the antisense strand.

[0058] Figure 4 A schematic diagram of mutation types of CRISPR-GmPHDL editing material phdla according to an embodiment of the present invention is shown.

[0059] Figure 5 A schematic diagram of mutation types of the CRISPR-GmPHDL editing material phdlb according to an embodiment of the present invention is shown.

[0060] Figure 6 A schematic diagram of mutation types of CRISPR-GmPHDL editing material phdlc according to an embodiment of the present invention is shown.

[0061] Figure 7 A schematic diagram of mutation types of the CRISPR-GmPHDL editing material phdld according to an embodiment of the present invention is shown.

[0062] Figure 8 The CRISPR-GmPHDL editing material according to an embodiment of the present invention is shown in the long-day conditions in the laboratory (16 h light / 8 h dark, and the light intensity is 120 μmol / (m 2 •s)) The flowering phenotypes of each edited material photographed in January 2024 during the growth period from November 2023 to June 2024.

[0063] Fig. 9 The CRISPR-GmPHDL editing material according to an embodiment of the present invention is shown in the long-day conditions in the laboratory (16 h light / 8 h dark, and the light intensity is 120 μmol / (m 2 •s)) Statistical graph of flowering time of each edited material; *p<0.05, **p<0.01, ***p<0.001 (t test).

[0064] Fig.10 The CRISPR-GmPHDL editing material according to an embodiment of the present invention is shown in the short-day conditions in the laboratory (8h light / 8h dark, and the light intensity is 400μmol / (m 2 •s)) The flowering phenotypes of each edited material photographed in December 2023 during the growth period from November 2023 to March 2024.

[0065] Fig.11 The CRISPR-GmPHDL editing material according to an embodiment of the present invention is shown in the short-day conditions in the laboratory (8h light / 8h dark, and the light intensity is 400μmol / (m 2 •s)) Statistical graph of flowering time of each edited material; *p<0.05, **p<0.01, ***p<0.001 (t test).

[0066] Fig.12The flowering phenotype of each edited material during the flowering period in July 2024 under natural long-day light (outdoor natural environment in Weifang City, Shandong Province (36°30'39"N, 119°25'46"E) from June to October 2024) when the CRISPR-GmPHDL edited material according to an embodiment of the present invention was planted in the field.

[0067] Fig.13 A statistical graph of the flowering time of each edited material under natural long-day light (outdoor natural environment in Weifang City, Shandong Province (36°30'39"N, 119°25'46"E) from June to October 2024) when the CRISPR-GmPHDL edited material according to an embodiment of the present invention was planted in the field; *p<0.05, **p<0.01, ***p<0.001 (t-test).

[0068] Fig.14 A statistical graph of plant height of each edited material at the peak flowering period in July 2024 under natural long-day light (outdoor natural environment (36°30'39"N, 119°25'46"E) in Weifang City, Shandong Province from June to October 2024) when the CRISPR-GmPHDL edited material according to an embodiment of the present invention was planted in the field; *p<0.05, **p<0.01, ***p<0.001 (t-test).

[0069] Fig.15 The plant height phenotype of each edited material at maturity in October 2024 under natural long-day conditions (outdoor natural environment in Weifang City, Shandong Province (36°30'39"N, 119°25'46"E) from June to October 2024) when the CRISPR-GmPHDL edited material according to an embodiment of the present invention was planted in the field.

[0070] Fig.16 Data analysis of plant height at maturity in October 2024 under natural long-day conditions (outdoor natural environment in Weifang City, Shandong Province (36°30'39"N, 119°25'46"E) from June to October 2024) of CRISPR-GmPHDL-edited materials according to an embodiment of the present invention planted in the field; *p<0.05, **p<0.01, ***p<0.001 (t-test).

[0071] Fig.17The phenotype of plant height at maturity in October 2024 of the CRISPR-GmPHDL-edited materials phdla-3+phdlb-1+phdlc-1+phdld-3 and phdla-4+phdlb-3+phdlc-1+phdld-3 according to an embodiment of the present invention is shown under natural long-day light (outdoor natural environment in Weifang City, Shandong Province from June to October 2024 (36°30'39"N, 119°25'46"E)) planted in the field.

[0072] Fig.18 The flowering time analysis of each edited material in January 2025 is shown under natural short-day conditions when the CRISPR-GmPHDL edited material according to an embodiment of the present invention was planted in the field (planted in December 2024 in the outdoor natural environment of Sanya City, Hainan Province, 18°09'34"N, 108°56'30"E). DETAILED DESCRIPTION

[0073] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0074] Terminology explanation:

[0075] Flowering time: The flowering time in the present invention refers to the total number of days from the germination of soybeans to the opening of the first flower.

[0076] As mentioned in the background technology, dwarfing plants helps to improve the soybean plant's efficiency in absorbing water and nutrients and reduce losses caused by lodging, thereby ensuring yield stability. At the same time, shorter plants are easier to manage mechanically, reducing production costs. Delaying the flowering time of soybeans helps soybeans better adapt to adverse environments such as drought and low temperatures, reduces the risk of flowering under adverse climatic conditions, helps to improve the adaptability of planting, and thus helps to increase soybean yields. In the present invention, the inventors attempted to genetically modify soybeans to make their plant height and flowering time easily controllable, and thus proposed the protection scheme of the present invention.

[0077] In a first typical embodiment of the present invention, a method for simultaneously regulating soybean plant height and flowering time is provided, the method comprising: knocking out any one or more of the following genes in soybean: GmPHDLa, GmPHDLb, GmPHDLc or GmPHDLd;

[0078] Among them, the nucleotide sequence of the above-mentioned GmPHDLa gene is SEQ ID NO: 1; the nucleotide sequence of the above-mentioned GmPHDLb gene is SEQ ID NO: 2; the nucleotide sequence of the above-mentioned GmPHDLc gene is SEQ ID NO: 3; and the nucleotide sequence of the above-mentioned GmPHDLd gene is SEQ ID NO: 4.

[0079] Knocking out the above gene in soybeans shortens the height of soybean plants and delays the flowering time of soybeans. Shortening the height of soybean plants helps reduce the losses caused by lodging, promotes the effective absorption of nutrients and water by soybeans in the soil layer, and increases the effective planting area, thereby further increasing soybean yields.

[0080] Delaying the flowering time of soybeans can help extend the growth period of soybeans, allowing the plants to obtain more photosynthetic accumulation during the growing season, increase the biomass and yield of individual plants, help soybeans better adapt to adverse environmental conditions such as drought or low temperature, and reduce the risk of soybean flowering under unsuitable climatic conditions. It can help soybeans avoid the peak periods of some common diseases and pests and reduce the risk of diseases and pests, thereby reducing the use of pesticides, increasing the friendliness of the ecological environment, and helping soybeans adapt to different planting areas. Choosing late flowering varieties can better adapt to local climatic conditions and increase the success rate of planting.

[0081] It should be noted that gene knockout refers to the deletion or inactivation of a specific gene from the genome of an organism through gene editing technology to study the effect of the gene on the physiology, development or disease of the organism. Methods for achieving gene knockout include but are not limited to: 1) Using homologous recombination to replace the target gene with a non-functional or damaged version by introducing a modified DNA fragment. When the exogenous DNA undergoes homologous recombination with a gene with the same or similar sequence in the genome of the recipient cell, the target gene is replaced and inactivated; 2) Using RNA interference to silence or degrade the mRNA of the target gene by using small RNA molecules to prevent it from being translated into protein, thereby achieving gene knockout; or 3) Using the CRISPR / Cas9 system to introduce targeted DNA breaks at specific locations in the genome using sgRNA and Cas9 enzymes, resulting in gene disruption. CRISPR / Cas9 produces frameshift mutations or fragment deletions at the break site through a non-homologous end joining repair pathway, silencing the gene and causing loss of function.

[0082] In a preferred embodiment of the present invention, the knockout is performed by gene editing to obtain soybeans with any one or more of the following gene knockouts: GmPHDLa, GmPHDLb, GmPHDLc or GmPHDLd. In a preferred embodiment of the present invention, the knockout is performed by CRISPR-Cas9 gene editing system. Knocking out the above genes by the above method has the beneficial effect of simple operation.

[0083] In a preferred embodiment of the present invention, the CRISPR-Cas9 gene editing system includes sgRNA; the sgRNA includes: sgRNA1 or sgRNA2 targeting the GmPHDLa gene; sgRNA5 or sgRNA2 targeting the GmPHDLb gene; sgRNA3 or sgRNA4 targeting the GmPHDLc gene; sgRNA6 or sgRNA4 targeting the GmPHDLd gene. Among them, the nucleotide sequence of the sgRNA1 is SEQ ID NO: 5; the nucleotide sequence of the sgRNA2 is SEQ ID NO: 6; the nucleotide sequence of the sgRNA3 is SEQ ID NO: 7; the nucleotide sequence of the sgRNA4 is SEQ ID NO: 8; the nucleotide sequence of the sgRNA5 is SEQ ID NO: 59; the nucleotide sequence of the sgRNA6 is SEQ ID NO: 66. The use of the above sgRNA for gene editing has the advantage of high editing efficiency.

[0084] In a preferred embodiment of the present invention, the GmPHDLa gene is knocked out in any of the following ways: deletion of the T base at position 9344 of the nucleotide sequence of the GmPHDLa gene; deletion of the A base at position 10054 of the nucleotide sequence of the GmPHDLa gene; deletion of 28 bases from positions 10041 to 10068 of the nucleotide sequence of the GmPHDLa gene; or deletion of 662 bases from positions 9413 to 10074 of the nucleotide sequence of the GmPHDLa gene. When the GmPHDLa gene undergoes the above mutation, the function of the gene is inactivated, which may help reduce soybean plant height and delay soybean flowering time, and further may help increase soybean yield.

[0085] In a preferred embodiment of the present invention, the GmPHDLb gene is knocked out in any of the following ways: adding an A base between the 3486th and 3487th positions of the nucleotide sequence of the GmPHDLb gene; deleting the A base at the 3486th position and the G base at the 3487th position of the nucleotide sequence of the GmPHDLb gene; deleting 10 bases from the 3477th to the 3486th position of the nucleotide sequence of the GmPHDLb gene; or deleting the C base at the 2716th position of the nucleotide sequence of the GmPHDLb gene. When the GmPHDLb gene undergoes the above mutation, the function of the gene is inactivated, which may help reduce the height of soybean plants and delay the flowering time of soybeans, and further may help increase soybean yield.

[0086] In a preferred embodiment of the present invention, the GmPHDLc gene is knocked out in any of the following ways: adding a T base between the 2735th and 2736th positions of the nucleotide sequence of the GmPHDLc gene; adding a T base between the 2576th and 2577th positions of the nucleotide sequence of the GmPHDLc gene; deleting the T base at the 2576th position of the nucleotide sequence of the GmPHDLc gene; or deleting 5 bases from the 2576th to the 2580th position of the nucleotide sequence of the GmPHDLc gene. When the GmPHDLc gene undergoes the above mutation, the function of the gene is inactivated, which may help reduce the height of soybean plants and delay the flowering time of soybeans, and further may help increase soybean yield.

[0087] In a preferred embodiment of the present invention, the GmPHDLd gene is knocked out by any of the following methods: deleting three bases from position 2494 to position 2496 of the nucleotide sequence of the GmPHDLd gene;

[0088] Three bases are deleted from positions 2654 to 2656 in the nucleotide sequence of the GmPHDLd gene;

[0089] There is a deletion of 4 bases from position 2655 to position 2658 in the nucleotide sequence of the above GmPHDLd gene;

[0090] There is a deletion of 7 bases from position 2491 to position 2497 in the nucleotide sequence of the GmPHDLd gene;

[0091] Ten bases from position 2494 to position 2503 of the nucleotide sequence of the GmPHDLd gene are deleted;

[0092] 37 bases are deleted from position 2494 to 2530 of the nucleotide sequence of the GmPHDLd gene;

[0093] Add 33 bases between positions 2495 and 2496 of the nucleotide sequence of the GmPHDLd gene;

[0094] Or, 9 bases from position 2484 to position 2492 of the nucleotide sequence of the above-mentioned GmPHDLd gene are deleted.

[0095] When the GmPHDLd gene undergoes the above mutation, the gene function is inactivated, which helps to reduce soybean plant height and delay soybean flowering time, which may help to increase soybean yield.

[0096] In a preferred embodiment of the present invention, the method comprises: knocking out the following gene combination in soybean: GmPHDLc+GmPHDLd or GmPHDLa+GmPHDLb+GmPHDLc+GmPHDLd. Knocking out the above genes in soybean can significantly reduce soybean plant height and delay soybean flowering time, which may help to increase soybean yield.

[0097] In a preferred embodiment of the present invention, the GmPHDLc+GmPHDLd gene is knocked out in the following manner: one T base is added between the 2576th and 2577th positions of the nucleotide sequence of the GmPHDLc gene and 10 bases are deleted from the 2494th to 2503th positions of the nucleotide sequence of the GmPHDLd gene. When the GmPHDLc+GmPHDLd gene undergoes the above mutation, the plant height of soybean is significantly reduced and the flowering time of soybean is significantly delayed, which may help to increase soybean yield.

[0098] In a preferred embodiment of the present invention, the GmPHDLa+GmPHDLb+GmPHDLc+GmPHDLd genes are knocked out in the following manner:

[0099] 1) 28 bases from position 10041 to 10068 of the nucleotide sequence of the above GmPHDLa gene are deleted;

[0100] Adding an A base between positions 3486 and 3487 of the nucleotide sequence of the GmPHDLb gene;

[0101] A T base is added between positions 2735 and 2736 of the nucleotide sequence of the GmPHDLc gene; and four bases from positions 2655 to 2658 of the nucleotide sequence of the GmPHDLd gene are deleted;

[0102] or

[0103] 2) 662 bases from position 9413 to position 10074 of the nucleotide sequence of the above GmPHDLa gene are missing;

[0104] Ten bases are deleted from positions 3477 to 3486 of the nucleotide sequence of the GmPHDLb gene;

[0105] One T base is added between positions 2735 and 2736 of the nucleotide sequence of the GmPHDLc gene; and four bases from positions 2655 to 2658 of the nucleotide sequence of the GmPHDLd gene are deleted.

[0106] When the above mutations occur in the GmPHDLa+GmPHDLb+GmPHDLc+GmPHDLd genes, the soybean plant height is reduced and the flowering time is delayed, which may help to increase soybean yield.

[0107] In a second typical embodiment of the present invention, there is provided an application of the above-mentioned method for controlling soybean plant height and delaying soybean flowering time in soybean planting.

[0108] It should be noted that the meaning of "phdlc-3 phdld-1" in the drawings of the specification is the same as the meaning of "phdlc-3+phdld-1".

[0109] The expression "phdlc-3 phdld-7" has the same meaning as the expression "phdlc-3 + phdld-7".

[0110] The expression "phdlc-2 phdld-5" has the same meaning as the expression "phdlc-2 + phdld-5".

[0111] The expression "phdla-2 phdlb-2 phdlc-1 phdld-2" has the same meaning as "phdla-2 + phdlb-2 + phdlc-1 + phdld-2".

[0112] The expression "phdla-3 phdlb-1 phdlc-1 phdld-3" has the same meaning as "phdla-3 + phdlb-1 + phdlc-1 + phdld-3".

[0113] The expression "phdla-4 phdlb-3 phdlc-1 phdld-3" has the same meaning as "phdla-4 + phdlb-3 + phdlc-1 + phdld-3".

[0114] The expression "phdla-1 phdlb-4 phdlc-4 phdld-8" has the same meaning as "phdla-1 + phdlb-4 + phdlc-4 + phdld-8".

[0115] The present invention is further described in detail below in conjunction with specific embodiments. These embodiments should not be construed as limiting the scope of protection claimed by the present invention.

[0116] Example 1 Construction of soybean GmPHDLa / b / c / d knockout expression vector

[0117] (1) Phylogenetic tree analysis: We named four homologous genes encoding a PHD domain in soybean as GmPHDLa, GmPHDLb, GmPHDLc and GmPHDLd. Using MEGA11 software, we compared the homology of their protein sequences. The phylogenetic tree analysis results are shown in Figure 2. Figure 1 shown.

[0118] According to the search of soybean V6 version in Phytozome 13 database, the DNA sequence of GmPHDLa is located on 37843511-37857643 forward of soybean chromosome 10, and the nucleotide sequence of GmPHDLa (Glyma.10G127700) is shown in SEQ ID NO: 1; the DNA sequence of GmPHDLb is located on 32474180-32487711 forward of soybean chromosome 20, and the nucleotide sequence of GmPHDLb (Glyma.20G079100) is shown in SEQ ID NO: 2; the DNA sequence of GmPHDLc is located on 3901434-3905906 reverse of soybean chromosome 16, and the nucleotide sequence of GmPHDLc (Glyma.16G041900) is shown in SEQ ID NO: 3. NO: 3; the DNA sequence of GmPHDLd is located on soybean chromosome 19 39513761-39517411 forward, and the nucleotide sequence of GmPHDLd (Glyma.19G110500) is shown in SEQ ID NO: 4.

[0119] (2) Construction of soybean GmPHDL knockout vector: The knockout vector was constructed using the reported CRISPR-Cas9 technology. The structure of the empty vector pCAMBIA3300-GmU6 is shown in Figure 2 , the specific steps are as follows: First, use the website http: / / crispr.hzau.edu.cn / to design sgRNA for the coding sequence of GmPHDL.

[0120] According to the score, sgRNA1 (having the nucleotide sequence shown in SEQ ID NO: 5) or sgRNA2 (having the nucleotide sequence shown in SEQ ID NO: 6) was selected as the target for GmPHDLa;

[0121] For GmPHDLb, sgRNA5 (having the nucleotide sequence shown in SEQ ID NO: 59) or sgRNA2 (having the nucleotide sequence shown in SEQ ID NO: 6) was selected as the target;

[0122] sgRNA3 (having the nucleotide sequence shown in SEQ ID NO: 7) or sgRNA4 (having the nucleotide sequence shown in SEQ ID NO: 8) was selected as the target for GmPHDLc.

[0123] For GmPHDLd, sgRNA6 (having the nucleotide sequence shown in SEQ ID NO: 66) or sgRNA4 (having the nucleotide sequence shown in SEQ ID NO: 8) was selected as the target;

[0124] sgRNA1 and sgRNA3 were constructed into pCAMBIA3300-GmU6 vector, and the vector was named pCAMBIA3300-GmU6-sgRNA1 / 3; sgRNA2 and sgRNA4 were constructed into pCAMBIA3300-GmU6 vector, and the vector was named pCAMBIA3300-GmU6-sgRNA2 / 4. Since the target gene sgRNA1 sequence of GmPHDLa has a potential off-target probability of 87.5%, it can act on the sgRNA5 sequence of the homologous gene GmPHDLb; similarly, the target gene sgRNA3 sequence of GmPHDLc has a potential off-target probability of 64.3%, and can act on the sgRNA6 sequence of the homologous gene GmPHDLd, so the target sequence of pCAMBIA3300-GmU6-sgRNA1 / 3 in GmPHDLb is the sgRNA5 sequence, and the target sequence in GmPHDLd is the sgRNA6 sequence.

[0125] Among them, the nucleotide sequence of SEQ ID NO: 5 is as follows: ATCATATGCCTGGACAGCCA; the nucleotide sequence of SEQ ID NO: 6 is as follows: AAAGTGGTACTGGTAGAGGA; the nucleotide sequence of SEQ ID NO: 7 is as follows: TTAGGGACTATAGGCAACGG; the nucleotide sequence of SEQ ID NO: 8 is as follows: GGGTTGATCAACATCCATCG; the nucleotide sequence of SEQ ID NO: 59 is as follows: ATCATAAGCCTGGACAGCCA; the nucleotide sequence of SEQ ID NO: 66 is as follows: TTAGGGACTATAGGCAATGG. Figure 3 The GmPHDL knockout target sequence and schematic diagram are shown.

[0126] The primers required to construct the vector are:

[0127] sgRNA1-F (SEQ ID NO: 9): GGATTGATCATATGCCTGGACAGCCA.

[0128] sgRNA1-R(SEQ ID NO:10):AAACTGGCTGTCCAGGCATATGATCA。

[0129] sgRNA2-F(SEQ ID NO:11:GGATTGAAAGTGGTACTGGTAGAGGA。

[0130] sgRNA2-R(SEQ ID NO:12):AAACTCCTCTACCAGTACCACTTTCA。

[0131] sgRNA3-F(SEQ ID NO:13:GGATTGTTAGGGACTATAGGCAATGG。

[0132] sgRNA3-R(SEQ ID NO:14):AAACCCATTGCCTATAGTCCCTAACA。

[0133] sgRNA4-F(SEQ ID NO:15):GGATTGGGTTGATCAACATCCATCG。

[0134] sgRNA4-R (SEQ ID NO:16):AAACCGATGGATGTTGATCAACCCA。

[0135] 3300-F-XmaI(SEQ ID NO:17):TTATCCCGGGTGCAAGTGCGGTGACAAGACAAGC。

[0136] 3300-R-XmaI(SEQ ID NO:18:TATTCCCGGGGCCATTTGTCTGCAGAATT。

[0137] Dilute the upstream and downstream primers of each pair of sgRNA to 100 μmol, and then mix them at a ratio of 1:1 for annealing. Mix the annealed primers, pCAMBIA3300 vector, BsaI, T4 DNA ligase, and ligase buffer, and perform cutting and ligation in a PCR instrument to connect four targets respectively; then use universal primers 3300-F-XmaI and 3300-R-XmaI to amplify target 3 and target 4 from the vector respectively, and perform XmaI single enzyme digestion on the vector connected to target 1 and 2, and then use T4 DNA ligase to connect target 1 and 3 together to form pCAMBIA3300-GmU6-sgRNA1 / 3; at the same time, connect target 2 and 4 together to form pCAMBIA3300-GmU6-sgRNA2 / 4. The final product was transformed into Escherichia coli DH5α. After the two correctly sequenced vectors were extracted with plasmids, they were further transformed into Agrobacterium EHA105. The correctly identified bacteria were handed over to the biotechnology platform of the Modern Agriculture Research Institute of Peking University for transformation of the cotyledon node.

[0138] Example 2 Extraction and PCR detection of transgenic soybean genomic DNA

[0139] (1) CTAB method for extracting soybean genomic DNA: First, take a fresh soybean leaf with a diameter of about 1 cm and place it in a 2.0 mL centrifuge tube. Add a clean steel ball with a diameter of about 6 mm, pre-cool it in liquid nitrogen, and then grind it with a grinder at 50 Hz for 1 min. Add 500 μL of CTAB extraction buffer: shake and incubate at 65°C for 1 h. After cooling to room temperature, add 500 μL of phenol: chloroform: isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 12,000 rpm for 10 min, aspirate the supernatant into a new 1.5 mL centrifuge tube, add 0.6 times the volume of isopropanol, mix by inversion, and precipitate at -20°C for more than 30 min. Centrifuge at 12,000 rpm at room temperature for 1 min, discard the supernatant, add 500 μL of 70% ethanol for rinsing, centrifuge at 12,000 rpm at room temperature for 1 min, and repeat. Finally, blow dry the ethanol at room temperature, add 100 μL of ddH2O, dissolve it, and store it at 4°C.

[0140] (2) PCR detection: First, the four homologous genes of GmPHDL were amplified by PCR using soybean genomic DNA as a template. The amplification reaction system is shown in Table 1, the amplification reaction procedure is shown in Table 2, and the nucleotide sequence of the amplification primers is shown in Table 3.

[0141] Table 1 PCR amplification reaction system

[0142]

[0143] Table 2 PCR amplification reaction program

[0144]

[0145] Table 3 Nucleotide sequences of amplification primers

[0146]

[0147] Table 4 Summary of mutation types of CRISPR-GmPHDL edited materials

[0148]

[0149] It should be noted that the A of the start codon ATG in Table 4 is the +1 site.

[0150] Secondly, 5 μL of PCR product was tested in 1% agarose gel electrophoresis. The length of the amplified fragment was about 1000 bp, and the remaining products were sequenced for identification. The results showed that the GmPHDL gene was edited in multiple T1 generation strains, but not in wild-type plants. The sequence comparison results are shown in Figure 4 (phdla), Figure 5 (PhDLB), Figure 6 (PhDLC) and Figure 7 (phdld), GmPHDL gene mutation types are shown in Table 4. This method was applied to PCR detection of target genes and material identification in the T2 generation and subsequent generations.

[0151] Example 3 Analysis of flowering time of T3 / T4 generation GmPHDLa / b / c / d transgenic soybean materials

[0152] The edited T1 generation soybeans were self-pollinated to obtain T2 generation materials, and further self-pollination was performed to obtain stable genetic T3 / T4 generation transgenic soybean materials. The flowering time of the stable genetic transgenic soybean materials was observed and counted under long and short daylight conditions.

[0153] Wild-type W82 and transgenic soybean seeds were placed in nutrient soil and placed in a laboratory with long-day (16 h light / 8 h dark; light intensity 120 μmol / (m 2 •s)) and laboratory short-day (12 h light / 12 h dark; light intensity 400 μmol / (m 2 •s)) conditions, the experiment was carried out under normal culture conditions at 25℃ and the flowering time was counted (the starting time was counted after germination, and the same was true for subsequent experiments).

[0154] Under long-day conditions, the complete double and quadruple knockout lines of GmPHDL showed a significant late flowering phenotype compared with the W82 line, with an average delay of 24-30 days ( Figure 8 and Fig. 9 ), see Table 5 for specific data.

[0155] Under short-day conditions, the complete double and quadruple knockout lines of GmPHDL also showed a significant late flowering phenotype compared with the W82 line, with an average late flowering of 9-12 days ( Fig.10 and Fig.11 ), see Table 5 for specific data.

[0156] Table 5 Average flowering period of CRISPR-GmPHDL materials with long and short daylight periods

[0157]

[0158] It should be noted that since phdld-1, phdld-2, phdld-7 and phdld-8 are all editing types of 3bp or multiples of 3 and do not produce substantial mutations, the double or quadruple mutant materials containing them are equivalent to single or triple mutants; for example, the double mutant phdlc-3+phdld-1 is equivalent to the single mutant phdlc-3, and for another example, the quadruple mutant phdla-2+phdlb-2+phdlc-1+phdld-2 is equivalent to the triple mutant phdla-2+phdlb-2+phdlc-1.

[0159] The delayed flowering time and shorter plant height of soybean plants under both long-day and short-day conditions will help the promotion and application of soybean varieties under different climatic conditions and have important ecological and agricultural significance.

[0160] Example 4 Analysis of flowering and plant height phenotypes of GmPHDLa / b / c / d transgenic soybean lines planted in the field

[0161] The genetically stable transgenic soybeans were uniformly planted in the field with a row spacing of 0.4m and a plant spacing of 10cm, and phenotypes such as flowering period and plant height were observed.

[0162] The natural long-day conditions of the field experiment were: 36°30'39"N, 119°25'46"E in the outdoor natural environment of Weifang City, Shandong Province from June to October 2024. The experimental data showed that Wm82 bloomed at about 40 days in the field, while phdld-4 bloomed 7 days later; phdlc-2+phdld-5 bloomed 8.5 days later; phdla-3+phdlb-1+phdlc-1+phdld-3 and phdla-4 +phdlb-3+ phdlc-1+ phdld-3 bloomed 13.5 days and 11.5 days later, respectively (see Fig.12 and Fig.13 ).

[0163] The plant height of Wm82 in the field at full flowering stage was about 52.8 cm. The plant heights of the four late-flowering editing types were significantly shorter at full flowering stage (see Fig.14 ), respectively Fig.14 32.7 cm (phdld-4), 15.1cm (phdlc-2+phdld-5), 14.8cm (phdla-3+phdlb-1+phdlc-1+phdld-3) and 15.3cm (phdla-4 +phdlb-3+ phdlc-1+ phdld-3).

[0164] At maturity, the plant height of the late-flowering mutant was smaller than that of Wm82 (94.6 cm) (see Fig.15 , Fig.16 and Fig.17 ), were 87.8 cm (phdld-4), 70.3 cm (phdlc-2+phdld-5), 62.3 cm (phdla-3+phdlb-1+phdlc-1+phdld-3) and 70.1 cm (phdla-4 +phdlb-3+ phdlc-1+ phdld-3), respectively.

[0165] In various assays and analysis experiments involved in this patent, each sample was measured three times in parallel, and the results were expressed as mean ± standard deviation. The differences between each sample and the control were analyzed for significance by a two-tailed t-test (*p<0.05; **p<0.01; ***p<0.001).

[0166] The natural short-day conditions of the field experiment were: planted in the outdoor natural environment of Sanya City, Hainan Province in December 2024 at 18°09'34"N, 108°56'30"E), and the flowering time of each edited material was analyzed in January 2025. The experimental data showed that Wm82 bloomed at about 33 days in the field, while phdlc-3+ phdld-7 bloomed 2.5 days later; phdlc-2+phdld-5 bloomed 7.5 days later; phdla-3+phdlb-1+phdlc-1+phdld-3 and phdla-4 +phdlb-3+ phdlc-1+ phdld-3 bloomed 6 days and 6.5 days later, respectively (see Fig.18 ).

[0167] The flowering period of soybean is a critical stage in the transition from vegetative growth to reproductive growth. The shortening of plant height during the flowering period is of great significance in improving photosynthetic efficiency, optimizing resource allocation (shortening of plant height during the flowering period may mean that the plant allocates more resources to reproductive growth, such as flowers, pods and seeds, rather than vegetative growth, thereby increasing seed yield and quality) and environmental adaptation, which helps to increase yield and planting benefits.

[0168] The plant height of soybeans at maturity reflects the final growth of the plant and is an important indicator for evaluating the growth potential of the material. The shortening of soybean plant height at maturity is of great significance in enhancing lodging resistance, environmental adaptation, breeding, mechanized harvesting, and pest and disease control, and helps to increase yield and planting benefits.

[0169] From the above description, it can be seen that the above-mentioned embodiments of the present invention achieve the following technical effects: the present invention can shorten the height of soybean plants by knocking out the GmPHDLa / b / c / d genes in soybeans. The change in soybean plant height may affect the growth and yield of soybean plants. By regulating the height of soybean plants, the plants can be more adapted to the local growth environment, thereby improving the yield and quality. In addition, the knockout material of GmPHDLa / b / c / d can also delay the flowering time of soybeans, increase the time of plant vegetative growth, and thus help to increase the yield of soybeans.

[0170] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for simultaneously regulating soybean plant height and flowering time, characterized in that: The method comprises: knocking out any one or more of the following genes in soybean: GmPHDLa, GmPHDLb, GmPHDLc or GmPHDLd; Wherein, the nucleotide sequence of the GmPHDLa gene is SEQ ID NO: 1; The nucleotide sequence of the GmPHDLb gene is SEQ ID NO: 2; The nucleotide sequence of the GmPHDLc gene is SEQ ID NO: 3; The nucleotide sequence of the GmPHDLd gene is SEQ ID NO:

4.

2. The method according to claim 1, characterized in that The knockout is performed by gene editing to obtain soybeans with any one or more of the following genes knocked out: GmPHDLa, GmPHDLb, GmPHDLc or GmPHDLd.

3. The method according to claim 2, characterized in that The knockout was performed using the CRISPR-Cas9 gene editing system.

4. The method according to claim 3, characterized in that The CRISPR-Cas9 gene editing system includes sgRNA; the sgRNA includes: sgRNA1 or sgRNA2 targeting the GmPHDLa gene; sgRNA5 or sgRNA2 targeting the GmPHDLb gene; sgRNA3 or sgRNA4 targeting the GmPHDLc gene; sgRNA6 or sgRNA4 targeting the GmPHDLd gene; Among them, the nucleotide sequence of the sgRNA1 is SEQ ID NO: 5; the nucleotide sequence of the sgRNA2 is SEQ ID NO: 6; the nucleotide sequence of the sgRNA3 is SEQ ID NO: 7; the nucleotide sequence of the sgRNA4 is SEQ ID NO: 8; the nucleotide sequence of the sgRNA5 is SEQ ID NO: 59; and the nucleotide sequence of the sgRNA6 is SEQ ID NO:

66.

5. The method according to claim 4, characterized in that The GmPHDLa gene is knocked out in any of the following ways: deleting the T base at position 9344 of the nucleotide sequence of the GmPHDLa gene; The A base at position 10054 of the nucleotide sequence of the GmPHDLa gene is missing; 28 bases from position 10041 to position 10068 of the nucleotide sequence of the GmPHDLa gene are deleted; or 662 bases from position 9413 to position 10074 in the nucleotide sequence of the GmPHDLa gene are deleted.

6. The method according to claim 4, characterized in that The GmPHDLb gene is knocked out by any of the following methods: adding an A base between the 3486th and 3487th positions of the nucleotide sequence of the GmPHDLb gene; The A base at position 3486 and the G base at position 3487 of the nucleotide sequence of the GmPHDLb gene are deleted; A deletion of 10 bases from position 3477 to position 3486 of the nucleotide sequence of the GmPHDLb gene; or The C base at position 2716 in the nucleotide sequence of the GmPHDLb gene is deleted.

7. The method according to claim 4, characterized in that The GmPHDLc gene is knocked out by any of the following methods: adding a T base between the 2735th and 2736th positions of the nucleotide sequence of the GmPHDLc gene; Adding a T base between positions 2576 and 2577 of the nucleotide sequence of the GmPHDLc gene; The T base at position 2576 of the nucleotide sequence of the GmPHDLc gene is deleted; or There is a deletion of 5 bases from position 2576 to position 2580 in the nucleotide sequence of the GmPHDLc gene.

8. The method according to claim 4, characterized in that The GmPHDLd gene is knocked out by any of the following methods: deleting three bases from position 2494 to position 2496 of the nucleotide sequence of the GmPHDLd gene; Three bases are deleted from position 2654 to position 2656 of the nucleotide sequence of the GmPHDLd gene; Four bases are deleted from position 2655 to position 2658 of the nucleotide sequence of the GmPHDLd gene; 7 bases from position 2491 to position 2497 of the nucleotide sequence of the GmPHDLd gene are deleted; Ten bases are deleted from position 2494 to position 2503 of the nucleotide sequence of the GmPHDLd gene; 37 bases are deleted from position 2494 to position 2530 of the nucleotide sequence of the GmPHDLd gene; Add 33 bases between positions 2495 and 2496 of the nucleotide sequence of the GmPHDLd gene; or Nine bases from position 2484 to position 2492 in the nucleotide sequence of the GmPHDLd gene are deleted.

9. The method according to claim 4, characterized in that The method comprises: knocking out the following gene combination in soybean: GmPHDLc+GmPHDLd or GmPHDLa+GmPHDLb+GmPHDLc+GmPHDLd.

10. The method according to claim 9, characterized in that The GmPHDLc+GmPHDLd gene was knocked out in the following manner: one T base was added between the 2576th and 2577th positions of the nucleotide sequence of the GmPHDLc gene and 10 bases were deleted from the 2494th to the 2503rd positions of the nucleotide sequence of the GmPHDLd gene.

11. The method according to claim 9, characterized in that The GmPHDLa+GmPHDLb+GmPHDLc+GmPHDLd genes were knocked out in the following manner: 1) 28 bases from position 10041 to position 10068 of the nucleotide sequence of the GmPHDLa gene are deleted; Adding an A base between positions 3486 and 3487 of the nucleotide sequence of the GmPHDLb gene; Adding a T base between positions 2735 and 2736 of the nucleotide sequence of the GmPHDLc gene; and Four bases are deleted from position 2655 to position 2658 of the nucleotide sequence of the GmPHDLd gene; or 2) 662 bases from position 9413 to position 10074 of the nucleotide sequence of the GmPHDLa gene are deleted; Ten bases are deleted from position 3477 to position 3486 of the nucleotide sequence of the GmPHDLb gene; Adding a T base between positions 2735 and 2736 of the nucleotide sequence of the GmPHDLc gene; and Four bases from position 2655 to position 2658 of the nucleotide sequence of the GmPHDLd gene are deleted.

12. Use of the method according to any one of claims 1 to 11 in soybean planting.

Images