SynNotch system delivery method, and delivery carrier and application thereof

Abstract

The invention provides a SynNotch system delivery method as well as a delivery vector and application thereof. The method comprises the following steps: constructing a stably transfected SIN-gamma-RV vector by using a PiggyBac transposon system, expressing a SynNotch system by using a PSR vector, and combining a GAL4 induction vector and a UAS effect vector of the SynNotch system on one PSR vector, so that the SynNotch system is delivered by one PSR vector. The PSR.SynNotch system disclosed by the invention not only solves the problem that the transduction efficiency of double-carrier downstream effector molecules of an original system is difficult to detect, but also solves the problem that the efficiency of preparing the double-positive cells by double-carrier transduction target cells is low, most importantly, a stable transfection packaging cell line can be constructed for expanded production, and the application of the SynNotch system is very facilitated.

Description

Technical Field

[0001] The present invention relates to the field of cell therapy, and in particular to a SynNotch system delivery method and a delivery vector and application thereof. Background Art

[0002] CAR-T cell therapy is a therapy that transfers the coding gene of the specific antigen chimeric receptor CAR into T cells, and then re-injects the cells into the patient's body. The CAR expressed by the T cells recognizes the targeted antigens on the surface of tumor cells, activates the killing activity of T cells, and then releases perforin, granzyme, cytokines, etc. to exert tumor killing effects. CAR-T cells will directly exert anti-tumor killing effects without the need for major histocompatibility complex (MHC) recognition restrictions.

[0003] The side effects of CAR-T cell therapy include cytokine release syndrome, cytopenia, neurotoxic syndrome, graft-versus-host disease (GVHD), "On target off tumor" toxicity, etc. Among them, "On target off tumor" toxicity is related to the single mechanical killing recognition mode of CAR-T cells.

[0004] In 2016, Roybal et al. developed a new SynNotch system, which is an "AND GATE" circuit system and successfully applied it to CAR-T cell therapy. The SynNotch system works by simultaneously expressing two corresponding antigens on the surface of tumor cells to activate the specific killing function of SynNotch CAR-T (Syn-CAR-T) cells. Therefore, Syn-CAR-T cells can achieve the goal of intelligently identifying and killing tumors, thereby improving the safety of CAR-T cell therapy.

[0005] SynNotch is a synthetic Notch receptor. The mouse Notch1 receptor is modified. The extracellular domain is replaced with a single-chain antibody (A antibody scfv), and the intracellular domain is replaced with the transcription activation domain Gal4VP64, retaining only the transmembrane core domain (NC) that can be recognized and cleaved by proteases.

[0006] The response program of the SynNotch system represents a strategy for reconstructing T cell responses. Taking SynNotch CAR-T cells as an example, the surface of tumor cells needs to express two corresponding antigens at the same time to activate the specific killing function of CAR-T cells. Therefore, SynNotch CAR-T cells can achieve the goal of accurately identifying and killing tumors. However, the SynNotch system is relatively large. The system control elements include the Notch receptor core region, the intracellular transcription factor Gal4VP64, the UAS recognition sequence, and the internal promoter, which are about 2.5kb in total. The input signal molecules (such as CD19-scfv) and output signal molecules (such as BCMA-CAR) in the editable region of the system are about 2.5kb in total. The entire system occupies about 5kb and needs to be delivered through two lentiviral vector plasmids, namely a GAL4 induction vector and a UAS effector vector. Therefore, when transducing target cells, it is necessary not only to prepare two lentiviral vectors, but also to perform double virus transduction of target cells.

[0007] The SynNotch system also faces a problem. When the UAS effector vector is not activated, the effector molecule is not expressed, and the transduction efficiency cannot be detected by flow cytometry, unless a promoter is added to express a fluorescent protein signal alone for transduction efficiency detection. The use of lentiviral vectors for dual-virus transduction of T cells will cause a production problem, that is, the efficiency of preparing double-positive T cells is low, and flow sorting and enrichment are required to obtain T cells with a high double positive rate. In addition, due to the toxicity of VSV-G envelope protein and the use of third-generation self-inactivating lentiviral vectors for packaging, lentiviral vectors can only be transiently transfected and packaged, and cannot be prepared on a large scale. The packaging titer is low and enrichment and purification are required, which greatly limits the clinical application of Syn-CAR-T cell therapy. Due to the above reasons, the application of the SynNotch system in CAR-T cell therapy is greatly limited, and further receptor system optimization or vector optimization is needed.

[0008] The problem of low preparation efficiency faced by delivering the SynNotch system through lentiviral vectors can be solved by replacing the viral vector for packaging. Currently, commonly used viral vectors include γ-retroviral vectors (γ-RV). γ-RV is a simple retrovirus with a diameter of about 100nm and an envelope. The genome is 2 copies of positive-strand RNA. The genome size is about 8.3kb, and the genome only includes 2 LTRs, Gag-Pol, and Env. γ-RV can only transduce dividing cells, but not non-dividing cells. It can integrate the host genome and has a high packaging titer. Inserting an exogenous target gene larger than 4kb will greatly reduce the vector packaging titer. In order to further improve the safety of γ-RV and reduce the generation of replicative RCR, the U3 promoter of the 3'LTR of γ-RV was deleted to transform it into a self-inactivating γ-retroviral vector (SIN-RV).

[0009] The γ-RV vector has a mature large-scale stable transfection packaging method and high production titer, but the retroviral vector is randomly integrated into the host chromatin, and there is a risk of insertion mutation inducing host proto-oncogene expression. The U3 enhancer of SIN-RV is deleted, which reduces the risk of carcinogenesis and greatly improves the safety of the vector. The challenge facing SIN-RV is the difficulty in large-scale production of viral vectors. Due to the lack of U3 elements, it is impossible to construct a stable transfection packaging cell line. It can only be obtained through transient transfection packaging, which is difficult to expand production, and it is difficult to screen out cell clones that produce SIN-RV stable transfection using traditional methods. Summary of the invention

[0010] In order to solve the above problems, the present invention provides a method for delivering a SynNotch system, the method comprising: step 1: using the PiggyBac transposon system to construct a stably transfected SIN-γ-RV vector, i.e., a PSR vector; step 2: using the PSR vector prepared in step 1 to express the SynNotch system, and merging the GAL4 inducible vector and the UAS effector vector of the SynNotch system into one of the PSR vectors, so that the SynNotch system is delivered by one of the PSR vectors.

[0011] The PiggyBac transposon (PB) system is a DNA transposon that can integrate the target gene between ITRs into the target cell genome and express it stably for a long time through a "cut-and-paste" mechanism. In the PB system, the ends of the PB transposon are 13bp inverted repeat sequences (ITRs), and the PB transposase is expressed by a separate plasmid. PB integration mechanism: After double plasmid transfection, the PB transposase recognizes the ITRs at both ends of the vector, cuts off from both ends of the ITR to become a free PB transposon (carrying the target gene), the genomic TTAA site is cut to form a sticky end, and the PB transposon is inserted into the "TTAA" site of the genome for integration.

[0012] In one embodiment, in step 1, the 5'LTR (long terminal repeat sequence), 5'UTR (packaging signal non-coding region), and 3'SIN-LTR sequence of the SIN-γ-RV vector are sequentially inserted between the 5'ITR (inverted repeat sequence) and 3'ITR sequence of the PB transposon of the PiggyBac transposon system; the non-coding region UTR includes a Ψ element for the viral vector packaging signal and a SD for the splicing donor site, and the U3 region is deleted in the 3'SIN-LTR sequence, leaving only the R region and the U5 region.

[0013] In one embodiment, the 5'UTR deletes all Gag and Pol coding region sequences and the start codon ATG.

[0014] In one embodiment, the SFFV promoter, the multiple cloning site sequence MCS and the woodchuck hepatitis virus post-transcriptional regulatory element WPRE sequence are sequentially inserted between the non-coding region 5'UTR and the 3'SIN-LTR sequence.

[0015] In one embodiment, the hEF1-HTLV promoter-CopGFP-T2A-Puro sequence is inserted after the 3'SIN-LTR sequence, wherein the Puro gene is used for puromycin drug screening, and the CopGFP gene is used for subsequent fluorescence microscopy screening of high-expressing monoclonal cells.

[0016] In one embodiment, in step 2, the effector molecule and the inducible receptor of the SynNotch system are sequentially inserted between the 5'LTR and the 3'SIN-LTR.

[0017] In one embodiment, a fluorescent protein is added downstream of the induced receptor as a detection tag for the carrier receptor protein.

[0018] In one embodiment, a SynNotch system delivery vector constructed according to the above method is provided.

[0019] In one embodiment, a use of the above-mentioned SynNotch system delivery vector in CAR-T cell therapy is provided.

[0020] The PiggyBac transposon (PB) system belongs to DNA transposons, and the target gene between ITRs can be integrated into the target cell genome and expressed stably for a long time through a "cut-and-paste" mechanism. The present invention combines the PiggyBac transposon system and SIN-RV to construct a vector (PSR) for stable transfection of SIN-RV. In order to facilitate the rapid screening of cell clones stably transfected with SIN-RV, fluorescent protein CopGFP and puromycin drug screening genes are inserted during vector design. In theory, the new PSR vector packaging element designed by the present invention is only 1.1kb, while the classic MFG vector packaging element is 2.6kb, which greatly improves the vector packaging capacity, and the CopGFP and puromycin drug screening genes on the PSR vector greatly improve the screening efficiency of cell clones stably transfected with SIN-RV.

[0021] The present invention utilizes a PSR vector to express the SynNotch system, and combines a GAL4 inducible vector and a UAS effector vector on a PSR vector (single vector system). Only one PSR.SynNotch vector needs to be constructed for viral packaging, and a single viral vector is used to transduce target cells. When the UAS effector element is not activated and not expressed, the transduction efficiency can be detected by using the label of the GAL4 inducible element. The PSR.SynNotch system of the present invention not only solves the problem that the transduction efficiency of the downstream effector molecules of the dual vectors of the original system is difficult to detect, but also solves the problem that the efficiency of preparing double positive cells by dual vector transduction of target cells is low. Most importantly, a stable transfection packaging cell line can be constructed for expanded production, which is very beneficial to the application of the SynNotch system.

[0022] In order to further verify the induction efficiency of the SynNotch system in the PSR.Syn vector, the present invention selected four tumor antigens (human BCMA antigen, human CD38 antigen, human CD19 antigen, and human GPC3 antigen) as targets, and constructed PSR.SynCAR vectors respectively. In order to facilitate the detection of the induction efficiency of the SynNotch system, the UAS downstream effector molecule will select the fluorescent protein tagBFP. After co-culture with the corresponding tumor cells, the SynNotch receptor activation efficiency in the PSR.Syn vector can be evaluated by detecting the expression efficiency of tagBFP, and the target with the best induction efficiency can be screened out. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0024] Figure 1 It is a schematic diagram of the design of the vector PSR vector plasmid of the present invention;

[0025] Figure 2 It is a schematic diagram of the design of the PSR.Syn.BFP plasmid of the present invention;

[0026] Figure 3 This is a graph showing the transduction efficiency of Syn-CAR-T flow cytometry of the present invention;

[0027] Figure 4 This is a graph showing the results of flow cytometry detection of the induction efficiency of Syn-CAR-T cells after incubation with tumor cells. DETAILED DESCRIPTION

[0028] In order to enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below in conjunction with embodiments. Obviously, the described embodiments are only part of the embodiments of this application, rather than all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of this application.

[0029] Example 1 PSR.SynNotch vector construction

[0030] 1. Materials and Methods

[0031] DH5α competent cells were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. PB transposon plasmids and PB transposase plasmids were purchased commercially. Plasmids pCDH-CMV-TNFRSF17 (human), pHR_PGK_antiCD19_synNotch_Gal4VP64, pHR_Gal4UAS_tBFP_PGK_mCherry, pCDH-CMV-TNFRSF17 (human)-EF1a-CopGFP-T2A-Puro were purchased from Wuhan Miaoling Biotechnology Co., Ltd. Other genes EGFP, WPRE, SFFV are from commercial plasmids. Pheonix-Ampho cells and PG13 cells were purchased from the American Type Culture Collection (ATCC). 293T cells were purchased from the Cell Resource Center of Peking Union Medical College, Institute of Basic Medicine, Chinese Academy of Medical Sciences.

[0032] Pyrobest DNA polymerase, TAKARA BIO, Japan; plasmid purification kit, QIAGEN, Germany; 50×TAE gel electrophoresis buffer; ethidium bromide (EB) nucleic acid staining solution, Beijing Solebow Technology Co., Ltd.; 6×DNA loading buffer, TAKARA; sodium chloride, agarose, yeast powder, tryptone, agar powder, dimethyl sulfoxide (DMSO solution), Sigma, USA; anhydrous ethanol, Beijing Chemical Industry Group Co., Ltd.; PCR product purification kit, Nanjing Novozyme Biotechnology Co., Ltd.; DNA Assembly Mix Plus, puromycin hydrochloride, Beijing Rambolide Trading Co., Ltd.; endotoxin-free midi-plasmid extraction kit, Beijing Tiangen Biochemical Technology Co., Ltd.; ampicillin powder, BioRuler, USA. DMEM medium, Opti-MEM medium, fetal bovine serum (FBS), trypsin (1×EDTA), phosphate buffered saline (1×PBS), 100× penicillin-streptomycin solution (P / S), Gibco, USA; FuGene HD transfection reagent, Promega, USA; Retronectin (recombinant human nexin fragment), Takara, Japan; Trypan blue solution, Invitrogen, USA. Polybrene virus infection enhancement reagent, from Beijing Solaibao Technology Co., Ltd. If not otherwise specified, the reagents and raw materials used in the present invention are all from commercial reagents.

[0033] (I) PSR vector construction

[0034] The present invention utilizes the PB transposon system (PB transposon plasmid and PB transposase plasmid) to construct a stably transfected SIN-γ-RV vector (PSR), which can stably produce self-inactivating retroviral vectors. The specific design pattern is shown in FIG. Figure 1As shown. The 5'LTR, non-coding region UTR (Ψ element is the viral vector packaging signal, SD is the splicing donor site), and 3'SIN-LTR sequence of the SIN-γ-RV vector are inserted between the 5'ITR and 3'ITR sequences of the PB transposon. According to SCHAMBACH A, MUELLER D, GALLAM, et al. Overcoming promoter competition in packaging cells improves production of self-inactivating retroviral vectors [J]. Gene Therapy, 2006, 13 (21): 1524-33, the SIN-γ-RV vector was designed based on pSRS11.SF.GFP. SFFV is the internal promoter of the PSR vector. To facilitate the insertion of the target gene at a later stage, a multiple cloning site sequence (MCS) is inserted after the SFFV promoter. In order to increase the viral vector packaging titer, the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) sequence is inserted at the C-terminus of the MCS. In order to facilitate the screening of stable cell lines, two screening tags were designed. hEF1-HTLV promoter-CopGFP-T2A-Puro was inserted after the 3'SIN-LTR element. The Puro gene can be used for puromycin drug screening, and the CopGFP gene can be used for later fluorescence microscopy screening of high-expressing monoclonal cells. The 5' end packaging signal non-coding region (5'UTR) deleted all Gag and Pol coding region sequences and the start codon ATG, thereby further improving the vector packaging capacity and vector safety. The designed vector PSR.MCS was sent to Jinweizhi Biotechnology Co., Ltd. for gene synthesis.

[0035] (II) Design and construction of PSR.SynNotch plasmids targeting different antigens

[0036] Since the downstream effector molecules need the transcription factor Gal4VP64 to induce expression, they cannot be placed downstream of the promoter, so they should be designed upstream of the internal promoter and Gal4 induction receptor. The plasmids of the PSR.SynNotch vector targeting CD19 molecules, BCMA molecules, CD38 molecules, and GPC3 molecules are named PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), and PSR.GPC3.BFP (p170). The schematic diagram of the four plasmid designs is shown in the figure below. Figure 2As shown, the effector molecule (UAS tagBFP) and the inducible receptor (SFFV_scfv Notch Gal4VP64) of the SynNotch system were inserted between the 5'LTR and 3'SIN-LTR, and the inducible receptor protein was expressed by the SFFV promoter. In addition, P2A-EGFP fluorescent protein was added downstream of the GAL4VP64 protein as a detection tag for the vector receptor protein (CD19scfv, BCMA scfv, CD38 scfv, GPC3scfv).

[0037] 5'LTR(SEQ ID NO.1):ATGTAGTCTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGC ATTGCAGAGATTTGTATTTAAGTGCCTAGCTCGATACAATAAACGCGCCAGTCCTCCGATaGACTGcGTCGCCCGGGTACCCGTaTTCCCAATAAAgCCTCTTGCTGTTTGCATCCGAATCGTGGaCTCGCTGaTCCTTGGGAGGGTCTCCTCaGAtTGATTGACTGCCCACCTCGGGGGTCTTTCATT

[0038] 5’UTR(SEQ ID NO.2):TTGGAGACCCCTGCCCAGGGACCACCGACCCCCCCGCCGGGAGGTAAGCTGGCCAGCGGTCGTTTCGTGTCTGTCTCTGTCTTTGGGCGTGTTTGTGCCGGCATCTAGTGTTTGCGCCTGCGTCTGTACTAGTTGGCTAACTAGATCTGTATCTGGCGGTCCCGCGGAAGAACTGACGAGTTCGTATTCCCGGCCGCAGCCCCTGGGAGACGTCCCAGCGGCCTCGGGGGCCCGTTTTGTGGCCCATTCTGTATCAGTTAACCTACCCGAGTCGGACTTTTTGGAGCTCCGCCACTGTCCGAGGGGTACGTGGCTTTGTTGGGGGACGAGAGACAGAGACACTTCCCGCCCCCGTCTGAATTTTTGCTTTCGGTTTTACGCCGAAACCGCGCCGCGCGTCTTGTCTGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAAAATTAGCGGCCCG

[0039] 3’SIN-LTR(SEQ ID NO.3):ATGAAAGACCCCACCCACAACCCCTCACTCGGCGCGCCAGTCCTCCGATaGACTGcGTCGCCCGGGTACCCGTGTTCtCAATAAACCCTCTTGCaGTTGCATCCGAcTCGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTGCCCACCTCGGGGGTCTTTCATT

[0040] The construction of the four plasmids is divided into four target DNA fragments and a vector, which are connected by seamless cloning. The construction of the four plasmids is composed of four DNA fragments and a vector. Three of the DNA fragments and the vector fragment are consistent in each plasmid, and only the template plasmid of the SFFV_scfv Notch Gal4 fragment is different. The p167 plasmid consists of four fragments: fragment 1 (UAS tagBFP), the template comes from pHR_Gal4UAS_tBFP_PGK_mCherry (Wuhan Miaoling); fragment 2, the template comes from pHR_PGK_antiCD19_synNotch_Gal4VP64 (Wuhan Miaoling); fragment 3 (P2A EGFP), fragment 3 is a fusion fragment of EGFP and P2A, pBT2-4xUAS:P2A-EGFP (addgene#127591); fragment 4 (WPRE), fragment 8 is a vector fragment after double enzyme digestion. The SFFV_scfv Notch Gal4 of the other three plasmids are fragment 5, fragment 6, and fragment 7, respectively. The templates are replaced with anti BCMA scfv, anti CD38 scfv, and anti-GPC3-scfv based on fragment 2. Among them, anti BCMA scfv is from the bb2121 anti-BCMA antibody approved by the FDA; anti CD38 scfv is obtained by this research team through phage display antibody library screening, and it has been proven to have strong killing function in both in vivo and in vitro experiments. For details, see LI X, FENG Y, SHANG F, et al. Characterization of the Therapeutic Effects of Novel Chimeric Antigen Receptor T Cells Targeting CD38 on Multiple Myeloma [J]. Frontiers In Oncology, 2021, 11: 703087; anti BCMA scfv comes from commercial antibody anti BCMA scfv comes from commercial antibody mouse GC33 clone. Amplification primers need to add homology arms, where the primers for fragment 2, fragment 5, fragment 6, and fragment 7 are the same. The primer sequences are shown in Table 1 below. The vector plasmid is PSR.MCS, and the restriction endonucleases are XhoI and NotI-HF. The PCR product and the enzyme digestion product are subjected to agarose gel electrophoresis and gel recovery.

[0041] Table 1 Primer design for PCR amplification of four targeted PSR.SynNotch plasmids

[0042]

[0043] Note: The underlined part is the homology arm.

[0044] Among them, the sequence number of S-16-1F is SEQ ID NO.4, the sequence number of S-16-1R is SEQ ID NO.5, the sequence number of S-16-2F is SEQ ID NO.6, the sequence number of S-16-2R is SEQ ID NO.7, the sequence number of S-16-3F is SEQ ID NO.8, the sequence number of S-16-3R is SEQ ID NO.9, the sequence number of S-16-4F is SEQ ID NO.10, and the sequence number of S-16-4R is SEQ ID NO.11.

[0045] The preparation process of the target fragment is as follows: PCR amplification, agarose gel electrophoresis, and gel recovery. Finally, the recovered 4 target fragments are recombined and connected, and the connection reaction is carried out at 50℃ for 30min. The connection product is transformed into competent E. coli DH5α and then spread on LB plate, cultured at 37℃ overnight, 3 to 5 positive clones are selected for expansion culture, and the plasmid is extracted and sent to the company for sequencing. The plasmid strain with correct sequencing is selected for expansion culture, and the plasmid is extracted and concentrated.

[0046] (III) Preparation of four vectors PSR.Syn.BFP self-inactivating retroviral vectors

[0047] After Pheonix-Ampho cells and PG13 cells were revived, the cells were in good condition, and the cell generation was preferably within 5 generations. When the cell confluence was about 80%, the cells were digested and inoculated in a six-well plate at a cell density of 5×10 5 / well, 2mL per well, and 4 wells are reserved for later flow cytometry detection of transfection efficiency. On the second day of inoculation, wait until the cell confluence is 70%-80%. Remove the culture medium and add fresh warm Opti-MEM culture medium dropwise, 1.8mL per well. Calculate the volume of plasmid required for transfection, and add 3.3μg of plasmid to each well. The transfection plasmids are PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), PSR.GPC3.BFP (p170). Add Opti-MEM culture medium to dilute to 200μL / well, gently blow to mix, and incubate at room temperature for 10min. After incubation, the transfection complex was added dropwise and evenly into the six-well plate, 200 μL per well, and the six-well plate was gently cross-mixed and placed in a 37°C, 5% CO2 cell culture incubator for culture.

[0048] 24 hours after transfection, remove the supernatant of the six-well plate, replace with fresh warm 10% FBS-DMEM medium, 2.5 ml / well, and place in a 32°C, 5% CO2 cell culture incubator for culture. After 24 hours of culture at 32°C, gently aspirate the supernatant (48h virus vector supernatant), replace with fresh warm 10% FBS-DMEM medium, 2.5 ml / well, and continue to culture in a 32°C, 5% CO2 cell culture incubator. After 24 hours of culture, collect the cell supernatant (72h virus vector supernatant). The collected supernatant was filtered and purified with a 0.45μm disposable syringe filter, and the filtered virus vector was immediately placed in a -80°C refrigerator for aliquoting and storage.

[0049] (IV) Preparation of Syn-CAR-T

[0050] 10 mL of venous blood was collected from healthy volunteers, PBMC cells were extracted, IL-2 and OKT-3 were added to activate T cells, and after culturing with AIM-V complete medium for 48 hours, T cells were transduced with the supernatants of the four retroviral vectors prepared above, PSR.Syn.CD19.BFP (Syn-CAR167), PSR.Syn.BCMA.BFP (Syn-CAR168), PSR.Syn.CD38.BFP (Syn-CAR169), and PSR.Syn.GPC3.BFP (Syn-CAR170), and retronectin was used as a transduction reagent.

[0051] One day before transduction, add the transduction reagent Retronetin to the Non-treated 12-well plate for incubation, that is, add 1mL of 1×PBS solution and 10μL Retronetin reagent to each well and mix well. Store at 4℃ in the dark. 48h after T cell activation, observe the growth status of T cells. If T cells grow in large clusters, the growth status is good and viral vector transduction of T cells can be performed. Take out the Non-treated 12-well plate incubated with Retronetin, and recover the Retronetin supernatant of the 12-well plate. Add 2% BSA for neutralization for 30min. Add 1×PBS solution for washing and remove the PBS solution. Add 1mL of retroviral vector supernatant (Syn-CAR167, Syn-CAR168, Syn-CAR169, Syn-CAR170) to each well and centrifuge at 2500rpm for 60min at 32℃. To treat T cells, take 5×106 cells / well, add 1mL of retroviral vector supernatant and mix well, centrifuge at 2500rpm for 60min at 32℃. After centrifugation, return to the cell culture incubator for incubation for at least 1h. After incubation, add retroviral vector supernatant again and centrifuge for 1h for transduction. After centrifugation, return to the incubator for incubation for at least 1h. After incubation, centrifuge each well of cells into 1mL of fresh AIM-V complete medium and add IL-2, 1μL / well. Return to the incubator for culture. If the viral vector titer is low, transduction can be continued on the second day, using the same method as on the first day.

[0052] 48 hours after transduction, appropriate amount of Pan-T cells were taken as blank control, and the transduction efficiency was detected by flow cytometry. The positive rate of EGFP was used as the transduction efficiency.

[0053] (V) Cultivation of target cells

[0054] RPMI-CD19, K562-hBCMA, RPMI, and HepG2 were revived from liquid nitrogen tanks. RPMI-CD19, K562-hBCMA, and RPMI cells were sterile cultured in a 37°C, 5% CO2 cell culture incubator using RPMI complete culture medium, and subcultured once every 48 hours with RPMI complete culture medium to a cell density of 5×105 / mL. After culturing to the logarithmic growth phase, they were used for subsequent experiments until the end of the experiment. HepG2 cells were sterile cultured in a 37°C, 5% CO2 cell culture incubator using MEM complete culture medium, and subcultured once every 48 hours with MEM complete culture medium to a cell density of 5×105 / mL. After culturing to the logarithmic growth phase, they were used for subsequent experiments until the end of the experiment.

[0055] (VI) Co-culture of Syn-CAR-T cells and target cells

[0056] Observe the growth status of target cells and Syn-CAR-T cells. If the cells are in good condition, they can be co-cultured. The co-culture is divided into 5 groups. Syn-CAR167 is co-cultured with RPMI-CD19 and RPMI respectively. Syn-CAR168 is co-cultured with K562-hBCMA. Syn-CAR169 is co-cultured with RPMI. Syn-CAR170 is co-cultured with HepG2. Count the target cells and Syn-CAR-T cells. The co-culture ratio of effector cells to target cells is 1:1. Take 5×10 5 cells in a 1.5 mL centrifuge tube and centrifuge at 300 g for 5 min.

[0057] Carefully remove the supernatant and resuspend in AIM-V complete medium. Mix each group of effector cells with target cells and supplement IL-2. Return to the incubator for culture. After 48 hours of culture, treat the cells for flow cytometry. The flow cytometry was divided into 9 groups, 5 in the co-incubation group and 4 in the non-incubation group.

[0058] 2. Experimental results

[0059] (I) Successful construction of four PSR.SynNotch plasmids targeting different antigens

[0060] In this experiment, the lentiviral dual vector of the original SynNotch system was transformed into a PSR (stable self-inactivating γ-retroviral vector) single vector for transduction, namely PSR.SynNotch. In order to verify the induction efficiency of the PSR.SynNotch system for different antigen targets, four antigen-targeted PSR.SynNotch vectors were designed, namely targeting CD19, BCMA, CD38, and GPC3, respectively. The effector molecule after induction was the reporter gene tagBFP fluorescent protein. Since the downstream effector molecule requires the transcription factor Gal4VP64 to induce expression, it cannot be placed downstream of the promoter, so it is designed to be placed upstream of the internal promoter and the Gal4 induction receptor. The four constructed plasmids PSR.Syn.CD19.BFP, PSR.Syn.BCMA.BFP, PSR.Syn.CD38.BFP, and PSR.Syn.GPC3.BFP were downloaded from the official website of the sequencing company. The sequencing results were analyzed and compared using the biological software SnapGene, and the sequencing results were correct. Therefore, this experiment successfully constructed four vector plasmids PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), and PSR.Syn.GPC3.BFP (p170).

[0061] (II) Successfully prepared four different targeted Syn-CAR-T cells

[0062] The four successfully constructed plasmids were transiently transfected into Ampho cells, and the viral vectors were harvested 48h and 72h after transfection, namely PSR.Syn.CD19.BFP (Syn-CAR167), PSR.Syn.BCMA.BFP (Syn-CAR168), PSR.Syn.CD38.BFP (Syn-CAR169), and PSR.Syn.GPC3.BFP (Syn-CAR170). Volunteers were recruited to collect venous blood, and PBMCs were isolated and activated and cultured for 48h. The harvested viral vectors were transduced into T cells. The transduction efficiency was detected by flow cytometry 48h after transduction. Since P2A-EGFP was added as a molecular tag at the C-terminus of Gal4VP64, the positive rate of EGFP detected by flow cytometry can be used as the transduction efficiency of T cells. The flow cytometry results are as follows Figure 3 As shown, the transduction efficiencies of the four Syn-CAR-Ts were 50.0%, 30.36%, 36.36%, and 41.68%, respectively. The transduction efficiency was greater than 30%, proving that the four Syn-CAR-T cells were successfully prepared in this experiment.

[0063] (III) Verification of the induction function of Syn-CAR-T cells with four different targets

[0064] Syn-CAR-T cells targeting 4 different antigens were co-cultured with the corresponding target cells at a ratio of 1:1 for 48 hours. There were 5 groups of co-culture, Syn-CAR167 was co-cultured with RPMI-CD19 and RPMI, Syn-CAR168 was co-cultured with K562-hBCMA. Syn-CAR169 was co-cultured with RPMI, and Syn-CAR170 was co-cultured with HepG2. There were 4 groups without incubation, Syn-CAR167, Syn-CAR168, Syn-CAR169, and Syn-CAR170. The flow cytometry results are as follows Figure 4As shown. When the four Syn-CAR-Ts were not co-incubated with tumor cells, the effector molecule tagBFP fluorescent protein had low background leakage expression, and the MFI values ​​of the four Syn-CAR-Ts were 3344, 3228, 4986, and 3257, respectively, which were all higher than the Control group (2567); when the four Syn-CAR-Ts were co-incubated with CD19+, BCMA+, CD38+, and GPC3+ tumor cells, only Syn-CAR167 had the highest induction efficiency (MFI: 17528), and the MFI value was 5.2 times that of the non-incubated (3344). When Syn-CAR167 was co-cultured with RPMI (CD19-), the induction efficiency was extremely low, and the MFI value was the same as that when it was not incubated, proving that Syn-CAR167-T cells can be specifically induced to express, and only when co-incubated with CD19-positive cells can the expression be induced. The MFI values ​​of the induced group of the other three groups of Syn-CAR-T were similar to those of the uninduced group, indicating that the induction efficiency of the targets BCMA, CD38, and GPC3 was extremely low and not suitable for the SynNotch system. In summary, the target CD19 had the highest induction efficiency and was most suitable for the SynNotch system.

[0065] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are also intended to be encompassed by the appended claims.

Claims

1. SynNotch system delivery method, characterized in that, The method comprises: Step 1: Use the PiggyBac transposon system to construct a stable transfection SIN-γ-RV vector, namely the PSR vector; Step 2: Use the PSR vector prepared in step 1 to express the SynNotch system, and combine the GAL4 inducible vector and the UAS effector vector of the SynNotch system into one of the PSR vectors, so that the SynNotch system is delivered by one of the PSR vectors.

2. The method according to claim 1, characterized in that In step 1, the 5'LTR, 5'UTR, and 3'SIN-LTR sequences of the SIN-γ-RV vector are sequentially inserted between the 5'ITR and 3'ITR sequences of the PB transposon of the PiggyBac transposon system; the non-coding region UTR includes a Ψ element for a viral vector packaging signal and a SD for a splicing donor site, and the U3 region is deleted in the 3'SIN-LTR sequence, leaving only the R region and the U5 region.

3. The method according to claim 2, characterized in that The 5'UTR deleted all Gag and Pol coding region sequences and the start codon ATG.

4. The method according to claim 2, characterized in that: The SFFV promoter, the multiple cloning site sequence MCS and the woodchuck hepatitis virus post-transcriptional regulatory element WPRE sequence are sequentially inserted between the non-coding region 5'UTR and the 3'SIN-LTR sequence.

5. The method according to claim 4, characterized in that The hEF1-HTLVpromoter-CopGFP-T2A-Puro sequence is inserted after the 3'SIN-LTR sequence, wherein the Puro gene is used for puromycin drug screening, and the CopGFP gene is used for later fluorescence microscopy screening of high-expressing monoclonal cells.

6. The method according to claim 2, characterized in that In step 2, the effector molecules and inducible receptors of the SynNotch system are sequentially inserted between the 5'LTR and the 3'SIN-LTR.

7. The method according to claim 6, characterized in that A fluorescent protein is added downstream of the induced receptor as a detection label for the carrier receptor protein.

8. A SynNotch system delivery vector constructed according to any one of claims 1-7.

9. Use of the SynNotch system delivery vector according to claim 1 in CAR-T cell therapy.

Images