Method for preparing ginsenoside Rg1 by biological enzyme method

Abstract

The invention provides a method for preparing ginsenoside Rg1 by a biological enzyme method. The method specifically comprises the following steps: constructing genetically engineered bacteria capable of heterologously expressing beta-glucosidase; fermenting the genetically engineered bacteria to prepare beta-glucosidase liquid; taking ginsenoside RE or a plant extract or a plant raw material containing a compound with the same structure as the ginsenoside RE as a substrate, adding the prepared beta-glucosidase solution and a buffer solution, stirring and mixing to obtain a mixed solution, and performing hydrolysis reaction to obtain ginsenoside RG1. The ginsenoside RE is used as a raw material, so that the preparation cost is relatively low; escherichia coli is used as host bacteria, heterologous expression of a gene sequence of beta-glucosidase derived from aspergillus niger CBS 101883 is realized, the constructed genetically engineered bacteria are good in stability, and the prepared enzyme liquid is high in activity; under the conversion condition provided by the invention, the conversion period of the enzyme liquid to the substrate is short, the specificity is strong, and the conversion efficiency is high.

Description

Technical Field

[0001] The invention relates to the technical field of bioenzyme preparation, and in particular to a method for preparing ginsenoside Rg1 by a bioenzyme method. Background Art

[0002] Ginsenoside Rg1 is a tetracyclic triterpenoid derivative, colorless needle-shaped crystals; molecular formula, C 48 H 82 O 18 , CAS registration number is 51542-56-4, easily soluble in water, methanol, ethanol, insoluble in ether and benzene. It mainly exists in the roots, buds, leaves, rhizomes, stems of ginseng of the Araliaceae family, and the roots of American ginseng; ginsenosides are distributed in different parts of ginseng, and ginsenoside Rg1 is one of the main saponins isolated. When it is partially / completely deglycosylated, the product is called rare ginsenoside, which has stronger activity and better bioavailability. The molecular structure of ginsenoside Rg1 is as follows:

[0003]

[0004] Existing studies have found that ginsenoside Rg1 has the effects of promoting hippocampal neurogenesis, improving neural plasticity, enhancing learning and memory, anti-aging, anti-fatigue, improving immunity, assisting in anti-tumor, and restoring sexual function. It has broad application prospects in high-end health care, assisting in anti-tumor, and preventing and treating neurodegenerative diseases such as Alzheimer's disease.

[0005] At present, the preparation methods of ginsenoside Rg1 mainly include plant raw material extraction method, microbial fermentation method, genetic engineering microbial transformation method, enzyme transformation method, etc., such as:

[0006] Chinese patent document CN102086223A provides a method for preparing ginsenoside Rg1 by extracting raw materials from plants. Specifically, total saponins are obtained by extracting raw medicinal materials such as Panax notoginseng, ginseng, American ginseng, and Gynostemma pentaphyllum, and ginsenoside Rg1 with a purity greater than or equal to 95% is obtained by using a combination of macroporous adsorption resin and organic solvent extraction.

[0007] Chinese patent document CN111363774A provides a scheme for preparing ginsenoside Rg1 by microbial fermentation, specifically discloses a method for fermenting ginseng with lactobacillus, ginseng fermentation products and uses. The method for fermenting ginseng with lactobacillus comprises the following steps: (1) adding water to ginseng powder to prepare ginseng homogenate, sterilizing, and obtaining ginseng sterilized liquid; wherein the amount of ginseng added to the ginseng homogenate is 5-12wt%; (2) after the ginseng sterilized liquid is cooled, inoculated with lactobacillus seed liquid, and fermented on a shaking table at a fermentation temperature of 24-36°C, with a shaking table speed of 100-300rmp and a fermentation time of 20-50h, to obtain ginseng fermentation products. The ginseng fermentation product can be used to prepare ginsenoside Rg1 monomer or its composition.

[0008] Chinese patent document CN114045270B provides a scheme for preparing ginsenoside Rg1 by genetic engineering microbial transformation, and specifically discloses a method for producing ginsenoside Rg1 and a dedicated engineered bacterium. The scheme introduces the coding gene of phosphoglucomutase 1, the coding gene of α-phosphoglucomutase, the coding gene of uridine diphosphate glucose pyrophosphorylase, the coding gene of Arabidopsis UDP-glucose dehydrogenase 1, the coding gene of Arabidopsis UDP-glucuronic acid decarboxylase 3 and the coding gene of ginseng UDP-glycosyltransferase 101 into the strain BY-PPD-PPT for producing PPT, obtains recombinant yeast Rg1-XM, and produces ginsenoside Rg1 by the constructed recombinant yeast Rg1-XM.

[0009] However, in the above-mentioned method for preparing ginsenoside Rg1, direct extraction is performed using plant medicinal materials, which have limited raw material sources, are expensive, and have relatively low yields; the microbial fermentation method has a long fermentation cycle and more non-specific transformations; the genetic engineering microbial transformation method has a long cycle and more non-specific transformations; the enzyme transformation method has low enzyme activity and low efficiency. Therefore, it is urgent to develop a method for preparing ginsenoside Rg1 with low cost, relatively short production cycle, and high yield. Summary of the invention

[0010] The technical problem to be solved by the present invention is to provide a method for preparing ginsenoside Rg1 by a bioenzymatic method in view of the problems existing in the prior art. The method of the present invention is to construct a recombinant expression vector by connecting the gene sequence of synthetic β-glucosidase to a PET vector, and then transforming it into an Escherichia coli strain to construct a recombinant engineered bacterium, extracting a large amount of fermentation bacterial liquid expressing β-glucosidase, and using ginsenoside RE or a plant extract or plant raw material containing a compound with the same structure as ginsenoside RE as a substrate, and obtaining ginsenoside RG1 by bioenzymatic fermentation. The method provided by the present invention has a short conversion cycle, strong specificity, and high conversion efficiency.

[0011] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0012] The present invention provides a method for preparing ginsenoside Rg1 by a bio-enzymatic method, which specifically comprises the following steps:

[0013] (1) constructing a genetically engineered bacterium capable of heterologously expressing β-glucosidase;

[0014] (2) fermenting the genetically engineered bacteria to prepare a β-glucosidase enzyme solution;

[0015] (3) Using ginsenoside RE as a substrate, adding the β-glucosidase solution prepared in (2), stirring and mixing, and performing a bioenzymatic hydrolysis reaction to obtain ginsenoside RG1.

[0016] Furthermore, plant extracts containing compounds with the same structure as ginsenoside RE include but are not limited to ginseng total saponin extracts and Panax notoginseng total saponin extracts; plant raw materials containing compounds with the same structure as ginsenoside RE include but are not limited to ginseng flowers, whole ginseng plants, ginseng stems and leaves, Panax notoginseng flowers, whole Panax notoginseng plants, and Panax notoginseng roots.

[0017] Furthermore, the process of step (1) constructing a genetically engineered bacterium capable of heterologously expressing β-glucosidase is specifically as follows: a synthetic gene sequence of β-glucosidase is selected, connected to an expression vector, and then transferred into Escherichia coli to construct a genetically engineered bacterium capable of heterologously expressing β-glucosidase; and then stored in glycerol to obtain a glycerol strain for later use.

[0018] Furthermore, the synthetic gene sequence of β-glucosidase is selected from the gene sequence of β-glucosidase derived from Aspergillus niger CBS 101883.

[0019] Furthermore, the expression vector is selected from the plasmid vector pET-28a(+).

[0020] Furthermore, the Escherichia coli host bacteria is selected from Escherichia coli BL21 (DE3).

[0021] Further,

[0022] Step (2) The method for preparing β-glucosidase enzyme solution by fermentation of genetically engineered bacteria is specifically as follows: taking out the glycerol strain stored in a -20°C refrigerator, inoculating the glycerol bacteria into 5 ml LB culture medium at a 1% inoculation amount, and shaking and culturing at 220 rpm and 37°C overnight (15 h); then inoculating the activated bacterial solution into the LB culture medium at a 1% inoculation amount, shaking and culturing at 37°C until the OD is 0.4-0.6, and then adding 1 mmol isopropyl-β-d-thiogalactoside (IPTG) to induce expression; taking the resuspended bacterial suspension into a 50 ml centrifuge tube, placing the centrifuge tube in ice water, adjusting the height for ultrasonic disruption and centrifugation;

[0023] The supernatant after centrifugation is taken to obtain a crude enzyme solution of β-glucosidase; the crude enzyme solution is purified and stored at low temperature for later use.

[0024] Further,

[0025] The conversion conditions in step (3) are: pH of the mixture is 4.5 to 6.5, the reaction temperature is 25 to 55° C., and the conversion time is 2 to 16 hours.

[0026] Further,

[0027] The concentration of the substrate in the mixture is 0.5% to 2.5%.

[0028] Further,

[0029] The enzyme concentration in the mixture is 0.01-0.5 mg.

[0030] Preferably,

[0031] The buffer was 50 mM phosphate buffer.

[0032] Beneficial effects of the present invention:

[0033] The present invention provides a method for preparing ginsenoside Rg1 by a bioenzymatic method. The method of the present invention comprises the following steps: connecting a gene sequence for synthesizing β-glucosidase to a PET vector to construct a recombinant expression vector, then transforming the vector into Escherichia coli to construct a recombinant engineered bacterium, extracting a large amount of fermentation bacterial liquid expressing β-glucosidase, and hydrolyzing ginsenoside RE or a plant extract or a plant raw material containing a compound having the same structure as ginsenoside RE to obtain ginsenoside RG1.

[0034] The invention uses ginsenoside RE or a plant extract or plant raw material containing a compound having the same structure as ginsenoside RE as a substrate, and has a low preparation cost; uses Escherichia coli as a host bacterium, heterologously expresses a gene sequence of beta-glucosidase derived from Aspergillus niger CBS101883, and the constructed genetically engineered bacteria has good stability and the prepared enzyme solution has high activity; under the conversion conditions provided by the invention, the enzyme solution has a short conversion cycle for the substrate, strong specificity and high conversion efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a schematic diagram of the reaction of preparing ginsenoside Rg1 by the bioenzymatic method provided by the present invention.

[0036] Figure 2 This is an SDS-PAGE detection diagram of the recombinant β-glucosidase of the embodiment of the present invention.

[0037] Figure 3This is a high performance liquid chromatogram of the ginsenoside RG1 product prepared in Example 3 of the present invention. DETAILED DESCRIPTION

[0038] In order to facilitate the understanding of the present invention, the present invention will be described more fully below with reference to the relevant drawings. Preferred embodiments of the present invention are provided in the drawings. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing the specific embodiments and are not intended to limit the present invention. In the embodiments, if specific conditions are not specified, they are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0040] Example 1 Construction of an engineered bacterium capable of heterologously expressing β-glucosidase

[0041] 1. Selection of genes for synthesizing β-glucosidase

[0042] β-Glucosidase (β-D-Glucosidase), also known as β-D-glucoside glucohydrolase, is also known as gentiobiase, cellobiase (cellobias, CB or β-G) and amygdalinase. It belongs to the cellulase class and is an important component of the cellulolytic enzyme system. It can hydrolyze the β-D-glucose bond bound to the terminal non-reducing bond, while releasing β-D-glucose and the corresponding ligand. Since β-glucosidase has the function of catalyzing the hydrolysis of the non-reducing β-D-glucose sidic bonds at the ends of the sugar chains of molecules such as alkyl glycosides and aryl glycosides, it can bioconvert the glycosylated main ginsenosides into rare ginsenosides (reference public literature: Zhong Shuning, "Study on the Biotransformation of Ginsenosides by β-glucosidase and Its Interaction Mechanism", Jilin University 2021 doctoral thesis). In the scheme of the present invention, ginsenoside RE is used as a raw material, and ginsenoside RG1 is obtained by hydrolysis with β-glucosidase.

[0043] The plant sources of β-glucosidase include ginseng, soybeans, etc.; there are many reports on microbial sources, such as Flavobacterium meningosepticum, Flavobacterium johnsonae, etc. from prokaryotic microorganisms, Candida peltata, Phanerochaete chrysosporium, etc. from eukaryotic organisms; the animal sources of β-glucosidase include bees, pig liver, pig small intestine, etc. The source of the β-glucosidase used in the following examples of the present invention is the β-glucosidase gene sequence of Aspergillus sp strain Aspergillus niger CBS101883 (https: / / www.ncbi.nlm.nih.gov / nuccore / NW_020290895.1?from=24442&to=26064&report=fasta&strand=true), whose Gene ID is 37104738. The known gene sequence is as follows:

[0044] ATGGTCAAGCTACTTCCCACCTTCCTGCTCCAAGCTGGCTTCGCTCTCGCAGCAGTGGA

[0045] ATATCTCAACTGGACTACTTACATCGCCAACGGTGTGAACCTGGGCGGGTGGCTTGAGC

[0046] AAGAAAGCACCATCGATACTACTTGATGGCTCAATATTCCAAGGGTGCGGACGATGAA

[0047] TGGGGCCTTTGTGTGAATCAAGGCTCCCAGTGTGGTCCTATTCTTGAGCGAAGATATGCG

[0048] ACCTATATCACCACCTCAGATATCGATACGTTGGCGAACGCCGGAGTGAACACTTTGCGT

[0049] ATCCCCACCACATATGCTGCTTGGGTCAAAGTGCCCGGGTCCCAGCTGTACTCTGGGAA

[0050] CCAGGTATCCTTTCTGAACAACATTGCAACATATGCTATCACTAGGTATTCCATGCATATC

[0051] ATCATCGATGTACACTCCTTACCAGGTGGAGTGAACGGTAAGGCGTTCGGGGAGGCAAC

[0052] AGGACATTACGGATGGTTCAACAACCAAACGGCGTTGGATTACTCGCTTCAGGCTATCG

[0053] ATTCCGTCATTGCCTATATTCAGAACTCCAGCAATCCTGGATCCTATACTATTGAGCCTATC

[0054] AACGAGCCCGTCGACAATAAAGATATGTCAGCATTCGGGAGTCCAGAAGCATTATCCGA

[0055] TGAAGGCGCAGCTTGGGTTTTGAAGTACATTCAGGCAGTACTGGACAAGGTTGAGGTGA

[0056] TCAGCCCGGATATACCGGTCATGTTCCAAGGCAGTTTCCGAGGCGAGGAGTACTGGTCA

[0057] CCCAACTTCTCTACATCCGCTAACCTGGTATTCGATGTGCACAACTATTATTTTGCCGGAC

[0058] GAGGAGCAACCGGTAAGAATATCACGACCTACATCTGTGCCGATGCAAAGAATGGAGCC

[0059] GGTGATGGCAAATTTCCCGTATTTGTCGGCGAATGGTCGATCCAGGCACAGTACAATAAC

[0060] TCCTTTGCTGACAGAGATGAAGCTCTCAACACCGGGCTCTATGCTTCTGCGAAAGATTC

[0061] CCAGGGGAGTGCCTATTGGAATGCCAAGTTTTCGGGGAATGCAACCGTCGACGGCCAA

[0062] GGTACACAGGCTGACTACTGGAATTACATGACCTGGATTGACAATGACATGATCCATCCG

[0063] GACGAAGCTTCTGGGGTGTGTGCATAGGTGAGCGCTTAGATGAGCCGTTTGGACTACGT

[0064] GAGGGTAGGGCAGTGTTCTAGCCGCGTCCAGCAGACAACATTCTTCATCGAGATTGCCA

[0065] CACCAACCAAAAGACTACTCTTTTGGCCATCGATCTTTTCTTGTTTTGGTTTCGTGAATCT

[0066] TACTGCTGTGCTCTAAGTAATACCGGGTAGGTCAAGTTGAAATACTAGTGCTACTTTAGA

[0067] GAAACATCATTTAATCAATGCCTACTTAATGTGCTGTAGACTTGTTTCTTCCCAGCTTTCT

[0068] TCTTCAAACTTAATCAGACCCAAGGTACCTACGGCGGTTAATGCTTATCACATGACAAGG

[0069] GCGTTGCTCTCTCCACTGGATGCCAAACGGCGACTCTCGCTACGCACTGACAAATCCCA

[0070] ACCTGGCCCCATCCAGCTATGGCTCGAGTCCTACCGACGAGTCTGATGATCATGGATTGG

[0071] GACCATCTTGCGG

[0072] The above gene sequences used in this example were purchased from Shanghai Bioengineering.

[0073] 2. Construction of recombinant expression vector

[0074] The gene sequence of the synthetic β-glucosidase was connected to the pET plasmid vector to obtain a recombinant plasmid, which was then transformed into Escherichia coli DH5α.

[0075] After the E. coli DH5α strain carrying the recombinant plasmid was activated and amplified, the plasmid was extracted according to the instructions of the Tiangen Plasmid DNA Small Quantity Extraction Kit for enzyme digestion identification. The PET plasmid vector in this example uses pET-28a(+).

[0076] The enzyme digestion system is as follows:

[0077]

[0078] After gently mixing, place in a 37°C water bath, take out after 1 hour of water bath, and perform agarose gel electrophoresis detection.

[0079] 3. The recombinant plasmid was transformed into E. coli expression competent cells to obtain recombinant E. coli containing the target gene: 2 μl of the recombinant plasmid was added to 50-100 μl of E. coli BL21 (DE3) competent cells, gently mixed and placed on ice for 30 min; heat shock was performed in a 42°C water bath for 90 s, and the cells were quickly removed and placed on ice for 5 min; 800 μl of LB liquid culture medium equilibrated to room temperature was added, and cultured at 37°C and 150 rpm for about 1 h; 100-200 μl of the bacterial solution was evenly spread on an LB solid plate culture medium containing 100 μg / mL kanamycin; the plate was inverted after there was no flowing liquid on the surface, and cultured at 37°C until a single colony appeared.

[0080] 4. Screening of positive clone plasmids: Pick a single colony on the transformation plate and place it in 5 mL LB liquid culture medium (kanamycin 100 μg / mL), culture at 37°C and 200 rpm until saturation. Perform PCR amplification and identification using specific primers.

[0081] Table 1 PCR amplification primers

[0082] Primer name Primer sequences Upstream primer GGATCCATGGTCAAGCTACTTCCCACCTTCC Downstream primer GAATTCCCGCAAGATGGTCCCAATCCATGAT

[0083] The PCR reaction system is as shown in Table 2:

[0084] Table 2 PCR reaction system

[0085] PrimeSTARMaxpolymerase (2×) 12.5μL Upstream primer (20 μmol / L) 1μL Downstream primer (20 μmol / L) 1μL DNA template 1.0μL Ultrapure water 9.5μL

[0086] After gentle mixing, PCR amplification was performed according to the following cycle parameters: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 50°C annealing for 15 s, 72°C extension for 1 min, for a total of 30 cycles; 72°C extension for 10 min, and storage at 4°C. The PCR reaction product was identified by 1% agarose gel electrophoresis. The PCR product of the expected size was identified by electrophoresis, and the DNA fragment was recovered and purified using the Agarose Gel DNA Purification Kit.

[0087] 5. Identification of induced expression of recombinant β-glucosidase gene

[0088] Take out the E.coli BL21 (DE3) glycerol bacteria containing the target gene stored at -80°C, melt at room temperature, absorb at 2.5% inoculum, add to LB liquid medium containing a final concentration of 100μg / mL kanamycin (Kana), and culture at 37°C with a constant temperature of 220rpm. After the OD600 value reaches 0.4-0.6, add a final concentration of 1mmol / L isopropyl-β-d-thiogalactoside (IPTG) to induce protein expression. Induction experimental conditions: induction temperature 20°C, induction time 15h, shaking speed 220rpm. Take out the induced bacterial solution and centrifuge at 10000rpm for 10min. Use phosphate buffer at a ratio of 1:10 (w / v) to cool the sample in an ice-water mixture environment. Ultrasonicate the sample until the solution is no longer viscous.

[0089] The supernatant and precipitate were centrifuged at 10,000 rpm for 10 min, and the supernatant and precipitate were retained for testing and SDS-PAGE was performed to verify the expression protein effect. The results are shown in the attached figure. Figure 2 shown.

[0090] The obtained recombinant Escherichia coli is preserved in glycerol to obtain glycerol bacteria.

[0091] Example 2 Engineering bacteria fermentation and enzyme solution extraction

[0092] On the basis of Example 1, the glycerol strain stored in a -20°C refrigerator was taken out and inoculated (according to a 5% inoculation amount) into 5ml LB (containing 100μg / mL kanamycin (Kana)) medium, and cultured overnight at 220rpm and 37°C with shaking (15h). The activated bacterial solution was inoculated into the LB medium at a 1% inoculation amount, and cultured at 37°C with shaking until OD 0.4-0.6, and then 1mmol isopropyl-β-d-thiogalactoside (IPTG) was added to induce expression. The resuspended bacterial suspension (10) ml was placed in a 50ml centrifuge tube, and the centrifuge tube was placed in ice water, and the height was adjusted for ultrasonic crushing and centrifugation. The supernatant after centrifugation was taken to obtain a crude enzyme solution of β-glucosidase.

[0093] 1. Enzyme activity detection

[0094] Prepare p-nitrophenyl-β-D-pyranoglucoside (pNPG) solution (10mmol / L) with sodium acetate buffer (0.1mol / L) as solvent. Take 1ml pNPG solution in 5ml centrifuge tubes, 6 tubes, incubate at 37℃ for 5 minutes, take out, add 50μL crude enzyme solution (80 times dilution) to 3 tubes respectively, and add 50μL pure water to the other 3 tubes as blank control, incubate at 37℃ for 5 minutes, take out, add 1ml sodium carbonate solution (1mol / L) to terminate the reaction, and observe the color change. The absorbance of each tube sample was measured at a wavelength of 405nm, and the results are shown in Table 3 below:

[0095] Table 3 Absorbance of each sample

[0096]

[0097] According to the difference in absorbance between the sample solution and the control solution, the corresponding p-nitrophenol micromoles are found on the standard curve. The activity of β-glucosidase is expressed as the p-nitrophenol micromoles released by the hydrolysis of p-nitrophenyl-β-D-pyranoglucoside (pNPG) per gram of sample per hour at 37°C. Calculation formula:

[0098] β-glucosidase activity = C × V × n / t × Vs

[0099] Where:

[0100] C——micromoles of p-nitrophenol obtained from the standard curve, μmol;

[0101] V——total volume of enzymatic reaction solution, mL;

[0102] Vs——the volume of sample extract taken during the determination, mL;

[0103] t——enzymatic reaction time, min;

[0104] N——Dilution multiple of enzyme solution.

[0105] The enzyme activity of this example was calculated to be 35.92 U / ml.

[0106] 2. Enzyme purification: In this example, the extracted enzyme crude solution is purified by the following method:

[0107] 1. Filler: Boglon Ni Bestarose FF

[0108] 2. Reagents:

[0109] (1) Balance solution (0.02 M imidazole, 0.2 M sodium chloride, 0.05 M phosphate buffer, pH 7.5) 200 ml:

[0110] Imidazole 0.272 g;

[0111] Sodium chloride 2.32 g;

[0112] 1.2 g of anhydrous sodium dihydrogen phosphate.

[0113] (2) Eluent (0.5 M imidazole, 0.2 M sodium chloride, 0.05 M phosphate buffer, pH 7.5) 200 ml:

[0114] Imidazole 6.8 g;

[0115] Sodium chloride 2.32 g;

[0116] Anhydrous disodium hydrogen phosphate 1.42 g.

[0117] 3. Purification method:

[0118] (1) Pipette 1 ml of filler into a 5 ml centrifuge tube, let it settle, and discard the supernatant;

[0119] (2) Wash with pure water, let stand to settle, discard the supernatant, and repeat for a total of 3 times;

[0120] (3) Add equilibration solution, place on a shaker and shake for 5-10 min, let stand to settle, discard the supernatant, and repeat 3 times;

[0121] (4) Add about 5 ml of crude enzyme solution and shake on a shaker for more than 30 min;

[0122] (5) Allow to settle and save the supernatant;

[0123] (6) Add 4 ml of equilibration solution each time, place in a shaker and shake for 5-10 min, let stand to settle, save the supernatant, and repeat twice;

[0124] (7) Add eluent

[0125] The first time, 1 ml was placed in a shaker and shaken for about 10 minutes, then allowed to settle and the supernatant was saved;

[0126] The second time, 1 ml, put it into a shaker and shake for about 10 minutes, let it stand and settle, and save the supernatant;

[0127] The third time, 1 ml was placed in a shaker and shaken for about 10 minutes, then allowed to settle and the supernatant was saved;

[0128] The supernatants were combined to obtain the purified enzyme solution, which was stored at low temperature for future use.

[0129] Example 3 Ginsenoside RE was used as raw material and ginsenoside RG1 was obtained by β-glucosidase enzymatic hydrolysis.

[0130] On the basis of Example 2, ginsenoside RE was used as a substrate, the enzyme solution extracted and purified in Example 2 and 50 mM phosphate buffer were added, stirred and mixed to obtain a mixed solution, the pH of the mixed solution was adjusted to 4.5, the substrate concentration in the mixed solution was 0.5%, the enzyme concentration was 0.05 mg, the reaction was stirred, the reaction temperature was 25°C, and the conversion time was 16 hours. The reaction was terminated when the liquid phase detection was performed until the product concentration did not increase within 0.5 hours.

[0131] Example 4

[0132] This example is also carried out on the basis of Example 2, and the difference from Example 3 is that the pH of the mixed solution is 5.5, the substrate concentration in the mixed solution is 1.5%, the enzyme concentration is 0.01 mg, the reaction is stirred, the reaction temperature is 45°C, and the conversion time is 2 hours. The reaction is terminated when the liquid phase detection is performed until the product concentration does not increase within 0.5 hours.

[0133] Example 5

[0134] This example is also carried out on the basis of Example 2, and the difference from Example 3 is that the pH of the mixed solution is 6.5, the substrate concentration in the mixed solution is 2.5%, the enzyme concentration is 0.5 mg, the reaction is stirred, the reaction temperature is 55°C, and the conversion time is 9 hours. The reaction is terminated when the liquid phase detection is performed until the product concentration does not increase within 0.5 hours.

[0135] The conversion products after the reaction of Example 3, Example 4, and Example 5 were collected and filtered through a membrane, and then passed through an anion and cation resin column to remove some ions to obtain the ginsenoside RG1 product. The products obtained in Examples 3-5 were measured, and the measurement method was based on the Chinese Pharmacopoeia 2020 Edition Volume 1, and the measurement was performed according to high performance liquid chromatography:

[0136] 1. Chromatographic conditions and system suitability test:

[0137] Column: Hypersil ODS-C18, 4.6×250 mm, 5 μm;

[0138] Detection wavelength: 203nm;

[0139] Flow rate: 1.3 ml / min;

[0140] Column temperature: 30°C;

[0141] Injection volume: 10 μl;

[0142] Gradient mobile phase: acetonitrile: 0.05% phosphate;

[0143] Running time: 105 min. The elution program is shown in Table 4 below:

[0144] Table 4 Elution program

[0145] Time (min) Flow rate (ml / min) A (0.05% phosphoric acid aqueous solution) B (acetonitrile, chromatography grade) 0 1.3 80 20 25 1.3 80 20 31 1.3 75 25 85 1.3 65 35 90 1.3 50 50 91.9 1.3 50 50 92 1.3 80 20 105 1.3 80 20

[0146] 2. Preparation of reference solution:

[0147] Accurately weigh appropriate amounts of ginsenoside Rg1 and Re reference substances, add methanol to make a mixed solution containing about 0.2 mg per 1 ml.

[0148] 3. Preparation of sample solution:

[0149] Accurately weigh an appropriate amount of the reaction product obtained in Examples 3 to 5 above (reference value 500 mg, which can be adjusted appropriately according to the actual area value), accurately weigh, place in a 50 ml volumetric flask, add about 40 ml of methanol, ultrasonically extract for 30 minutes, let it cool to room temperature, dilute to the scale with methanol, shake well, and filter with a 0.22 μm organic phase microporous filter membrane to obtain the test solution.

[0150] 4. Determination: Accurately pipette 10 μl of the reference solution and the test solution, respectively, and inject them into the liquid chromatograph to record the chromatogram. The chromatogram of Example 3 is as follows: Figure 3 As shown, the peak area was calculated using the external standard method.

[0151] The product purity and conversion rate of each example were measured and calculated as shown in Table 5:

[0152] Table 5 Conversion results of Examples 3-5

[0153] Example Example 3 Example 4 Example 5 Conversion rate 95.6％ 98.1％ 97.3％ Liquid phase purity 96.2％ 98.3％ 97.7％

[0154] In summary, the present invention uses ginsenoside RE or a plant extract or plant raw material containing ginsenoside RE as a substrate, and has a low preparation cost; Escherichia coli is used as a host bacterium, and the gene sequence of β-glucosidase derived from Aspergillus niger CBS101883 is heterologously expressed, and the constructed genetically engineered bacteria has good stability and the prepared enzyme solution has high activity; under the conversion conditions provided by the present invention, the enzyme solution has a short conversion cycle for the substrate, strong specificity, and high conversion efficiency.

[0155] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for preparing ginsenoside Rg1 by a bioenzymatic method, characterized in that: The specific steps include: (1) constructing a genetically engineered bacterium capable of heterologously expressing β-glucosidase; (2) fermenting the genetically engineered bacteria to prepare a β-glucosidase enzyme solution; (3) Using ginsenoside RE or a plant extract or plant raw material containing a compound having the same structure as ginsenoside RE as a substrate, adding the β-glucosidase solution prepared in (2), stirring and mixing, and performing a bioenzymatic hydrolysis reaction to obtain ginsenoside RG1.

2. The method for preparing ginsenoside Rg1 by bioenzymatic method according to claim 1, characterized in that: The process of step (1) constructing a genetically engineered bacterium capable of heterologously expressing β-glucosidase is as follows: a synthetic gene sequence of β-glucosidase is selected, connected to an expression vector, and then transferred into Escherichia coli to construct a genetically engineered bacterium capable of heterologously expressing β-glucosidase; and then stored in glycerol to obtain a glycerol strain for later use.

3. The method for preparing ginsenoside Rg1 by bioenzymatic method according to claim 2, characterized in that: The gene sequence for synthesizing β-glucosidase is selected from the gene sequence of β-glucosidase derived from Aspergillus niger CBS101883.

4. The method for preparing ginsenoside Rg1 by bioenzymatic method according to claim 2, characterized in that: The expression vector was selected from the plasmid vector pET-28a(+).

5. The method for preparing ginsenoside Rg1 by bioenzymatic method according to claim 2, characterized in that: The E. coli host strain was selected from E. coli BL21 (DE3).

6. The method for preparing ginsenoside Rg1 by bioenzymatic method according to any one of claims 2 to 5, characterized in that: The conversion conditions in step (3) are: pH of the mixture is 4.5 to 6.5, the reaction temperature is 25 to 55° C., and the conversion time is 2 to 16 hours.

7. The method for preparing ginsenoside Rg1 by bioenzymatic method according to any one of claims 2 to 5, characterized in that: The concentration of the substrate in the mixture is 0.5% to 2.5%.

8. The method for preparing ginsenoside Rg1 by bioenzymatic method according to any one of claims 2 to 5, characterized in that: The enzyme concentration in the mixture is 0.01-0.5 mg / ml.

9. The method for preparing ginsenoside Rg1 by bioenzymatic method according to any one of claims 2 to 5, wherein the buffer is 50 mM phosphate buffer.

Images