Digital PCR kit for detecting TREC and KREC copy numbers and application method thereof

Abstract

A digital PCR kit for detecting copy numbers of TREC and KREC relates to the field of biomedicine, and comprises a PCR premixed solution, deionized water and a primer probe combination, and the primer probe combination in the kit comprises a TREC upstream primer, a TREC downstream primer, a KREC upstream primer, a KREC downstream primer, a TCRAC upstream primer, a TCRAC downstream primer, a TREC fluorescent probe, a KREC fluorescent probe and a TCRAC fluorescent probe; the application method of the digital PCR kit for detecting the copy numbers of the TREC and the KREC comprises a mixture of the following four steps. The kit has the advantages that sampling is convenient, quantification is accurate, and clinical detection cost and workload are greatly reduced, TREC and KREC are detected at the same time with the reference gene TCRAC, false positive results can be avoided, copy number deviation caused by sampling, nucleic acid quantification, sample adding errors and the like can be avoided, and the kit has great significance in popularization of neonatal screening and HSCT post-immune reconstruction monitoring and has wide application prospects. And a favorable technical support is provided for accurate and timely treatment of related diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a digital PCR kit for detecting the copy number of TREC and KREC and an application method thereof. Background Art

[0002] In the medical field, immune reconstitution after hematopoietic stem cell transplantation (HSCT) is a key process aimed at helping patients who have received HSCT to restore normal immune function. This process involves the gradual recovery of different immune cells, and the specific time varies from person to person. In the first few months after HSCT, innate immunity (including monocytes, granulocytes, and natural killer cells) will gradually recover. Acquired immunity (including T lymphocytes and B lymphocytes) takes longer, usually 1-2 years to fully recover. Newborn T / B cells are mainly generated in the thymus or bone marrow. This process is crucial for the diversity and function of T / B cells. Therefore, the development of newborn T / B cell monitoring technology and kits to provide a basis for the immune reconstitution of patients after HSCT is of great significance to the prognosis of patients. Severe Combined Immunodeficiency (SCID) in humans is a group of rare inherited immune system diseases caused by mutations in different genes, which affect the development and function of infection defense immune cells. Its incidence rate is about 1 / 50,000 to 1 / 30,000. When newborns have SCID, they usually appear healthy at birth, but are extremely vulnerable to serious infections. Without immune-restoring treatments, such as stem cell transplantation, gene therapy, or enzyme replacement therapy, the child usually dies within one or two years of birth. However, if newborn screening is performed, SCID can be detected before symptoms appear, ensuring that the child receives life-saving treatment. Therefore, the development of sensitive and highly specific SCID screening technology and kits can provide more SCID children with the best treatment opportunities, which has important clinical significance and social value.

[0003] T-cell receptor excision circle (TREC) is a non-functional circular deoxyribonucleic acid (DNA) molecule produced during the formation of T-cell receptors. These DNA molecules exist stably in T cells. Since TREC does not replicate with the proliferation of T cells, quantitative detection of TREC can obtain the information of initial T lymphocytes output by the thymus, which can be used to screen some types of SCID on the one hand, and to evaluate the reconstruction of T cells after hematopoietic stem cell transplantation on the other hand. Similar to TREC, kappa excision recombination excision circle (KREC) can be produced during the early maturation and development of B cells. KREC can be used as a biomarker for the development of B cells in peripheral lymphoid organs. Quantitative detection of the content of KREC in samples can be used to screen for some immune deficiencies related to B cell development, such as X-linked agammaglobulinemia (XLA); in addition, it can also be used to evaluate the reconstruction of B cells after hematopoietic stem cell transplantation.

[0004] Among the existing medical detection technologies, digital PCR (Digital Polymerase Chain Reaction, PCR) is an absolute quantitative technology for nucleic acid molecules. Its principle is to disperse the PCR reaction system into a large number of independent micro-reaction units for amplification, and calculate the nucleic acid copy number according to the Poisson distribution and the positive ratio to achieve quantitative analysis. Compared with traditional PCR technology, digital PCR technology does not rely on the standard curve, has higher sensitivity and accuracy, can achieve absolute quantitative analysis of samples, and is particularly suitable for use in clinical testing laboratories. It is an ideal technology for conducting neonatal SCID screening and post-transplant T / B cell reconstruction monitoring. However, due to technical limitations, the existing digital PCR technology has complicated steps, long time consumption, and high cost for TREC / KREC detection methods, which restricts its effective application (a second round of internal reference gene detection is required for samples with extremely low or undetected TREC / KREC copy numbers). Summary of the invention

[0005] In order to overcome the drawbacks of the existing digital PCR technology applied to TREC / KREC detection, such as complicated steps, long time consumption and high cost, which restrict its effective application, the present invention provides a digital PCR kit for detecting the copy number of TREC and KREC and its application method, which has the advantages of convenient sampling, accurate quantification and greatly reduced clinical detection cost and workload under the action of relevant raw materials and process parts, and can detect TREC and KREC together with the internal reference gene TCRAC (a name of an internal reference gene) at the same time, thereby avoiding false positive results and copy number deviations caused by sampling, nucleic acid quantification, and sample addition errors, etc., which is of great significance for the promotion of newborn screening and immune reconstitution monitoring after HSCT, and provides favorable technical support for the accurate and timely treatment of related diseases.

[0006] The technical solution adopted by the present invention to solve its technical problem is:

[0007] A digital PCR kit for detecting the copy number of TREC and KREC, comprising a PCR premix, deionized water, and a primer-probe combination, wherein the primer-probe combination in the kit comprises a TREC upstream primer, a TREC downstream primer, a KREC upstream primer, a KREC downstream primer, a TCRAC (an internal reference gene name) upstream primer, a TCRAC (an internal reference gene name) downstream primer, a TREC fluorescent probe, a KREC fluorescent probe, and a TCRAC (an internal reference gene name) fluorescent probe; the nucleotide sequence listings of the TREC upstream primer and the TREC downstream primer are SEQ ID No: 1 and SEQ ID No: 2, respectively; the nucleotide sequence listings of the KREC upstream primer and the KREC downstream primer are SEQ ID No: 4 and SEQ ID No: 5, respectively; the nucleotide sequence listings of the TCRAC (an internal reference gene name) upstream primer and the TCRAC (an internal reference gene name) downstream primer are SEQ ID No: 7 and SEQ ID No:8; the oligonucleotide sequence tables of the TREC fluorescent probe, KREC fluorescent probe and TCRAC (a name of an internal reference gene) fluorescent probe are SEQ ID No:3, SEQ ID No:6 and SEQ ID No:9 respectively; the TREC upstream primer, TREC downstream primer, and TREC fluorescent probe are used to detect the TREC gene, the KREC upstream primer, KREC downstream primer, and KREC fluorescent probe are used to detect the KREC gene, and the TCRAC (a name of an internal reference gene) upstream primer, TCRAC (a name of an internal reference gene) downstream primer, and TCRAC (a name of an internal reference gene) fluorescent probe are used to detect the internal reference gene; in the primer-probe combination, the concentration of each primer is 4000 nM, and the concentration of each probe is 2000 nM.

[0008] Furthermore, the 5' end of the fluorescent probe contains a fluorescent group and the 3' end contains a quenching group. The 5' end of the TREC fluorescent probe is labeled with a FAM (a fluorescent dye) fluorescent group and the 3' end is a BHQ1 (maleimide) quenching group; the 5' end of the KREC fluorescent probe is labeled with a HEX fluorescent group and the 3' end is a BHQ1 (maleimide) quenching group; the 5' end of the TCRAC (a reference gene name) fluorescent probe is labeled with a ROX (a fluorescent dye) fluorescent group and the 3' end is a BHQ2 quenching group.

[0009] Furthermore, the PCR premix includes DNA (deoxyribonucleic acid) polymerase, Cy5.5 fluorescent dye, PCR buffer, MgCl2, dNTP and dUTP.

[0010] Furthermore, the kit also includes a positive control substance, which is a recombinant plasmid containing gene fragments of TREC, KREC and TCRAC (a name of an internal reference gene), and the plasmid framework is a plasmid vector of pUC57.

[0011] The application method of the digital PCR kit for detecting the copy number of TREC and KREC comprises the following steps: (1) extracting DNA (deoxyribonucleic acid) from a peripheral blood sample to obtain a sample genome for standby use; (2) mixing a PCR premix, a primer probe combination and deionized water to obtain a digital PCR reaction master solution for standby use; (3) taking the above sample genome DNA (deoxyribonucleic acid) or a positive control and mixing it with the PCR reaction master solution, performing PCR amplification and fluorescence collection using a digital PCR instrument to obtain the number of sample positive droplets; (4) calculating the copy number of TREC, KREC and TCRAC (a name of an internal reference gene) in the reaction system through the software provided by the digital PCR instrument; and calculating the number of cells of the added sample according to the copy number of TCRAC (a name of an internal reference gene), thereby calculating the copy number of TREC and KREC per 100,000 cells.

[0012] Furthermore, the PCR kit is mainly used in severe combined immunodeficiency disease, agammaglobulinemia screening and immune reconstitution evaluation after hematopoietic stem cell transplantation.

[0013] Compared with the prior art, the present invention has the following advantages: (1) Convenient sampling: The sample of the present invention is a peripheral blood sample, which can be venous blood, heel blood, finger blood, etc. For neonatal screening, dry blood spots for genetic metabolic disease screening can be used. Since the cell number can be calibrated, there is no need for strict requirements for dry blood spot sampling; for HSCT patients, both blood spot specimens and venous blood specimens can be collected. (2) Absolute quantification: Specifically, digital PCR does not rely on a standard curve, and can achieve true absolute quantification, detecting as low as 1 copy number of template, overcoming the disadvantage of qPCR that it does not have accurate quantification. (3) The method of the present invention uses a single-well internal reference gene synchronization experiment to calculate and control the copy number. TREC and KREC are detected simultaneously with the internal reference gene TCRAC (a name of an internal reference gene). On the one hand, false positive results caused by sample quality can be avoided; on the other hand, the actual number of cells put into the sample can be calculated by accurately quantifying the copy number of the internal reference gene, which can be calibrated to the copy number of TREC and KREC under the same cell number, thereby avoiding copy number deviations caused by sampling, nucleic acid quantification, and sample addition errors. The operation process is simple, which greatly reduces the cost and workload of clinical testing. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a one-dimensional analysis diagram of the TREC gene ddPCR detection of the positive control in the embodiment of the present invention;

[0015] Figure 2 This is a one-dimensional analysis diagram of the KREC gene ddPCR detection of the positive control in the embodiment of the present invention;

[0016] Figure 3 This is a one-dimensional analysis diagram of TCRAC (a name of an internal reference gene) gene ddPCR detection of the positive control in the embodiment of the present invention;

[0017] Figure 4 This is a one-dimensional analysis diagram of the TREC gene ddPCR detection of sample 1 in an embodiment of the present invention;

[0018] Figure 5 This is a one-dimensional analysis diagram of KREC gene ddPCR detection of sample 1 in an embodiment of the present invention;

[0019] Figure 6 This is a one-dimensional analysis diagram of TCRAC (a name of an internal reference gene) gene ddPCR detection of sample 1 in an embodiment of the present invention;

[0020] Figure 7 This is a one-dimensional analysis diagram of the TREC gene ddPCR detection of sample 2 in an embodiment of the present invention;

[0021] Figure 8This is a one-dimensional analysis diagram of the KREC gene ddPCR detection of sample 2 in an embodiment of the present invention;

[0022] Fig. 9 This is a one-dimensional analysis diagram of TCRAC (a name of an internal reference gene) gene ddPCR detection of sample 2 in an embodiment of the present invention;

[0023] Fig.10 Schematic diagram of a process for using a digital PCR kit for detecting the copy number of TREC and KREC. DETAILED DESCRIPTION

[0024] Unless otherwise specified, the reagents or instruments used in the following embodiments of the present invention are all existing mature products.

[0025] Fig.10As shown, a digital PCR (polymerase chain reaction) kit for detecting the copy number of TREC (T cell receptor excision circle) and KREC (kapa rearrangement shear circle) includes a PCR (polymerase chain reaction) premix for digital PCR (polymerase chain reaction) amplification (nuclease-free water for balancing the reaction system, a primer-probe combination for amplification of TREC (T cell receptor excision circle), KREC (kapa rearrangement shear circle) and TCRAC (name of an internal reference gene) genes), and the primer-probe combination in the kit includes TREC (T cell receptor excision circle) upstream primer, TRE C (T cell receptor excision circle) downstream primer, KREC (kapa rearrangement shearing circle) upstream primer, KREC (kapa rearrangement shearing circle) downstream primer, TCRAC (an internal reference gene name) upstream primer, TCRAC (an internal reference gene name) downstream primer, TREC (T cell receptor excision circle) fluorescent probe, KREC (kapa rearrangement shearing circle) fluorescent probe and TCRAC (an internal reference gene name) fluorescent probe; the nucleotide sequence tables of the TREC (T cell receptor excision circle) upstream primer and the TREC (T cell receptor excision circle) downstream primer are SEQ ID No: 1 and SEQ ID No: 2; the nucleotide sequence listings of the KREC (kapa rearrangement shearing loop) upstream primer and the KREC (kapa rearrangement shearing loop) downstream primer are SEQ ID No: 4 and SEQ ID No: 5, respectively; the nucleotide sequence listings of the TCRAC (a reference gene name) upstream primer and the TCRAC (a reference gene name) downstream primer are SEQ ID No: 7 and SEQ ID No: 8, respectively; the oligonucleotide sequence listings of the TREC (T cell receptor excision loop) fluorescent probe, the KREC (kapa rearrangement shearing loop) fluorescent probe and the TCRAC (a reference gene name) fluorescent probe are SEQ ID No: 3, SEQ ID No: 6 and SEQ ID No: 9; the TREC (T cell receptor excision circle) upstream primer, TREC (T cell receptor excision circle) downstream primer, TREC (T cell receptor excision circle) fluorescent probe are used to detect the TREC (T cell receptor excision circle) gene, the KREC (kapa rearrangement shearing circle) upstream primer, KREC (kapa rearrangement shearing circle) downstream primer, KREC (kapa rearrangement shearing circle) fluorescent probe are used to detect the KREC (kapa rearrangement shearing circle) gene, TCRAC (a reference gene name) upstream primer, TCRAC (a reference gene name) downstream primer, TCRAC (a reference gene name) fluorescent probe are used to detect the reference gene. The sequence table of the above primers is as follows:

[0026] SEQ ID No:1 GCCACATCCCTTTCAACCATGCT

[0027] SEQ ID No:2 GGTGCAGGTGCCTATGCATCA

[0028] SEQ ID No:3 CACCTCTGGTTTTTGTAAAGGTGCCCAC

[0029] SEQ ID No:4 TTCCCTTAGTGGCATTATTTGTATCAC

[0030] SEQ ID No:5 CAGGAGCCAGCTCTTACCCTAGAG

[0031] SEQ ID No:6 TTCTGCACGGGCAGCAGGTTG

[0032] SEQ ID No:7 gtcctaaccctgatcctcttg

[0033] SEQ ID No:8 gatttagagtctctcagctggtacacg

[0034] SEQ ID No:9 tcccacagatatccagaaccctgacc

[0035] Fig.10As shown, the 5' end of the fluorescent probe contains a fluorescent group and the 3' end contains a quenching group. The 5' end of the TREC (T cell receptor excision ring) fluorescent probe is labeled with a FAM (a fluorescent dye) fluorescent group and a BHQ1 (maleimide) quenching group at the 3' end; the 5' end of the KREC (kapa rearrangement shearing ring) fluorescent probe is labeled with a VIC (a fluorescent dye) fluorescent group and a BHQ1 (maleimide) quenching group at the 3' end; the 5' end of the TCRAC (a reference gene name) fluorescent probe is labeled with a ROX (a fluorescent dye) fluorescent group and a BHQ2 (maleimide) quenching group at the 3' end. The PCR (polymerase chain reaction) premix includes DNA (deoxyribonucleoside triphosphate) polymerase, Cy5.5 (a fluorescent dye) fluorescent dye, PCR (polymerase chain reaction) buffer, MgCl2 (magnesium chloride), dNTP (deoxynucleotide) and dUTP (deoxyuracil). The kit also includes a positive control for verifying the effectiveness of the PCR (polymerase chain reaction) reaction. The positive control is a recombinant plasmid containing TREC (T cell receptor excision circle), KREC (kapa rearrangement shear circle) and TCRAC (a reference gene name) gene fragments, and the plasmid framework is a plasmid vector of pUC57. The primers and probes designed by the present invention are highly specific. When combined with digital PCR (polymerase chain reaction) technology, they can show good sensitivity and can detect low-abundance TREC (T cell receptor excision circle) and KREC (kapa rearrangement shear circle) genes. This is of great significance for evaluating the reconstruction monitoring of T / B cells after hematopoietic stem cell transplantation and the diagnosis of SCID (severe combined immunodeficiency) and XLA (X-linked agammaglobulinemia).

[0036] Fig.10As shown, the application method of the digital PCR (polymerase chain reaction) kit for detecting the copy number of TREC (T cell receptor excision circle) and KREC (kapa rearrangement shearing circle), this embodiment is based on peripheral blood for the detection of the copy number of TREC (T cell receptor excision circle), KREC (kapa rearrangement shearing circle) and TCRAC (name of an internal reference gene), including the following steps: 1. Extracting genomic DNA (deoxyribonucleic acid) from the peripheral blood sample (Kaisuo Biological MagCore HF16 Nucleic Acid Extractor and C1002 DNA (deoxyribonucleic acid) extraction kit); specifically including the following sub-steps, (1) adding 400 μL of whole blood to the sample tube, adding 40 μL of Proteinase K (proteinase K) (when the sample volume is 200 μL, add 20 μL of Proteinase K (proteinase K)), and then extracting DNA (deoxyribonucleic acid) on the extractor. (2) Inserting the reagent strip (code C1002) into the reagent strip holder slot of the extractor and pressing it flat. (3) Place the sample tube in the W1 hole of the sample rack (the first row from the inside to the outside of the machine), the large experimental gun tip in the W3 hole of the sample rack (the third row), and the collection tube in the W5 hole of the sample rack (the fifth row). (4) Place the reagent strip rack and the sample rack in the corresponding positions of the extractor in turn and lay them flat. (5) Click on the program of the extractor in turn to complete the corresponding functions, Start→C1002→Sample volume→Elution volume→Start. (6) After the extraction program is completed, remove the sample collection tube containing genomic DNA (deoxyribonucleic acid) from the extractor. (7) Use Nanodrop (micro-volume UV spectrometer) to measure the concentration of genomic DNA (deoxyribonucleic acid) and store it at -20℃ for later use. 2. Digital PCR (polymerase chain reaction) instrument detection, specifically including the following steps: (1) PCR (polymerase chain reaction) reaction system configuration, specifically according to the ratio in Table 1, adding each component of the kit into a PCR (polymerase chain reaction) reaction tube, vortexing and mixing, and then centrifuging, the total reaction system is 22 μL;

[0037] Table 1

[0038]

[0039]

[0040] Specifically, the concentration of each primer in the primer-probe mixture used is 4000nM, and the concentration of each probe is 2000nM; the concentration of genomic DNA (deoxyribonucleic acid) is 50ng / μL, and the total input amount is 100ng. (2) Digital PCR (polymerase chain reaction) machine: Put the PCR (polymerase chain reaction) reaction tube after mixing and centrifugation into the digital PCR (polymerase chain reaction) instrument, and place the consumables in the corresponding position according to the manual of the digital PCR (polymerase chain reaction) instrument. (3) Sample setting: Click "Setup" → "Assignment" of the digital PCR (polymerase chain reaction) instrument to enter the sample assignment interface; "Target" is the fluorescence channel, and the target gene fluorescence channel selects "FAM (a fluorescent dye)", "VIC (a fluorescent dye)" and "ROX (a fluorescent dye)", and the droplet identification channel is "CY5.5 (a fluorescent dye)"; click "Number" to set the number of generated droplets to 23,000. (4) Perform PCR (polymerase chain reaction) amplification according to the procedure in Table 2.

[0041] Table 2

[0042]

[0043] (5) Click "Run" → "Sample Partioning" → "start" on the digital PCR (polymerase chain reaction) instrument to start the experiment. (6) Interpretation of results: a. After the ddPCR (polymerase chain reaction) reaction is completed, open the "Analyze Plot" → "1D dot plot" → "wells select" on the digital PCR (polymerase chain reaction) instrument to check the amplification results of each well; b. Select the reaction well of the positive control. The threshold line should be set at 1 / 3 between the negative and positive droplet clusters (close to the negative droplet cluster), and record the threshold; c. Select all reaction wells and apply the threshold set in b to all reaction wells; d. According to the threshold line, the number of positive droplets, concentration and other results can be obtained. 3. For every 10 6The conversion of the copy number of TREC (T cell receptor excision circle) and KREC (kapa rearrangement shear circle) in each cell is specifically calculated by the software of the digital PCR (polymerase chain reaction) instrument to obtain the copy number of TREC (T cell receptor excision circle), KREC (kapa rearrangement shear circle) and TCRAC (a reference gene name) in the reaction system; according to the copy number of TCRAC (a reference gene name), the number of cells of the added sample is calculated, thereby calculating the copy number of TREC (T cell receptor excision circle) or KREC (kapa rearrangement shear circle) per 100,000 cells. The formula is TREC 100000 =100000*TREC 体系 *22 / (TCRAC (name of an internal reference gene) 体系 *22 / 2); KREC 100000 =100000*KREC 体系 *22 / (TCRAC 体系 *22 / 2).

[0044] (7) Analysis of the positive control results in Example 1: Figure 1 , 2 , 3 are respectively positive control ddPCR (polymerase chain reaction) amplification 1D graphs. The instrument's own software analyzes the reaction system TREC (T cell receptor excision circle) gene copy number: 55.4cp / μL; KREC (kapa rearrangement shearing circle) gene copy number is 54.85cp / μL; TCRAC (a reference gene name) gene copy number is 55.09cp / μL. The reaction system quality control passed. (8) Example Sample 1 Result Analysis, Figure 4 , 5 6 are the positive control ddPCR (polymerase chain reaction) amplification 1D graphs. The instrument's own software analyzes the reaction system TREC (T cell receptor excision circle) gene copy number: 2.25cp / μL; KREC (kapa rearrangement shearing circle) gene copy number is 1.63cp / μL; TCRAC (a reference gene name) gene copy number is 1132.96cp / μL. According to the formula, the TREC in sample 1 is calculated. 100000 =397.19 copies; KREC 100000 = 287.7 copies. :(9) Result analysis of sample 2 of embodiment, Figure 7 , 89 are the positive control ddPCR (polymerase chain reaction) amplification 1D graphs. The instrument's own software analyzes the reaction system TREC (T cell receptor excision circle) gene copy number: 5.09cp / μL; KREC (kapa rearrangement shearing circle) gene copy number is 12.28cp / μL; TCRAC (a reference gene name) gene copy number is 1082.23cp / μ. According to the formula, the TREC in sample 2 is calculated. 100000 =940.65 copies; KREC 100000 =2269.40 copies.

[0045] Fig.10 As shown above, the present invention, under the action of relevant raw materials and process parts, has the advantages of convenient sampling, accurate quantification, and greatly reduced clinical testing costs and workload. TREC (T cell receptor excision ring) and KREC (kapa rearrangement shear ring) are detected simultaneously with the internal reference gene TCRAC (a name of an internal reference gene), which can avoid false positive results and copy number deviations caused by sampling, nucleic acid quantification, and sampling errors. It is of great significance to the promotion of newborn screening and immune reconstruction monitoring after HSCT, and provides favorable technical support for the accurate and timely treatment of related diseases (no need to perform a second round of internal reference gene detection for samples with extremely low or undetected TREC (T cell receptor excision ring) / KREC (kapa rearrangement shear ring) copy numbers).

[0046] The above describes the basic principles and main features of the present invention and the advantages of the present invention. It is obvious to those skilled in the art that the present invention is limited to the details of the above exemplary embodiments, and that the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention. Therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes that fall within the meaning and scope of the equivalent elements of the claims are included in the present invention.

[0047] In addition, it should be understood that although the present specification is described according to the implementation mode, the implementation mode does not only include an independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in the embodiments can also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A digital PCR kit for detecting the copy number of TREC and KREC, characterized in that: The kit comprises a PCR premix, deionized water, and a primer-probe combination. The primer-probe combination in the kit comprises a TREC upstream primer, a TREC downstream primer, a KREC upstream primer, a KREC downstream primer, a TCRAC upstream primer, a TCRAC downstream primer, a TREC fluorescent probe, a KREC fluorescent probe, and a TCRAC fluorescent probe; the nucleotide sequence tables of the TREC upstream primer and the TREC downstream primer are SEQ ID No: 1 and SEQ ID No: 2, respectively; the nucleotide sequence tables of the KREC upstream primer and the KREC downstream primer are SEQ ID No: 4 and SEQ ID No: 5, respectively; the nucleotide sequence tables of the TCRAC upstream primer and the TCRAC downstream primer are SEQ ID No: 7 and SEQ ID No: 8, respectively; the oligonucleotide sequence tables of the TREC fluorescent probe, the KREC fluorescent probe, and the TCRAC fluorescent probe are SEQ ID No: 3, SEQ ID No: 6, and SEQ ID No: 7, respectively. No:9; the TREC upstream primer, TREC downstream primer, and TREC fluorescent probe are used to detect the TREC gene, the KREC upstream primer, KREC downstream primer, and KREC fluorescent probe are used to detect the KREC gene, and the TCRAC upstream primer, TCRAC downstream primer, and TCRAC fluorescent probe are used to detect the internal reference gene; in the primer-probe combination, the concentration of each primer is 4000 nM, and the concentration of each probe is 2000 nM.

2. The digital PCR kit for detecting the copy number of TREC and KREC according to claim 1, characterized in that: The 5' end of the fluorescent probe contains a fluorescent group and the 3' end contains a quenching group. The 5' end of the TREC fluorescent probe is labeled with a FAM fluorescent group and a BHQ1 quenching group at the 3' end; the 5' end of the KREC fluorescent probe is labeled with a HEX fluorescent group and a BHQ1 quenching group at the 3' end; the 5' end of the TCRAC fluorescent probe is labeled with a ROX fluorescent group and a BHQ2 quenching group at the 3' end.

3. The digital PCR kit for detecting the copy number of TREC and KREC according to claim 1, characterized in that: The PCR premix includes DNA polymerase, Cy5.5 fluorescent dye, PCR buffer, MgCl2, dNTP and dUTP.

4. The digital PCR kit for detecting the copy number of TREC and KREC according to claim 1, characterized in that: The kit also includes a positive control substance, which is a recombinant plasmid containing TREC, KREC and TCRAC gene fragments, and the plasmid framework is a plasmid vector of pUC57.

5. The application method of the digital PCR kit for detecting the copy number of TREC and KREC according to any one of claims 1 to 4, characterized in that: The method comprises the following steps: (1) extracting DNA from a peripheral blood sample to obtain a sample genome for later use; (2) mixing a PCR premix, a primer probe combination and deionized water to obtain a digital PCR reaction master solution for later use; (3) taking the above sample genome DNA or a positive control and mixing it with the PCR reaction master solution, performing PCR amplification and fluorescence collection using a digital PCR instrument to obtain the number of sample positive droplets; (4) calculating the copy numbers of TREC, KREC and TCRAC in the reaction system using the software provided by the digital PCR instrument; and calculating the number of cells in the added sample based on the copy number of TCRAC, thereby calculating the copy numbers of TREC and KREC per 100,000 cells.

6. The application method of the digital PCR kit for detecting the copy number of TREC and KREC according to any one of claim 5, characterized in that: PCR kits are mainly used in screening for severe combined immunodeficiency, agammaglobulinemia, and evaluation of immune reconstitution after hematopoietic stem cell transplantation.

Images