Single base mutation detection method

Abstract

The invention belongs to the technical field of single-base mutation detection, and discloses a modular probe design method compatible with amplification of multiple nucleic acids, which overcomes the limitation of a recognition blind area of a conventional nucleic acid probe through synergistic nucleic acid hybridization and enzyme ligation recognition, realizes base resolution of a whole section of a cross-target sequence, and is used for analysis of gene multi-site mutation. In the detection process, nucleic acid targets carrying a plurality of near mutations in a solution can be analyzed, the method can be used for analyzing short microRNA and gene targets, and the detection method is high in specificity, sensitivity and universality and can be widely applied to SNV analysis of complex samples.

Description

Technical Field

[0001] The present invention relates to the technical field of intracellular single-base mutation detection, and specifically to a modular probe design method that is compatible with multiple nucleic acid amplifications, and coupled with a multiple connection process, utilizing the synergistic recognition of nucleic acid hybridization and enzyme connection to achieve a detection method for single-base difference resolution across the entire target sequence. Background Art

[0002] Genetic variations of single nucleotide differences, such as single nucleotide variants (SNVs), are closely associated with many human diseases such as cancer and drug resistance, and are therefore important biomarkers for disease diagnosis and prognosis. Economical, accurate, and reliable detection of SNVs is one of the key goals to meet the growing demand for precision diagnostics and drugs. Although sequencing-based methods enable high-throughput discovery and simultaneous analysis of a large number of SNVs, the high upfront cost and low accessibility limit their widespread use in routine clinical use, where only a few hotspot SNVs need to be monitored. On the other hand, assays based on allele-specific hybridization or enzymatic reactions are simple, cost-effective, and allow rapid analysis of hotspot SNVs in routine clinical and point-of-care settings.

[0003] The performance of most allele-specific assays strongly depends on the position of the mutation. For hybridization-based methods, such as molecular beacons or branch exchange probes, it is necessary to place the target mutation in the middle of the probe, as these probes often lose specificity when the mismatch is located at the end. In contrast, enzyme-based methods, such as ligation-mediated padlock probes and ARMS-PCR, can only distinguish mismatches at the ends of the probe or primer. The positional specificity of current methods makes it difficult to detect two or more mutations on a single target. Summary of the invention

[0004] In order to solve the problems in the background technology, the present invention provides a homogeneous and high-fidelity detection method for multiple adjacent mutations in a single target using a collaborative recognition probe (CRP). The collaborative recognition probe is capable of integrating a series of hybridization-based identification events with connection-based identification reactions. Two orthogonal identification mechanisms ensure unbiased detection of mutations located in the middle and end of the probe, which significantly reduces the design difficulty and improves the fidelity of the assay. In addition, a successful connection event can only be initiated when all CRPs correctly bind to the target sequence, which ensures highly collaborative recognition of targets containing multiple mutations. Finally, since the connection products can be further amplified by rolling circle amplification (RCA) and PCR, our CRP strategy can be easily deployed to the accurate distinction of microRNAs with similar sequences and the analysis of genetic SNV markers in clinical samples.

[0005] The specific steps of the detection method of the present invention are as follows:

[0006] (1) CRP-RCA operation. CRP-RCA includes four steps: CRP hybridization, ligation, RCA, and imaging analysis. First, CRP was phosphorylated using T4 polynucleotide kinase to produce phosphorylated probes. The reaction was carried out at 37°C for 30 minutes in a 20μl volume containing 2μl 10×T4 polynucleotide kinase reaction buffer (50mM Tris-HCl, 10mM MgCl2, 5mM DTT, 1mM spermidine, pH 7.6 at 25°C), 13μl H2O, 2μl of each CRP (100μM), 2μl ATP (10mM), and 1μl T4 polynucleotide kinase (10U / μl). The prepared CRP was then stored at -20°C until use.

[0007] CRP at a concentration of 10 nM was mixed with the target sequence in 1×T4 DNA ligase buffer (40 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT, 0.5 mM ATP, pH 7.8, 25°C) or 1×T4 RNA ligase 2 buffer (50 mM Tris-HCl, 2 mM MgCl2, 1 mM DTT, 0.4 mM ATP, pH 7.5, 25°C). The hybridization reaction was performed by incubating the mixture at 90°C for 5 minutes, followed by a cooling step at room temperature for 30 minutes. The ligation process was initiated by adding 0.5 μl of ligase and the reaction was carried out at 30°C for 30 min, followed by termination at 80°C for 5 min. T4 DNA ligase was used for DNA target sequences and T4 RNA ligase 2 was used for RNA target sequences. 2 μl of RCA primer was added for the RCA process. It was performed by adding 0.3 μl of phi 29 DNA polymerase (10 U / μl) to a final volume of 30 μl. The RCA reaction was carried out at 30° C. for 60 min and terminated at 65° C. for 10 min. The reaction mixture was used for fluorescence imaging.

[0008] To visualize the RCA product (RCAP), the RCA reaction product was first mixed with 100 nM YOYOTM-1. A volume of 3 μl of the mixture was deposited on an aminosilane-treated coverslip. Incubate at 37 ° C for 30 minutes to allow RCAP to bind to the slide surface. A poly (dimethylsiloxane) (PDMS) mask was applied to create a reaction chamber on the coverslip. Wash once with 2× SSC buffer. Then, the coverslip was fixed with Fluoromount-G and prepared for imaging. Fluorescence images of RCAP were obtained using a laser confocal microscope (Zeiss) and a Zeiss LSM 880 with a 63× oil immersion objective. Ar+ (488 nm) laser was used as the excitation source, and a 500-535 nm bandpass filter was used for fluorescence detection. To ensure that all RCAPs were imaged, images were collected as z stacks. Bright spots in the fluorescence image were distinguished from background signals by thresholding the images using ImageJ.

[0009] (2) CRP-qPCR operation. CRP-qPCR was performed by three methods: CRP hybridization, ligation, and PCR. The hybridization and ligation methods were the same as described in the “CRP-RCA method”. The PCR process was performed on a CFX 96 Real-Time PCR Detection System (Bio-rad) using PowerUp SYBR Green Master Mix. The concentration of each primer was 200 nM. The thermal cycle started with a 3-min incubation step at 95°C for polymerase activation, 40 repeated cycles of 10 s at 95°C for DNA denaturation, and 30 s at 60°C for annealing / extension.

[0010] (3) Nucleic acid extraction. We used the PureLink Genomic DNA Kit to purify DNA from tissue samples or cell samples, and used TRIzol reagent to purify total RNA from tissue samples or cell samples according to the manual protocol.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] (1) This method develops a collaborative recognition strategy that can analyze nucleic acid targets carrying multiple adjacent mutations in homogeneous solution.

[0013] (2) The integration of hybridization-based and ligation-based recognition in this method ensures high fidelity of the strategy for mismatches located in the middle and ends of the probe.

[0014] (3) The synergistic binding of multiple probes in this method further enables AND-gated detection of multiple adjacent mutations that are difficult to analyze using conventional allele-specific probes or primers.

[0015] (4) The present method is applicable to both RCA and PCR, making it a highly flexible SNV detection strategy for both imaging- and assay-based SNV analysis.

[0016] (5) This method is highly versatile and has demonstrable advantages and can be used to analyze both short microRNAs and long genomic targets. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the working principle of the collaborative recognition probe (CRP), which is used for high-fidelity, AND-gated SNV identification;

[0018] Figure 2 It is a graphic representation of the robust discrimination of SNVs using CRP;

[0019] Figure 3 It is to identify homologous microRNAs by integrating CPR and RCA (CPR-RCA);

[0020] Figure 4 It analyzes multiple adjacent mutations in genomic DNA by integrating CRP and qPCR (CRP-qPCR). DETAILED DESCRIPTION

[0021] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments.It should be understood that these descriptions are exemplary only, and are not intended to limit the scope of the present invention.In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present invention.Unspecified conditions in the embodiments are carried out according to the conditions of normal conditions or manufacturer recommendations.Reagents used or instruments that do not specify manufacturers are conventional products that can be purchased and obtained commercially.

[0022] Example 1: CRP strategy for detecting multiple mutations in a single target

[0023] In this example, the CRP strategy was evaluated for different types of mutation recognition. The specific steps are as follows:

[0024] First, CRP was phosphorylated using T4 polynucleotide kinase to generate phosphorylated probes. The reaction was carried out for 30 minutes at 37°C in a 20 μl volume containing 2 μl 10×T4 polynucleotide kinase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 5 mM DTT, 1 mM spermidine, pH 7.6 at 25°C), 13 μl H2O, 2 μl of each CRP (100 μM), 2 μl ATP (10 mM) and 1 μl T4 polynucleotide kinase (10 U / μl). The prepared CRP was then stored at -20°C until use.

[0025] CRP at a concentration of 10 nM was mixed with the target sequence in 1×T4 DNA ligase buffer (40 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT, 0.5 mM ATP, pH 7.8, 25°C, provided with the enzyme) or 1×T4 RNA ligase 2 buffer (50 mM Tris-HCl, 2 mM MgCl2, 1 mM DTT, 0.4 mM ATP, pH 7.5, 25°C). The hybridization reaction was carried out by incubating the mixture at 90°C for 5 minutes, followed by a cooling step at room temperature for 30 minutes. The ligation process was initiated by adding 0.5 μl of ligase and the reaction was carried out at 30°C for 30 min, followed by termination at 80°C for 5 min. T4 DNA ligase was used for DNA target sequences and T4 RNA ligase 2 was used for RNA target sequences. 2 μl of RCA primer was added for the RCA process. The reaction was performed by adding 0.3 μl of phi29 DNA polymerase (10 U / μl) to a final volume of 30 μl. The RCA reaction was performed at 30°C for 60 min and terminated at 65°C for 10 min. The reaction mixture was used for fluorescence imaging.

[0026] To visualize the RCA product (RCAP), the RCA reaction product was first mixed with 100 nM YOYOTM-1. A volume of 3 μl of the mixture was deposited on an aminosilane-treated coverslip. Incubate at 37 ° C for 30 minutes to allow RCAP to bind to the slide surface. A poly (dimethylsiloxane) (PDMS) mask was applied to create a reaction chamber on the coverslip. Wash once with 2× SSC buffer. Then, the coverslip was fixed with Fluoromount-G and prepared for imaging. Fluorescence images of RCAP were obtained using a laser confocal microscope (Zeiss) and a Zeiss LSM 880 with a 63× oil immersion objective. Ar+ (488 nm) laser was used as the excitation source, and a 500-535 nm bandpass filter was used for fluorescence detection. To ensure that all RCAPs were imaged, images were collected as z stacks. Bright spots in the fluorescence image were distinguished from background signals by thresholding the images using ImageJ.

[0027] As a proof of concept, we first aimed to distinguish miR-let-7a from its eight isoforms (isomiRs). By analyzing the sequence of miR-let-7a relative to its eight isomiRs, we found that there were five mismatch sites that allowed the distinction of the correct miR-let-7a from any of its isomiRs. Next, we designed a pair of CRPs that covered all five mismatch sites, so that the assembly and ligation reactions could only occur when the correct nucleotides were present at all five positions. By counting the number of RCA products under a fluorescence microscope, we confirmed that the CRPs could effectively distinguish miR-let-7a from any of its isoforms microRNAs with high selectivity.

[0028] Based on the successful differentiation of miR-let-7a from its isomiRs, we further designed a set of CPRs capable of identifying the seven major members of the let-7 family of microRNAs (miR-let-7a to miR-let-7g). Each member can be defined by a combination of specific nucleotides spanning seven positions. The results showed that despite the high sequence similarity, the group of seven CPRs is highly specific and orthogonal, with minimal crosstalk between family members.

[0029] Aberrant expression of let-7 microRNAs is closely associated with devastating diseases such as lung cancer, but it remains difficult to assess the specific contribution of a single member to the entire family. Given the ability to distinguish each member of the let-7 family using CRP, we sought to evaluate its ability to quantify specific let-7 members in clinical samples. To do this, we first assessed the quantification of miR-let-7a in the presence of a large excess of miR-let-7c, which differs from miR-let-7a by only one nucleotide. By spiking RNA samples extracted from E. coli with 1 pM of miR-let-7a and 1 to 100 pM of miR-let-7c, which were then quantified using CRP followed by RCA, we achieved recoveries ranging from 100% to 128%, indicating that miR-let-7c had little effect on the quantification of miR-let-7a.

[0030] Table 1 Templates of miR-let-7a isoforms

[0031] Serial number Name Sequence (5’-3’) 1 Polymorphic isomiRs-1 TAATACGACTCACTATAGGG AGCTACAGCTGGCTACTGGGT 2 Polymorphic isomiRs-2 TAATACGACTCACTATAGGG AGCGACATCTGGCTACTGGGT 3 5’isomiRs-1 TAATACGACTCACTATAGGG GCTACATCTGGCTACTGGGT 4 5’isomiRs-2 TAATACGACTCACTATAGGG AAGCTACATCTGGCTACTGGGT 5 5’isomiRs-3 TAATACGACTCACTATAGGG GCAGCTACATCTGGCTACTGGGT 6 3’isomiRs-1 TAATACGACTCACTATAGGG AGCTACATCTGGCTACTGGG 7 3’isomiRs-2 TAATACGACTCACTATAGGG AGCTACATCTGGCTACTGGGTT 8 3’isomiRs-3 TAATACGACTCACTATAGGG AGCTACATCTGGCTACTGGGTCT

[0032] Table 2 Templates for let-7 family members

[0033] Serial number Name Sequence (5’-3’) 1 miR-let-7a TAATACGACTCACTATAGGG TGAGGTAGTAGGTTGTATAGTT 2 miR-let-7b TAATACGACTCACTATAGGG TGAGGTAGTAGGTTGTGTGGTT 3 miR-let-7c TAATACGACTCACTATAGGG TGAGGTAGTAGGTTGTATGGTT 4 miR-let-7d TAATACGACTCACTATAGGG AGAGGTAGTAGGTTGCATAGT 5 miR-let-7e TAATACGACTCACTATAGGG TGAGGTAGGAGGTTGTATAGT 6 miR-let-7f TAATACGACTCACTATAGGG TGAGGTAGTAGATTGTATAGTT 7 miR-let-7g TAATACGACTCACTATAGGG TGAGGTAGTAGTTTGTACAGT 8 miR-let-7i TAATACGACTCACTATAGGG TGAGGTAGTAGTTTGTGCUGTT

[0034] Table 3 Probes for detecting let-7 family members

[0035]

[0036] *Sequences that hybridize to the target microRNA are marked in green

[0037] Example 2: Combining CRP and PCR to analyze multiple adjacent mutations in genomic DNA

[0038] In this example, CRP was evaluated for analyzing multiple adjacent mutations in a single genomic DNA (gDNA) target. The specific steps are as follows:

[0039] First, CRP was phosphorylated using T4 polynucleotide kinase to generate phosphorylated probes. The reaction was carried out for 30 minutes at 37°C in a 20 μl volume containing 2 μl 10×T4 polynucleotide kinase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 5 mM DTT, 1 mM spermidine, pH 7.6 at 25°C), 13 μl H2O, 2 μl of each CRP (100 μM), 2 μl ATP (10 mM) and 1 μl T4 polynucleotide kinase (10 U / μl). The prepared CRP was then stored at -20°C until use.

[0040] CRP at a concentration of 10 nM was mixed with the target sequence in 1×T4 DNA ligase buffer (40 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT, 0.5 mM ATP, pH 7.8, 25°C, provided with the enzyme) or 1×T4 RNA ligase 2 buffer (50 mM Tris-HCl, 2 mM MgCl2, 1 mM DTT, 0.4 mM ATP, pH 7.5, 25°C). The hybridization reaction was performed by incubating the mixture at 90°C for 5 minutes, followed by a cooling step at room temperature for 30 minutes. The ligation process was initiated by adding 0.5 μl of ligase and the reaction was carried out at 30°C for 30 min, followed by termination at 80°C for 5 min. T4 DNA ligase was used for DNA target sequences and T4 RNA ligase 2 was used for RNA target sequences.

[0041] The PCR process was performed on a CFX 96 real-time PCR detection system (Bio-rad) using PowerUp SYBR green Master Mix. The concentration of each primer was 200 nM. The thermal cycle began with a 3-minute incubation step at 95°C for polymerase activation, 40 repeated cycles of 10 seconds at 95°C for DNA denaturation and 30 seconds at 60°C for annealing / extension.

[0042] A set of CRPs for four EGFR SNVs was designed, carrying primer sites for the end probes for subsequent PCR amplification. By integrating CRP and PCR (CRP-qPCR), all mutations from the middle to the end of the target can be effectively distinguished, indicating that CRP-qPCR is also robust in detecting microRNAs and their mutations.

[0043] Table 4 Probes for detecting EGFR exon 20 sequences

[0044]

[0045] *Sequences that hybridize to the target sequence are marked in green

[0046] Example 3: CRP-qPCR is used to analyze hotspot SNVs in cell samples

[0047] In this example, the CRP strategy was used to analyze hotspot SNVs in the KRAS gene of different cancer cell lines. The specific steps are as follows: CRP was phosphorylated using T4 polynucleotide kinase to produce phosphorylated probes. The reaction was carried out for 30 minutes at 37°C in a 20 μl volume containing 2 μl 10×T4 polynucleotide kinase reaction buffer. The prepared CRP was stored at -20°C until use. CRP-qPCR was performed by three methods: CRP hybridization, ligation, and PCR. The PCR process was performed on a CFX 96 real-time PCR detection system (Bio-rad) using PowerUp SYBR Green Master Mix. The concentration of each primer was 200nM. The thermal cycle began with a 3-minute incubation step at 95°C for polymerase activation, 40 repeated cycles, 95°C for 10 seconds at 95°C for DNA denaturation, and 60°C for 30 seconds for annealing / extension.

[0048] The CRP panel was further designed to analyze multiple hotspot mutations located at codon 12 / 13 of the oncogenic KRAS gene. Mutational hotspots, including SNVs rs 112445441, rs 121913529, and rs 121913530, are responsible for resistance to drugs such as cetuximab in patients with colorectal and lung cancer. Three sets of CRPs were designed, capable of distinguishing targets carrying one, two, or three mutations, respectively. Targets carrying different numbers of mutations were efficiently detected using CRPs, confirming the effectiveness of our CRP strategy to detect multiple nearby mutations in an AND-gate manner. Pre-amplification of the KRAS gene using asymmetric PCR to generate single-stranded target sequences and subsequent analysis using CRP integrated with qPCR resulted in specific combinations of hotspot SNVs for each cell line, confirming the effectiveness of our strategy for analyzing multiple biologically significant mutations in genomic markers.

Claims

1. A single-base mutation detection method describes the design of a collaborative recognition probe (CPR), which integrates hybridization and ligation-based recognition mechanisms and is therefore effective for distinguishing mutations across all positions; the collaborative mechanism of CPR further enables AND-gate-based detection of multiple adjacent mutations with high fidelity and specificity; in addition, CPR produces circular or linear ligation products, which can be easily amplified by rolling circle amplification or polymerase chain reaction, making our strategy easily applicable to sensitive detection of different samples.

2. As described in claim 1, the present method utilizes collaborative recognition probes (CRPs) for homogeneous and high-fidelity detection of multiple adjacent mutations in a single target. The collaborative recognition probes are capable of integrating a series of hybridization-based identification events with ligation-based identification reactions to achieve base resolution across the entire target sequence for the analysis of multi-site mutations in genes.

3. As described in claim 1, the two orthogonal discrimination mechanisms of the present method ensure unbiased detection of mutations located in the middle and ends of the probe, which significantly reduces the design difficulty and improves the fidelity of the assay.

4. As described in claim 1, the present method can initiate a successful ligation event only when all CRPs correctly bind to the target sequence, which ensures highly cooperative recognition of targets containing multiple mutations.

5. As described in claim 1, since the ligation products can be further amplified by rolling circle amplification (RCA) and PCR, the CRP strategy can be easily deployed to accurately distinguish microRNAs with similar sequences and analyze genetic SNV markers in samples.

Images