Application of OsCFIm68b gene in regulation and control of Cd resistance of rice and Cd accumulation of grains

Abstract

The invention discloses an application of an OsCFIm68b gene in regulation and control of Cd resistance of rice and Cd accumulation of grains. The OsCFIm68b gene in rice is knocked out through gene editing to obtain a knockout mutant, and it is found that under the Cd polluted soil culture condition, the length of a main root is shortened, the number of lateral roots is reduced, the length of a total root is shortened, and the Cd concentration of grains is reduced to 1 / 3 of that of a wild type. Therefore, the OsCFIm68b gene is a negative regulatory factor for encoding Cd accumulation of the rice grains, the Cd accumulation of the rice grains can be improved by weakening the expression of the OsCFIm68b gene, the Cd resistance of the rice is improved, and a new gene target is provided for Cd low-accumulation breeding of the rice.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to OsCFIm68b Application of a gene in regulating Cd resistance and Cd accumulation in rice grains. BACKGROUND

[0002] Cadmium (Cd) is a metal substance with strong toxicity, and cadmium in soil has strong migration ability to plant roots, so plants are prone to accumulate cadmium. The degree of cadmium poisoning of plants varies greatly depending on the plant species, cadmium concentration, and the development stage of the plant under stress. Rice is the second largest food crop in the world, so the quality of rice is closely related to human health. Scientific research has found that cadmium pollution is particularly prominent in rice (Li Tianzhe et al., 2018; Zheng Xinyi, 2020).

[0003] Rice field Cd pollution has always been a concern, and Cd accumulation in rice and transfer to the food chain seriously threatens human health. The related mechanism of Cd absorption and accumulation in rice is continuously deepened, but further exploration is still needed. Developing and enriching the regulation technology of Cd accumulation in rice is of great significance to the safe production of rice in Cd contaminated areas.

[0004] Genetic methods are one of the effective ways to reduce heavy metal accumulation in rice. In rice plants, the expression of related genes and various metal transport proteins that affect heavy metal distribution and migration plays an important role in the absorption and transport of heavy metals in rice. Current research has found that the protein family responsible for Cd transport mainly includes zinc / iron transport proteins (ZIP), natural resistance-related macrophage proteins (NRAMP), heavy metal ATPases (HMA), cation exchangers (CAX), and metal tolerance proteins (MTP) (Han Tianlong, 2023). Cd transport in rice is responsible for a variety of genes, and their expression will affect Cd accumulation to varying degrees. For example, using the CRISPR / Cas9 system to knock out OsNramp5 Since the knockout, OsNramp5 functions are defective, and these defects greatly reduce the absorption of Cd in the roots, which can reduce Cd accumulation in straw and rice without affecting yield (Peng et al , 2017). Low-Cd rice varieties have been developed for Cd uptake transport proteins OsNRAMP5 . Researchers have developed a set of combined genotypes based on molecular markers (early rice: Multi-LCL1 / LCL2 ; late rice: Multi-CL1 ), which can quickly and accurately screen low-cadmium accumulation types from local main rice varieties. Varieties carrying these genotypes can produce cadmium content below the national safety standard (0.2 mg kg -1Rice, can effectively reduce the cadmium content of rice, and protect food safety (Cheng et al , 2025). But so far, there is no report on rice OsCFIm68b genes related to reducing heavy metal accumulation in rice, therefore, it is of great significance to study the role of rice OsCFIm68b genes in regulating rice resistance to Cd and Cd accumulation in grains. SUMMARY

[0005] The primary purpose of the present application is to overcome the shortcomings and deficiencies of the prior art, and provide the application of rice OsCFIm68b gene or its related biological material in regulating rice Cd resistance and / or Cd accumulation in grains.

[0006] Another purpose of the present application is to provide a method for reducing Cd accumulation in rice grains.

[0007] Still another purpose of the present application is to provide a rice OsCFIm68b gene mutant.

[0008] Still another purpose of the present application is to provide the application of the rice OsCFIm68b gene mutant.

[0009] The purpose of the present application is achieved by the following technical solutions: The application of rice OsCFIm68b gene or its related biological material in regulating rice Cd resistance and / or Cd accumulation in grains; wherein the amino acid sequence of the protein encoded by the rice OsCFIm68b gene is shown in SEQ ID NO. 2; The rice OsCFIm68b gene related biological material is any one or a combination of the following biological materials: (1) an expression cassette containing the above-mentioned rice OsCFIm68b gene; (2) a recombinant expression vector containing the above-mentioned rice OsCFIm68b gene; (3) a recombinant expression vector containing the expression cassette in (1); (4) a recombinant bacteria containing the above-mentioned rice OsCFIm68b gene; (5) a recombinant bacteria containing the expression cassette in (1); (6) a recombinant bacteria containing the recombinant expression vector in (2) or (3).

[0010] The nucleotide sequence of the rice OsCFIm68b gene

Rice Database (http: / / rice.uga.edu /

[0011] The regulation of rice Cd resistance and grain Cd accumulation is achieved by the following methods: (a) knocking out the rice OsCFIm68b gene, OsCFIm68b gene mutation), improving the resistance of rice to Cd, and reducing the accumulation of Cd in rice grains; (b) overexpressing the rice OsCFIm68b gene, reducing the resistance of rice to Cd, and increasing the accumulation of Cd in rice grains.

[0012] The rice OsCFIm68b gene or its related biological material is used to regulate the main root length of rice and / or increase the number (amount) of lateral roots.

[0013] The regulation of the main root length of rice and the increase of the number (amount) of lateral roots is achieved by the following methods: (i) overexpressing the rice OsCFIm68b gene, increasing the main root length, increasing the number (amount) of lateral roots, and increasing the total root length; (ii) knocking out the rice OsCFIm68b gene, shortening the main root length, reducing the number (amount) of lateral roots, and shortening the total root length.

[0014] The knocking out of the rice OsCFIm68b gene is achieved by CRISPR-Cas9 editing technology: using the CRISPR-Cas9 editing system to construct a rice OsCFIm68b gene knockout vector, resulting in the loss of function of the rice OsCFIm68b gene, and reducing the Cd concentration in rice grains; further preferably achieved by the following method: deleting 21 bases "CGGTGGCAGGGCTTCTGAATA" at positions 1530-1550 of the coding region of the rice OsCFIm68b gene as shown in SEQ ID NO. 1.

[0015] The application also provides the application of the above-mentioned rice OsCFIm68b gene or its related biological material in rice genetic breeding (such as preparing transgenic rice and improving rice varieties).

[0016] A method for improving the resistance of rice to Cd and reducing the accumulation of Cd in rice grains, by knocking out the rice OsCFIm68b gene, reducing the biological function of the rice OsCFIm68b gene or its encoded protein, improving the resistance of rice to Cd, and reducing the accumulation of Cd in rice grains.

[0017] A rice OsCFIm68b gene mutant, which is a rice OsCFIm68bThe 21 bases of "CGGTGGCAGGGCTTCTGAATA" are deleted from the 1530th to 1550th of the coding region of the gene.

[0018] The rice OsCFIm68b The expression cassette of the gene mutant, the recombinant expression vector or the recombinant bacteria.

[0019] The rice OsCFIm68b The gene mutant is obtained by the way of gene mutation (knockout OsCFIm68b The main root length of the rice plant is shortened, the number of lateral roots is reduced, the total root length is shortened, the Cd poisoning is reduced, the Cd concentration of the grain is reduced, and the Cd resistance of the rice is improved. OsCFIm68b

[0020] The variety of the rice is Zhonghua 11 (ZH11).

[0021] The rice OsCFIm68b The gene mutant and / or the rice OsCFIm68b The application of the expression cassette of the gene mutant, the recombinant expression vector or the recombinant bacteria in improving the Cd resistance of the rice and / or reducing the Cd accumulation of the grain of the rice.

[0022] The present application has the following advantages and effects relative to the prior art: The present application obtains a knockout mutant by knocking out the OsCFIm68b gene in the rice, and the Cd concentration of the grain is reduced to 1 / 3 of the wild type. OsCFIm68b The gene is a negative regulatory factor of the Cd accumulation of the grain of the rice, and weakening the expression thereof can be used for improving the Cd accumulation of the grain of the rice, and provides a new gene target for the Cd low-accumulation breeding of the rice. BRIEF DESCRIPTION OF DRAWINGS

[0023] OsCFIm68b is the target position and the target sequencing result graph of the OsCFIm68b gene knockout mutant strain ( OsCFIm68b , 2 ) in the embodiment of the present application.

[0024] OsCFIm68b is the amino acid change graph after the gene mutation of the OsCFIm68b gene editing mutant strain ( Figure 1 , OsCFIm68b 2 ) in the embodiment of the present application.

[0025] Oscfi68b-1, Oscfi68b- is the gene editing mutant plant ( Figure 2 , OsCFIm68b , Oscfi68b-1 2Cd stress schematic diagram; wherein a is Oscfi68b- The root phenotype photo of ZH11 under Cd stress for one week; b is Figure 3 , OsCFIm68b The photo of ZH11 under Cd stress for one week; c is Oscfi68b-1 The Cd concentration of ZH11 under Cd stress for one week. DETAILED DESCRIPTION

[0026] The application will be further described in detail below with examples. The purpose of providing these examples is to make the understanding of the disclosure of the application more thorough and comprehensive, but the embodiments of the application are not limited to this. Based on the examples in the application, all other examples obtained by those skilled in the art without creative labor are within the scope of protection of the application. Unless otherwise specified, the reagents, methods and devices used in the application are conventional reagents, methods and devices in the technical field. Unless otherwise specified, the test methods in the following examples are usually carried out according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents and raw materials used in the application can be obtained by market.

[0027] The application provides a rice Oscfi68b- gene and the protein encoded thereby in regulating low Cd accumulation in rice grains; wherein the nucleotide sequence of the rice Oscfi68b-1, Oscfi68b-2 gene is shown as SEQ ID NO. 1, and the amino acid sequence of the protein encoded thereby is shown as SEQ ID NO. 2. The regulation is negative regulation, and the Cd accumulation in rice grains is reduced by reducing the biological function of the rice Oscfi68b-1 gene or the protein encoded thereby.

[0028] The rice Oscfi68b-2 gene (SEQ ID NO. 1) is: Oryza sativa Oscfi68b-1, Oscfi68b-2 Protein sequence encoded by the gene (SEQ ID NO. 2): MAFAGRVVNALRRTSVSSNPSLLQAVRCMSSKLFVGGLSYATDDTTLKDVFSHYGDVLEARIIIDRDTGKSKGYGFITYTSSEEAAAAVTAMDGKDLQGRIVRVSTANDRAGGIRGGGGFGAGGYGSGGGYSSGGGYGTGEYGRGGGYAGNGGYGGRASEYGGYGAGGYSSSGGYNATSVLHGNAGGYGSSEALMFTILPTPMALATSAIVVSPVAASVETTVELVVDDLVPPVAATSTTLPTSAMVVVALVKTVVDITADNLVPRVTAMAATLPATSVMLALVQTVVYLAVDNLVPPVATTVATRPATSASVAALVQTMVELAVDNLVPWVTAMEATLPATSAVVAALVQTVVDPAMDNMVPRMATTAATSATVAALVHKWWEQEKDIPENGPPLDCEAELPPLVLLFAAPAPGAPPPAPAPGAPSPPAAPAAAPARGADMAMARMSSRVGSTPQKPDHPPTRCRSQAKVSLRTLTGTGLPFASPLFGAYKSNSRPFMSI*.

[0029] Example 1 OsCFIm68b Construction and functional verification of knockout mutant plants 1.1 OsCFIm68b Obtaining of homozygous knockout mutant plants The knockout mutant in this embodiment is based on the conventional commercially available rice variety Zhonghua 11, and the gene editing (CRISPR-Cas9) is used to knockout the OsCFIm68bThe knockout mutant material is entrusted to Baogeli Gene Technology Co., Ltd. to complete. The T1 generation is detected for gene variation to find homozygous mutant and the seed is harvested. The homozygous knockout mutant is detected by polyacrylamide gel electrophoresis and sequencing. After obtaining the T0 generation transgenic seedlings, the leaf is taken to extract DNA, the target detection primer amplified fragment is sent for sequencing according to the feedback of the company, the transgenic seedling mutation type is analyzed according to the sequencing peak chart, the T0 generation seed is harvested and the mutation type is marked. The T1 and T2 generations can be designed according to the mutation type of the T0 generation to amplify the target fragment, and then polyacrylamide gel electrophoresis is used for detection, and the homozygous plant is determined according to the control band, and 1-2 plants with homozygous bands are selected for sequencing to ensure that the correct homozygous plant is screened. The specific steps are as follows: The CTAB method is used to extract rice leaf DNA: (1) Prepare 2% CTAB extraction solution: weigh 4 g CTAB (hexadecyl trimethyl ammonium bromide), 16.34 g NaCl, 1.48 g EDTA . 2Na2H2O, add 20 mL of 1 mol / L Tris-HCl solution, and dilute to 200 mL with distilled water.

[0030] (2) Prepare a 2 mL centrifuge tube, take an appropriate amount of green rice leaves (which can be taken from T0, T1 or T2 generation green rice leaves at any time) in a 2 mL centrifuge tube, add grinding beads, grind into powder under liquid nitrogen, add 600 μL of 2% CTAB extraction solution, heat at 65 ℃ metal bath for 15 min, and mix for 7.5 min.

[0031] (3) After mixing, take out the sample, cool at room temperature, add an equal volume of chloroform / isopentanol mixed solution (chloroform:isopentanol=24:1, v / v), mix up and down, centrifuge at 12000 r / min for 5 min at 4 ℃.

[0032] (4) After centrifugation, 450 μL of supernatant is taken in a 1.5 mL centrifuge tube, and an equal volume (450 μL) of pre-cooled pure isopentanol solution is added, mixed up and down, centrifuged at 12000 r / min for 2 min at 4 ℃, and the supernatant was discarded and the precipitate was retained.

[0033] (5) Wash the precipitate with ethanol solution (70% by volume) for 2-3 times, each time at 12000 r / min for 1 min, and dry the centrifuge tube upside down overnight.

[0034] (6) Add 70-100 μL of sterile water to dissolve the DNA, shake at room temperature, and use or store at -20 ℃ for long-term preservation.

[0035] PCR amplification system is Gen star 2x dye Taq premix PCR system (10 μL), the reaction system is shown in Table 1, and the reaction program is shown in Table 2.

[0036] The knockout target detection primer sequence is as follows: T1F: 5'-ATGGTACTGGTGAGTATGG-3' (SEQ ID NO. 3); T1R: 5'-GCTTCTGTAGTCACCAGC-3' (SEQ ID NO. 4).

[0037] Table 1

[0038] Reaction program: Table 2

[0039] Note: The annealing temperature time of Tm can be adjusted according to the size of the amplification product.

[0040] According to the difference of PCR amplification product, the concentration of polyacrylamide is selected, generally more than 3 bases use 6% non-denaturing polyacrylamide, less than 3 bases use 10% non-denaturing polyacrylamide gel. Among them, The polyacrylamide gel mother liquor formula is as follows: 6% mother liquor (capacity 8 L): urea 1000 g, acrylamide 500 g, N, N-methylene bisacrylamide 26 g, EDTA (ethylenediamine tetraacetic acid) 5.952 g, boric acid 44 g, Tris (tris-hydroxymethyl aminomethane) 86.4 g, and pure water to 8 L; 10% mother liquor (capacity 2 L): urea 256 g, acrylamide 182.4 g, N, N-methylene bisacrylamide 9.6 g, 10xTBE 213.4 mL, and pure water to 2 L; wherein, 10xTBE buffer (capacity 5 L): Tris 540 g, Na2EDTA . 2H2O 37.2 g, boric acid 275 g, and pure water to 5 L.

[0041] The steps of polyacrylamide gel electrophoresis are as follows: (1) Glass plate sealing: the gap at the bottom of the assembled glass plate is sealed with heated agarose solution.

[0042] (2) Gel preparation (one electrophoresis apparatus and two gels): Pour 100 mL of polyacrylamide gel stock solution into a beaker, add 800 μL of 10% (w / v) ammonium persulfate solution and 35 μL of tetramethyl ethylenediamine, and quickly stir until uniform. Slowly pour into the bottom-sealed glass plate (if bubbles are encountered, shake left and right to break the bubbles), place the glass plate horizontally, insert the electrophoresis comb, and stand at room temperature for 20 min or more to allow the gel to solidify.

[0043] (3) Sample loading: Place the prepared gel into the electrophoresis tank, add 1x TBE electrophoresis solution (TBE buffer), slowly pull out the electrophoresis comb, use a syringe to flush the comb holes with electrophoresis solution, and use a sample applicator to load the PCR product into the pores of the pulled-out electrophoresis comb. Apply a voltage of 300 V for 1-2 h, and adjust the time according to the concentration of the stock solution, the size and difference of the PCR product.

[0044] (4) Staining and color development: Remove the glass plate, use a knife to remove the gel, wash the gel with pure water to remove TBE, add 0.1% (w / v) silver nitrate solution, shake on a shaker for 10 min, wash the gel twice with pure water, add color developing solution and shake on a shaker until the target band is clear. Pour out the color developing solution, add pure water, and use a sampling plate to take a photo of the gel. Color developing solution (one electrophoresis apparatus and two gels): 200 mL of pure water, add 0.05 g of sodium tetraborate, 3 g of NaOH and 800 μL of formaldehyde, and stir until uniform.

[0045] Two types of homozygous mutant strains were screened in T2 generation, named OsCFIm68b and OsCFIm68b , the mutation type and target detection are shown in OsCFIm68b and OsCFIm68b , two types of homozygous mutants were obtained, both of which were base deletion mutations, OsCFIm68b , Oscfi68b-1 were deleted in the coding region of Oscfi68b-2 gene (positions 1530-1550 of SEQ ID NO. 1) by 21 bases CGGTGGCAGGGCTTCTGAATA.

[0046] 1.2 Knockout mutant verification Figure 1 function Select full and pest-free rice Zhonghua 11 (ZH11) and homozygous knockout mutants ( Figure 2 and Oscfi68b-1 ) for seedling culture in the medium for one week, and investigate the traits under water culture and Cd contaminated soil culture conditions. The specific steps are as follows: The seedlings were cultured in a light incubator (light 12 h, dark 12 h, temperature 25 ℃, humidity 80%) for one week, and the rice seedlings with uniform growth were selected to wash the roots with tap water, spread the lateral roots with forceps, take pictures, and analyze the pictures with Image J and RhizoVision Explorer software to obtain the length of the main root and the number of lateral roots. Each variety was repeated three times.

[0047] The rice seedlings with uniform growth were transferred to 6 L gray plastic barrels, and Hoggan nutrient solution (5 mM Ca(NO3)2, 5 mM KNO3, 1 mM KH2PO4, 1 mM MgSO4, 50 μM H3BO3, 4.5 mM MnCl2, 3.8 μM ZnSO4, 0.3 mM CuSO4, 0.1 mM (NH4)6Mo7O 24 )and 50 μM Fe-EDTA) was added according to the volume ratio of 1:1000, and the pH of the culture solution was adjusted to 5.6~6.0, and the nutrient solution was replaced every three days. Set up control (CK) and Cd (48 μM CdCl2) two treatments, and observe the phenotype after three days of treatment. Each variety was repeated three times.

[0048] The rice seedlings with uniform growth were transplanted to Cd contaminated soil (CdCl2 was directly added to the soil, and the soil Cd concentration was 22.5 mg / kg), 3 plants were planted in each pot, and each variety was repeated three times. Observe the Cd poisoning phenotype of the plants regularly, and take pictures to record the Cd poisoning grade of the plants when the phenotype is basically stable. Harvest the rice grains after the plants mature, and measure the total Cd content of the rice grains.

[0049] Results: Compared with wild type ZH11, the root length of two rice mutants Oscfi68b-2 and OsCFIm68b was shortened, mainly in the length of the main root, the number of lateral roots, and the total root length (a in OsCFIm68b ). Under the condition of Cd contaminated soil culture, compared with ZH11, the two mutant plants were short, the growth was poor, and the leaf tips were yellow (b in Oscfi68b-1 ). The Cd concentration in the grains of mutant Oscfi68b-2 and Oscfi68b-1 was lower than that of WT, the Cd concentration in the grains of ZH11 was 0.9705 mg / kg, while the Cd concentration in the grains of Oscfi68b-2 and Figure 3 was 0.3486 and 0.3824 mg / kg respectively (c in Figure 3 Oscfi68b-1 Oscfi68b-2 Oscfi68b-1 Oscfi68b-2 Figure 3 Figure 3 Oscfi68b-1 Oscfi68b-2 Oscfi68b-1 Oscfi68b-2 Figure 3 ).

[0050] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations, simplifications, etc. made without departing from the spirit and principles of the present application should be equivalent replacement manners and should be included in the protection scope of the present application.

Claims

1. Rice OsCFIm68b The application of genes or related biological materials in regulating Cd resistance and / or Cd accumulation in rice grains, characterized by: The rice OsCFIm68b The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2; The rice mentioned OsCFIm68b Gene-related biological materials are any one or more combinations of the following biological materials: (1) Contains the above-mentioned rice OsCFIm68b Gene expression cassettes; (2) Contains the above-mentioned rice OsCFIm68b Recombinant gene expression vectors; (3) A recombinant expression vector containing the expression cassette described in (1); (4) Contains the above-mentioned rice OsCFIm68b Recombinant bacteria; (5) Recombinant bacteria containing the expression cassette described in (1); (6) Recombinant bacteria containing the recombinant expression vector described in (2) or (3).

2. The application according to claim 1, characterized in that: The rice mentioned OsCFIm68b The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. The application according to claim 1, characterized in that, The aforementioned regulation is achieved in the following manner: (a) Knocking out rice OsCFIm68b Genes that enhance rice's resistance to Cd and reduce Cd accumulation in rice grains; (b) Overexpression in rice OsCFIm68b Genes that reduce rice's resistance to Cd and increase Cd accumulation in rice grains.

4. The rice as described in claim 1 OsCFIm68b The application of genes or related biological materials in regulating taproot length and / or increasing the number of lateral roots in rice, characterized by: The aforementioned regulation is achieved through the following methods: (i) Overexpression in rice OsCFIm68b Genes that increase the length of the taproot, the number of lateral roots, and the total root length; (ii) Knocking out rice plants OsCFIm68b Genes shorten the length of the taproot, reduce the number of lateral roots, and shorten the total root length.

5. The application according to claim 3 or 4, characterized in that, The knockout rice OsCFIm68b The gene is achieved through the following method: in rice as shown in SEQ ID NO.1 OsCFIm68b The gene coding region has a 21-base deletion at positions 1530-1550: "CGGTGGCAGGGCTTCTGAATA".

6. The rice as described in claim 1 OsCFIm68b Application of genes or related biological materials in rice genetic breeding.

7. A method for improving rice's resistance to Cd and reducing Cd accumulation in rice grains, characterized in that: By knocking out rice OsCFIm68b Genes reduce rice OsCFIm68b The biological function of the gene or its encoded protein can enhance rice's resistance to Cd and reduce Cd accumulation in rice grains. The rice mentioned OsCFIm68b The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

8. A type of rice OsCFIm68b Gene mutants, characterized by: In rice as shown in SEQ ID NO.1 OsCFIm68b The gene coding region has a 21-base deletion at positions 1530-1550: "CGGTGGCAGGGCTTCTGAATA".

9. Rice containing the rice of claim 8 OsCFIm68b Expression cassettes of gene mutants, recombinant expression vectors, or recombinant bacteria.

10. The rice according to claim 8 OsCFIm68b Gene mutants and / or those containing rice as described in claim 9 OsCFIm68b Application of gene mutant expression cassettes, recombinant expression vectors, or recombinant bacteria in improving rice resistance to Cd and / or reducing Cd accumulation in rice grains.

Images