Use of receptor accessory protein 6 and inhibitors thereof in the preparation of medicaments for the treatment of oral squamous cell carcinoma
By targeting and inhibiting the REEP6 gene, the high recurrence and metastasis rates of OSCC have been addressed, providing a new treatment approach that significantly inhibits OSCC cell growth and invasion, thereby improving patient survival rates.
Patent Information
- Application Number
- CN202411653269.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-18
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2044-11-18
AI Technical Summary
Oral squamous cell carcinoma (OSCC) has a high recurrence and metastasis rate. Current treatments have failed to significantly improve the overall 5-year survival rate of patients, and its molecular mechanisms are unclear, with existing technologies lacking effective treatment options.
Develop receptor accessory protein 6 (REEP6) and its inhibitors. By specifically detecting the expression level of the REEP6 gene or the activity of its expression product, the expression level or activity of REEP6 can be reduced using methods such as antisense RNA, siRNA, shRNA, miRNA, TALEN or CRISPR. DNA methylation reagents targeting the promoter of the REEP6 gene can be used to inhibit its function.
It significantly inhibits the growth, migration, and invasion of OSCC cells, reduces the expression level of the REEP6 gene, promotes the ferroptosis signaling pathway, provides a new drug target for the treatment of OSCC, and improves the therapeutic effect.
Smart Images

Figure CN119709996B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biological medicine, and particularly relates to application of receptor accessory protein 6 and an inhibitor thereof in preparation of a drug for treating oral squamous cell carcinoma. BACKGROUND
[0002] Oral squamous cell carcinoma (OSCC), is the most common malignant tumor in the oral and maxillofacial region, mainly occurring in the tongue, floor of the mouth, gums, buccal wall and palate. At present, the main treatment method for early oral cancer patients is surgical resection combined with radiotherapy and chemotherapy. Despite this, due to the high recurrence rate and high metastasis of OSCC, about 20%-40% of patients still have local recurrence, occult lymph node metastasis and poor prognosis after surgery. Although various methods can improve the quality of life of oral cancer patients, the overall 5-year survival rate of oral cancer patients has not improved significantly, and has hovered around 50% in recent years. Metastasis is the main cause of death in cancer patients. However, the key causes and molecular mechanisms of OSCC are still unknown. The causes and mechanisms of oral cancer recurrence and metastasis are still unclear.
[0003] Receptor expression-enhancing protein 6 (REEP6) is a conserved member of the endoplasmic reticulum (ER) shaping protein DP1 / Yop1p superfamily. There are six proteins in the DP1 / Yop1p family, all of which are transmembrane proteins, including REEP1, REEP2, REEP3, REEP4, REEP5 and REEP6. Initially, the REEP family was thought to play a role in enhancing the expression of cell surface olfactory receptors, G protein-coupled receptors (GPCRs) and taste receptors, and there were few studies on the biological function of REEP6 in tumors. Previous studies have shown that REEP6 plays an important role in maintaining endoplasmic reticulum homeostasis. Interestingly, an increasing number of research reports have shown that endoplasmic reticulum stress is closely related to ferroptosis.
[0004] Ferroptosis is a recently discovered form of non-cell death, iron-dependent cell death. Imbalance between the production and degradation of reactive oxygen species (ROS) in cells can lead to ferroptosis. Ferroptosis inducers directly or indirectly act on glutathione peroxidase (GPX), leading to decreased cellular antioxidant capacity, accumulation of reactive oxygen species, and ultimately oxidative cell death. Since ferroptosis plays an important role in cell death, it has been found to be related to the occurrence and development of many diseases, especially cancer. The ferroptosis signaling pathway in tumors is generally limited, so anti-tumor therapies that induce ferroptosis in tumor cells have broad application prospects. Therefore, the identification of key proteins in the ferroptosis signaling pathway should be crucial, as these proteins can serve as drug targets to overcome disease progression. SUMMARY
[0005] The present application aims at overcoming the deficiencies of the prior art, and the application of receptor accessory protein 6 and its inhibitors in the preparation of drugs for treating oral squamous cell carcinoma.
[0006] The first object of the present application is to provide a product for the auxiliary diagnosis of oral squamous cell carcinoma, which is used for specifically detecting the expression level of REEP6 gene or the activity of REEP6 gene expression product; the nucleotide sequence of the REEP6 gene is shown as SEQ ID NO. 1.
[0007] Preferably, the product comprises reagents for specifically detecting the change in the expression level of REEP6 gene or the activity of REEP6 gene expression product by sequencing technology, nucleic acid hybridization technology, nucleic acid amplification technology or immunoassay.
[0008] Preferably, the product comprises PCR amplification reagents and PCR primers for detecting the expression level of REEP6 gene, and the nucleotide sequences of the PCR primers are shown as SEQ ID NO. 11 and SEQ ID NO. 12.
[0009] The second object of the present application is to provide a drug for treating oral squamous cell carcinoma, which comprises an inhibitor of REEP6 gene or an inhibitor of REEP6 gene expression product; the nucleotide sequence of the REEP6 gene is shown as SEQ ID NO. 1.
[0010] The third object of the present application is the application of an inhibitor of REEP6 gene or an inhibitor of REEP6 gene expression product in the preparation of a drug for treating oral squamous cell carcinoma, which can reduce the expression level of REEP6 gene or reduce the activity of REEP6 gene expression product in vitro and / or in vivo; the nucleotide sequence of the REEP6 gene is shown as SEQ ID NO. 1.
[0011] The present application proves that the inhibitor of REEP6 gene or its expression product can inhibit the growth, number increase, migration and / or invasion of oral squamous cell carcinoma cells.
[0012] Preferably, the inhibitor is any of the following:
[0013] a. antisense RNA, siRNA, shRNA, miRNA, TALEN or CRISPR targeting REEP6 gene;
[0014] b. an agent for promoting DNA methylation of REEP6 gene promoter.
[0015] Preferably, the inhibitor is shRNA, the forward primer and reverse primer for inhibiting REEP6 are shown in SEQ ID NO. 7 and SEQ ID NO. 8 respectively.
[0016] Preferably, the target sequence of the shRNA is GCATGGCTCCCAGGCCCTGGAA.
[0017] A fourth object of the present application is a method for inhibiting the growth, number increase, migration and / or invasion of oral squamous cell carcinoma cells in vitro, which comprises culturing oral squamous cell carcinoma cells in the presence of an inhibitor of REEP6 gene or an inhibitor of the expression product of REEP6 gene, so as to inhibit the growth, number increase, migration and / or invasion of the oral squamous cell carcinoma cells; the nucleotide sequence of the REEP6 gene is shown in SEQ ID NO. 1.
[0018] The present application has the following beneficial effects:
[0019] The present application discloses that receptor accessory protein 6 (REEP6) is a novel ferroptosis inhibitor in OSCC cells, is a key protein in the ferroptosis signaling pathway, and can be used as a drug target for overcoming the progression of oral squamous cell carcinoma; knockdown of REEP6 significantly inhibits the cell proliferation rate in OSCC cell lines, significantly promotes DNA damage in OSCC cell lines, and significantly inhibits the migration and invasion of OSCC cell lines, so that an inhibitor targeting receptor accessory protein 6 can be used as an oral squamous cell carcinoma treatment drug. The present application provides a new idea for preparing a drug for treating oral squamous cell carcinoma. BRIEF DESCRIPTION OF DRAWINGS
[0020] Figure 1 REEP6 overexpression predicts poor prognosis of OSCC; wherein, A: the subcellular location of REEP6 protein in human HepG2 cells obtained using the Human Protein Atlas network tool; B: determination of REEP6 protein levels in paracancerous tissue and OSCC tissue using immunohistochemical staining method (the data is from the Human Protein Atlas network tool); C: immunohistochemical staining images of REEP6 in normal tissue and OSCC tissue; D: immunohistochemical scores of REEP6 protein levels in normal tissue (N = 15) and OSCC tissue (N = 20), REEP6 protein is significantly overexpressed in OSCC, *** indicates that there is a significant difference in immunohistochemical scores between OSCC tissue and normal tissue at the level of p≤0.001; E, F: expression levels of REEP6 in advanced pathological stages or T stages in the TCGA_OSCC cohort; G-I: the influence of REEP6 expression level on the overall survival, disease-specific survival and progression-free interval of OSCC patients.
[0021] Figure 2 Figure 6 is the results of OSCC cell lines with overexpression of REEP6 showing a pro-tumor phenotype; wherein, A: OSCC cell lines with overexpression of REEP6 (CAL-27 and SCC-15 cells) were established using lentivirus infection method (Cal27 or CAL-27 in the figure both represent CAL-27 cells, Scc15 or SCC-15 both represent SCC-15 cells, the same below); B, C: qRT-PCR and Western blotting test results of overexpression efficiency of REEP6 in OSCC cell lines; D: growth rate of OSCC cell lines after overexpression of REEP6; E: results of colony formation test of OSCC cell lines with or without overexpression of REEP6; F, G: effects of overexpression of REEP6 on cell cycle transition of OSCC cell lines; H: effects of expression level of REEP6 on cell migration of OSCC cell lines; I: effects of expression level of REEP6 on cell invasion ability of OSCC cell lines; *, **, ***, **** represent significant differences of data results of OSCC cell lines with overexpression of REEP6 and NC at P≤0.05, P≤0.01, P≤0.001, P≤0.0001, respectively.
[0022] Figure 3 Figure 7 is the results of proliferation, migration and invasion of OSCC after knockdown of REEP6; wherein, A: Western blotting test result figure for verifying knockdown efficiency of different shRNAs targeting REEP6 in OSCC cell lines; B: REEP6 mRNA level in shRNA#3 cell line targeting REEP6; C: effects of knockdown of REEP6 on growth rate of OSCC cell lines; D, E: effects of knockdown of REEP6 on proliferation rate of OSCC cell lines as shown by Edu and colony formation test; F: effects of knockdown of REEP6 on DNA damage of OSCC cell lines; G, H: effects of knockdown of REEP6 on migration and invasion of OSCC cell lines; **, **** represent significant differences of data results of OSCC cell lines with knockdown of REEP6 and NC at P≤0.01, P≤0.0001, respectively.
[0023] Figure 4Figure 6 is the effect of REEP6 overexpression on the in vivo progression of OSCC; wherein, A, B: the size and weight of the subcutaneously transplanted tumor in nude mice after 30 days; C: the body weight of nude mice on the specified day after injection of the corresponding cells into nude mice; D: the tumor volume on the specified day after injection of the corresponding cells into nude mice, the data represent the mean tumor volume ± scanning electron microscope; E: the expression of cell proliferation biomarkers (Ki-67 and PCNA) in transplanted tumors determined using immunohistochemical methods; F: the expression levels of epithelial-mesenchymal transition biomarkers (E-cad / CDH1 and Vimentin) in transplanted tumors and corresponding cell lines determined using Western blotting experiments; G: the effect of REEP6 overexpression on EMT signaling in OSCC in vivo and in vitro; *, **, *** represent significant differences in the data results of the OSCC cell line with REEP6 overexpression and NC at P≤0.05, P≤0.01, P≤0.001, respectively, and ns represents no significant difference in the data results of the OSCC cell line with REEP6 overexpression and NC.
[0024] Figure 5 Figure 7 is the negative role of REEP6 in ferroptosis in OSCC cell lines; wherein, A: differentially expressed genes after REEP6 overexpression shown in the heat map after RNA-seq analysis; B: genes down-regulated in the heat map further analyzed by GO / KEGG analysis indicate enrichment of ferroptosis signals; C: GSEA analysis based on RNA-seq data shows that ferroptosis signals are significantly inactivated in REEP6 overexpression cells; D: REEP6 gene expression correlation analysis with ferroptosis inhibitors (GPX4, SLC7A11 and NFE2L2) or ferroptosis drivers (ACSL4, ACSL5, HMOX1, ALOX5 and IFNG) in OSCC in the TCGA_OSCC cohort; E: the effect of REEP6 overexpression on Fe 2+ accumulation in OSCC cell lines; F, G: the effect of REEP6 overexpression on the production of reactive oxygen species in OSCC cell lines; *, *** represent significant differences in the data results of the OSCC cell line with REEP6 overexpression and NC at P≤0.05, P≤0.001, respectively.
[0025] Figure 6REEP6 overexpression shows resistance to RSL3-induced ferroptosis; wherein, A, B: the effect of REEP6 overexpression on mitochondrial morphology of OSCC cell lines was observed by electron microscopy; C, D: IC50values of RSL3 in REEP6 overexpression or REEP6 knockdown cell lines; E: REEP6 mRNA expression levels in OSCC cell lines exposed to different concentrations of RSL3 were detected by qRT-PCR; F, G: rescue experiments confirmed that REEP6 promotes OSCC progression by inhibiting ferroptosis in OSCC cell lines; *, ** represent that the results of the data between different treatment cell lines exist significant difference at P≤0.05, P≤0.01, respectively.
[0026] Figure 7 REEP6 overexpression inhibits ER stress-mediated ferroptosis in OSCC cell lines; wherein, A: ACSL4 mRNA expression level in REEP6 overexpression OSCC cell line (SCC-15); B, C: expression levels of ER stress-related biomarker genes and ferroptosis-related biomarker genes in OSCC cell lines with or without REEP6 overexpression; D-F: the effect of REEP6 overexpression on the protein levels of ER stress-related biomarkers and ferroptosis-related biomarkers was evaluated by Western blotting experiments, which confirmed that REEP6 overexpression negatively regulates ER stress signaling and ferroptosis signaling in OSCC cell lines; ** represents that the expression levels of different genes or proteins in REEP6 overexpression cell lines and NC cell lines exist significant difference at P≤0.01.
[0027] Figure 8 DNA hypomethylation leads to REEP6 overexpression in OSCC; wherein, A: UCSC online tool confirms that there is a CpG island in the promoter region of the REEP6 gene; B, C: the relationship between the methylation level of CpG sites and the expression level of REEP6; D: after RNA-seq analysis, the heat map shows the differentially expressed genes after 5-Aza-CDR treatment; E: the effect of 5-Aza-CdR treatment on the transcript abundance of REEP6 in OSCC cell lines; F, G: expression levels of REEP6 in OSCC cell lines with or without 5-Aza-CdR treatment; H: DNA methylation analysis of GSE 98807 cohort of REEP6 in OSCC, which includes DNA methylation chip results of head and neck cancer and paracancer tissues; *, ** represent that the data results between different treatments exist significant difference at P≤0.05, P≤0.01, respectively.
[0028] Figure 9 REEP6 overexpression promotes OSCC progression working model. DETAILED DESCRIPTION
[0029] The following examples are further illustrations of the application and are not intended to limit the same.
[0030] Example 1
[0031] 1. Materials and methods
[0032] 1.1 Tissue samples and clinical analysis
[0033] All tissue samples were collected from a total of 20 OSCC patients who underwent surgical resection in Taihe Hospital from January 10, 2017 to July 15, 2020. Normal oral gingival tissue samples were collected from 15 patients who underwent extraction of the mandibular third molar at the same time, and the informed consent of all patients was obtained. This study was approved by the Ethics Committee of Taihe Hospital of Hubei Medical College. The correlation analysis between REEP6 mRNA expression and clinical characteristics of OSCC patients was performed in the Cancer Genome Atlas (TCGA) cohort. The gene expression data and clinical information of the TCGA_OSCC cohort were downloaded from the https: / / www.cbioportal.org database.
[0034] 1.2 Immunohistochemical staining and evaluation
[0035] Primary antibody (12088-1-AP, Proteintech, Wuhan) was used to evaluate REEP6 protein levels. The expression level of REEP6 was quantified using staining intensity score and positive cell percentage score. Staining intensity score: 0 = no staining, 1 = weak staining, 2 = moderate staining, 3 = strong staining. Positive cell percentage score, score 0 = 0%~ 5% positive cells, 1 = 6%~25% positive cells, 2 = 26%~ 50% positive cells, 3 = 51%~ 75% positive cells, 4 = 76%~100% positive cells.
[0036] 1.3 Cell transfection and establishment of cell lines
[0037] OSCC cell lines and normal oral epithelial cell line HOK-8 were purchased from Shanghai Cell Bank. Cells were placed in MEK medium containing 10% fetal bovine serum (FSB) by mass fraction, and cultured at 37°C, 5% CO2. REEP6 overexpression and knockdown lentivirus were purchased from Genechem Company, and cell transplantation was performed according to the manufacturer's protocol. The overexpression or knockdown efficiency of REEP6 in cell lines was further determined by Western blot and qRT-PCR analysis.
[0038] 1.4 Cell proliferation, migration, invasion and comet assay
[0039] Proliferation of OSCC cells was determined using CCK-8, colony formation and EdU assays, migration of OSCC cells was evaluated using cell scratch assay, and invasion of OSCC cells was examined using transwell invasion assay (CCK-8, colony formation, EdU, cell scratch and transwell invasion assay methods refer to: Xia L, Zhang T, Yao J, Lu K, Hu Z, Gu X, et al. Fibromodulin overexpression drives oral squamous cell carcinoma via activating downstream EGFR signaling. Iscience. 2023;26(11):108201). The comet assay was designed to determine the relative degree of DNA damage of OSCC cells. Briefly, the first layer of 1% normal melting point gel was prepared with a glass slide. The collected cells were mixed with 0.7% low melting point gel and spread on the first layer of gel to prepare the second layer of gel. Then the gel was placed in cell lysis solution for 2 hours at 4°C, then PBS was washed for 3 minutes. The glass slide was soaked in electrophoresis buffer to unwind for 30 minutes. Then electrophoresis was performed for 30 minutes. After electrophoresis, the glass slide was placed in neutral buffer for 10 minutes. Finally, propidium iodide solution was added to the glass slide, incubated in the dark for 20 minutes, and then observed under a fluorescence microscope. Specifically, the comet electrophoresis kit (Bi Yun Tian, C2041M) was used.
[0040] 1.5 RNA isolation and quantitative RT-PCR
[0041] qPCR analysis was performed using One Step TB Green® PrimeScript™ RT-PCR Kit II (Takara, RR086). GAPDH was used as a reference gene (GAPDH_qF: GACATGCCGCCTGGAGAAAC, SEQ ID NO. 9; GAPDH_qR: AGCCCAGGATGCCCTTTAGT, SEQ ID NO. 10). Each gene was run in triplicate. The comparative ΔΔCt method was used to calculate the relative fold change of gene expression. The base sequences of the quantitative PCR primers of other genes in this experiment are as follows (represented as 5'-3'):
[0042] REEP6_qF: CCAAGCAAGGACGACGACACTG, SEQ ID NO. 11;
[0043] REEP6_qR: AGAAAGGGAACCAGGACAGGAGTAG, SEQ ID NO. 12;
[0044] DDIT3_qF: TCTCCTTCATGCGCTGCTTT, SEQ ID NO. 13;
[0045] DDIT3_qR: AGAACCAGGAAACGGAAACAGA, SEQ ID NO. 14;
[0046] GPR78_qF: AAAGCTAAGAAGAAGGAACTGGAAG, SEQ ID NO. 15;
[0047] GPR78_qR: CAACTCATCTTTTTCTGCTGTATCC, SEQ ID NO. 16;
[0048] PERK_qF: TACAAGAGGGAGAGGAACAAACGAA, SEQ ID NO. 17;
[0049] PERK_qR: CCTGTGAGGATGAGGATGGAAAAG, SEQ ID NO. 18;
[0050] ACSL4_qF: CATCCCTGGAGCAGATACTCT, SEQ ID NO. 19;
[0051] ACSL4_qR: TCACTTAGGATTTCCCTGGTCC, SEQ ID NO. 20;
[0052] ACSL5_qF: ACCCATGAAAATGTTGTTTCAA, SEQ ID NO. 21;
[0053] ACSL5_qR: GAGGTGGGCTGGAAGATAGG, SEQ ID NO. 22.
[0054] 1.6 RNA sequencing
[0055] RNA-seq study was performed in REEP6 overexpressed SCC-15 cells. Briefly, the total amount of 1.5 μg RNA per sample was used for RNA sample preparation. The whole process of library construction and sequencing was performed by Shanghai Life Technology Co., Ltd. and RNA-seq data was obtained.
[0056] 1.7 Mouse xenograft model
[0057] The study protocol was approved by the Experimental Animal Research Ethics Committee of Hubei Medical College. All animals were treated in accordance with the guidelines of the Animal Committee of Hubei Medical College. NC (Negative Control) and REEP6 overexpressed CAL-27 cells were injected into the subcutaneous tissue of female MCB / c nude mice. After 28 days, all mice were euthanized and tumors were collected for weighing and volume measurement. The tumor volume was calculated using the following formula: Volume = length x (width) 2 / 2.
[0058] 1.8 Active oxygen detection and iron ion content
[0059] Flow cytometry was used to determine the relative active oxygen production level. The level of hydrogen peroxide in OSCC cells was determined by staining the cells with a 2',7'-dichlorofluorescein (DCF) probe. The intensity of DCF fluorescence is directly proportional to the amount of hydrogen peroxide produced in the cells. Briefly, OSCC cells were incubated with DCF at 37°C for 15 minutes. Then, the cells were removed, washed and resuspended in PBS, and DCF fluorescence was analyzed using a CycloFLEX machine (Beckman, USA). Hydrogen peroxide treatment was used as a positive control group. PGSK combined with flow cytometry was used to determine the relative iron ion level. The PGSK probe was used to determine the level of iron ions in the cells.
[0060] 1.9 Western blot assay
[0061] Western blotting was performed according to the literature (Li D, Xia L, Huang P, Wang Z, Guo Q, Huang C, et al. Cancer-associated fibroblast-secreted IGFBP7 promotes gastric cancer by enhancing tumor associated macrophage infiltration via FGF2 / FGFR1 / PI3K / AKT axis. Cell death discovery. 2023;9(1):17.). OSCC cell lines were lysed in RIPA buffer containing 1 mM PMSF. The protein concentration of all samples was quantified and standardized using the BSA method. Then, the protein samples were layered and transferred to a polyvinylidene fluoride membrane, incubated with primary and secondary antibodies (Multi-rAb HRP-Goat Anti-Rabbit Recombinant Secondary Antibody (H+L), RGAR001, Ruiyuan, Wuhan, China), and the final image was visualized using a Bio-Rad imaging system (USA). The primary antibodies used in this experiment were as follows: PERK (3192, Cell Signaling Technology, Danvers, MA), p-PERK (Thr 980, BS-3330 R, Bioss, USA), CHOP (SC-7351, Santa Cruz, CA), GPR78 (ab21685, AbCam, Cambridge, UK), E-cad (A24874, ABclonical, Wuhan, China), VIM (A19607, ABclonical, Wuhan, China), TFRC (A5865, ABclonical, Wuhan, China), ACSL4 (A20414, ABclonical, Wuhan, China), ACSL5 (A14130, ABclonical, Wuhan, China), SLC7A11 (A25219, ABclonical, Wuhan, China), and GPX4 (A21440, ABclonical, Wuhan, China).
[0062] 1.10 Statistical analysis
[0063] For gene expression analysis of different subtypes of OSCC, P value was estimated using Mann-Whitney non-parametric test. Survival curves were calculated using the Kaplan-Meier method and differences between curves were analyzed using the log-rank test. All remaining experiments used unpaired t-test or one-way ANOVA test. For all experiments, each group was repeated at least three times and repeated at least three times to achieve reproducibility. All tests with P value less than 0.05 were considered statistically significant.
[0064] 2. Results of the study
[0065] 2.1 REEP6 overexpression predicts poor prognosis of oral cancer
[0066] To explore the biological function of REEP6 (nucleotide sequence of genomic DNA as shown in SEQ ID NO. 1, amino acid sequence as shown in SEQ ID NO. 2) in OSCC, we first studied the subcellular localization of REEP6 protein in human cells using the Human Protein Atlas web tool. According to the images taken by confocal microscopy, REEP6 is indeed a protein located in the endoplasmic reticulum (ER) (Fig. 1A), which is consistent with its reported function. Based on the results of immunohistochemical staining (IHC) of OSCC tissues and peritumoral tissues in the Human Protein Atlas database, REEP6 protein is highly expressed in OSCC (Fig. 1B). Next, we further evaluated the expression of REEP6 in adjacent normal oral tissue samples (N=15) and OSCC samples (N=20) using immunohistochemical staining analysis (Fig. 1C). IHC results showed that REEP6 protein was significantly overexpressed in OSCC compared to adjacent normal oral tissues (Fig. 1D). On the other hand, we performed clinical analysis of REEP6 in the TCGA_OSCC cohort. The results showed that REEP6 overexpression was positively correlated with advanced pathological stage and pathological T stage of OSCC patients (Fig. 1E, F). More importantly, OSCC patients with relatively high REEP6 expression had shorter overall survival, disease-specific survival, and progression-free interval time (Fig. 1G, H, I). In summary, REEP6 gene can act as an oncogene in OSCC. Figure 1 A), which is consistent with its reported function. Based on the results of immunohistochemical staining (IHC) of OSCC tissues and peritumoral tissues in the Human Protein Atlas database, REEP6 protein is highly expressed in OSCC (Fig. 1B). Next, we further evaluated the expression of REEP6 in adjacent normal oral tissue samples (N=15) and OSCC samples (N=20) using immunohistochemical staining analysis (Fig. 1C). IHC results showed that REEP6 protein was significantly overexpressed in OSCC compared to adjacent normal oral tissues (Fig. 1D). On the other hand, we performed clinical analysis of REEP6 in the TCGA_OSCC cohort. The results showed that REEP6 overexpression was positively correlated with advanced pathological stage and pathological T stage of OSCC patients (Fig. 1E, F). More importantly, OSCC patients with relatively high REEP6 expression had shorter overall survival, disease-specific survival, and progression-free interval time (Fig. 1G, H, I). In summary, REEP6 gene can act as an oncogene in OSCC. Figure 1 B). Next, we further evaluated the expression of REEP6 in adjacent normal oral tissue samples (N=15) and OSCC samples (N=20) using immunohistochemical staining analysis (Fig. 1C). IHC results showed that REEP6 protein was significantly overexpressed in OSCC compared to adjacent normal oral tissues (Fig. 1D). On the other hand, we performed clinical analysis of REEP6 in the TCGA_OSCC cohort. The results showed that REEP6 overexpression was positively correlated with advanced pathological stage and pathological T stage of OSCC patients (Fig. 1E, F). More importantly, OSCC patients with relatively high REEP6 expression had shorter overall survival, disease-specific survival, and progression-free interval time (Fig. 1G, H, I). In summary, REEP6 gene can act as an oncogene in OSCC. Figure 1 C). IHC results showed that REEP6 protein was significantly overexpressed in OSCC compared to adjacent normal oral tissues (Fig. 1D). On the other hand, we performed clinical analysis of REEP6 in the TCGA_OSCC cohort. The results showed that REEP6 overexpression was positively correlated with advanced pathological stage and pathological T stage of OSCC patients (Fig. 1E, F). More importantly, OSCC patients with relatively high REEP6 expression had shorter overall survival, disease-specific survival, and progression-free interval time (Fig. 1G, H, I). In summary, REEP6 gene can act as an oncogene in OSCC. Figure 1 D). On the other hand, we performed clinical analysis of REEP6 in the TCGA_OSCC cohort. The results showed that REEP6 overexpression was positively correlated with advanced pathological stage and pathological T stage of OSCC patients (Fig. 1E, F). More importantly, OSCC patients with relatively high REEP6 expression had shorter overall survival, disease-specific survival, and progression-free interval time (Fig. 1G, H, I). In summary, REEP6 gene can act as an oncogene in OSCC. Figure 1 E, F). More importantly, OSCC patients with relatively high REEP6 expression had shorter overall survival, disease-specific survival, and progression-free interval time (Fig. 1G, H, I). In summary, REEP6 gene can act as an oncogene in OSCC. Figure 1 G, H, I). In summary, REEP6 gene can act as an oncogene in OSCC.
[0067] 2.2 REEP6 overexpression promotes OSCC cell proliferation, migration and invasion
[0068] To confirm the pro-tumorigenic role of REEP6, gain-of-function and loss-of-function studies were performed to explore the effects of REEP6 on the biological behavior of OSCC cells. Lentivirus infection was used to perform REEP6 overexpression study Figure 2 A). Western blot and qRT-PCR analysis together confirmed the successful overexpression of REEP6 in two OSCC cell lines (CAL-27, SCC-15) Figure 2 B, C). CCK-8 assay showed that REEP6 overexpression significantly increased the growth rate of CAL-27 and SCC-15 cell lines Figure 2 D). Colony formation assay confirmed that REEP6 overexpression significantly increased the number of OSCC cell colonies Figure 2 E). Since REEP6 has a significant promoting effect on OSCC cell proliferation, the effects of REEP6 overexpression on the distribution of OSCC cell cycle phases were further evaluated using flow cytometry method. The results showed that REEP6 overexpression promoted the transition from G1 phase to S phase and G2 / M phase in CAL-27 and SCC-15 cell lines Figure 2 F, G). Interestingly, cell scratch and transwell invasion assays also showed that REEP6 overexpression significantly enhanced the migration and invasion ability of OSCC cell lines Figure 2 H, I).
[0069] 2.3 REEP6 deficiency inhibits cell proliferation, invasion and induces DNA damage in OSCC cell lines
[0070] Lentivirus-short hairpin RNA (shRNA) system is a widely used RNA interference tool. Loss-of-function study of REEP6 was performed using 3 different shRNAs in two OSCC cell lines to avoid off-target effects. Specifically, lentivirus production was customized by Genechem, and 3 different shRNA targets were inserted into the vector GV298, respectively. The primer sequences used are shown in SEQ ID NO. 3-SEQ ID NO. 8 (Table 1). Western blot assay showed that shRNA #3 (target sequence: GCATGGCTCCCAGGCCCTGGAA) had the highest REEP6 knockdown efficiency in OSCC cell lines Figure 3 A). shRNA #3 cell line targeting REEP6 was selected for loss-of-function study, and the REEP6 mRNA level in shRNA #3 cell line was greatly reduced to 30% of the original level Figure 3 B). Therefore, shRNA #3 cell line was selected to verify the inhibitory effect of REEP6 deficiency on OSCC cell lines. CCK-8 Figure 3 C), EdU staining Figure 3 D) and colony formation assayFigure 3 E) together confirmed that REEP6 deficiency significantly inhibited the growth and proliferation rate of cells in the OSCC cell line. Furthermore, REEP6 knockdown significantly promoted DNA damage in the OSCC cell line. Figure 3 F). In addition, cell scratches ( Figure 3 G) and transwell ( Figure 3 H) assays showed that REEP6 knockdown significantly inhibited the migration and invasion of OSCC cell lines. These results collectively suggest that the REEP6 gene acts as an oncogene in OSCC progression.
[0071] Table 1. Primers used for shRNA knockdown of REEP6
[0072]
[0073] 2.4 REEP6 overexpression promotes tumor growth and activates EMT signaling in cell lines and xenografts.
[0074] Based on these in vitro results, REEP6 plays a carcinogenic role in OSCC. Here, we further validated the in vivo carcinogenic effect of REEP6. We evaluated the ability of REEP6-overexpressing CAL-27 cells to form orthotopic tumors using a nude mouse subcutaneous transplantation model. The results showed that REEP6 overexpression significantly accelerated tumor growth (weight and volume) in the transplanted tumor, but had no significant effect on the body weight of the nude mice. Figure 4 AD). Furthermore, the expression of cell proliferation biomarkers (Ki-67 and PCNA) in xenografts formed from REEP6-overexpressing CAL-27 cells was higher than that in xenografts formed from negative control CAL-27 cells. Figure 4 E). Western blot assays in CAL-27 cell lines and transplanted tumors showed that REEP6 overexpression significantly activated epidermal-mesenchymal transition (EMT) signaling in vitro and in vivo. Figure 4 (F, G). Tumor metastasis is closely related to EMT signaling. Therefore, we hypothesize that REEP6 may promote OSCC metastasis by activating EMT signaling.
[0075] 2.5 REEP6 as an inhibitor of ferroptosis
[0076] To understand the molecular mechanism of REEP6's pro-tumorigenic effect in OSCC, we performed RNA sequencing in the SCC-15 cell line. The most significantly differentially expressed genes (DEGs) after REEP6 overexpression, including several ferroptosis driver genes (TFRC, SAT1, ACSL4, and ACSL5), are shown in the heatmap ( Figure 5A). GO / KEGG analysis showed that DEGs after REEP6 overexpression were enriched in ferroptosis signals ( Figure 5 B). GSEA analysis based on RNA-seq data showed that ferroptosis signals were significantly inactivated in REEP6 overexpression cells ( Figure 5 C). In addition, gene expression correlation analysis showed that REEP6 was positively correlated with ferroptosis inhibitors (GPX4, SLC7A11 and NFE2L2) in OSCC, but negatively correlated with ferroptosis drivers (ACSL4, ACSL5, HMOX1, ALOX5 and IFNG) in TCGA_OSCC cohort ( Figure 5 D). These results collectively suggest that REEP6 may play a role in regulating cellular ferroptosis.
[0077] Ferroptosis is a new type of programmed cell death, which is iron-dependent and different from cell death, necrosis and autophagy. Under the action of divalent iron or ester oxygenase, the highly expressed unsaturated fatty acids on the cell membrane undergo lipid peroxidation, leading to cell death. To verify the role of REEP6 in ferroptosis in OSCC cells, we used PGSK and DCF probes to evaluate the effect of REEP6 overexpression on the relative content of divalent iron and reactive oxygen species in OSCC cell lines. Flow cytometry results showed that REEP6 overexpression reduced the accumulation of divalent iron in OSCC cell lines ( Figure 5 E) and reactive oxygen species production ( Figure 5 F-G).
[0078] In addition, compared with the control group, REEP6 overexpressed OSCC cells showed better mitochondrial membrane and inner wave crest integrity ( Figure 6 A, B). These evidences collectively suggest that REEP6 plays an important role in ferroptosis in OSCC cells. Therefore, we further evaluated the effect of REEP6 overexpression or knockdown in OSCC cell lines exposed to different concentrations of RSL3, a well-known ferroptosis inducer. The results showed that REEP6 overexpression significantly increased the RSL3 resistance of OSCC cell lines, while REEP6 knockdown increased the RSL3 sensitivity of OSCC cell lines ( Figure 6 C, D). In addition, we noticed that RSL3 treatment could significantly up-regulate the mRNA expression of RSL3 in OSCC cell lines ( Figure 6 E). Therefore, we speculate that REEP6 may promote the progression of OSCC by inhibiting ferroptosis. To verify this possibility, we performed a rescue experiment of cell colony formation in OSCC cell lines using RSL3. The results showed that the promoting effect of REEP6 on the proliferation of OSCC cells could be rescued by RSL3 treatment ( Figure 6F, G). These results collectively suggest that REEP6 promotes OSCC progression by inhibiting ferroptosis.
[0079] It is known that long-chain fatty acid-CoA ligase 4 (ACSL4) becomes a driver of ferroptosis by participating in the synthesis of membrane phospholipids that are susceptible to oxidation. Recent evidence suggests that the CHOP / ACSL4 axis is involved in ferroptosis associated with endoplasmic reticulum (ER) stress. Consistently, REEP6 has been reported to play a role in maintaining ER homeostasis. Therefore, we speculated that REEP6 might inhibit ferroptosis by maintaining ER homeostasis. Based on RNA-seq analysis, ACSL4 mRNA was downregulated in REEP6-overexpressed OSCC cells ( Figure 7 A). To validate the RNA-seq data, we further determined the expression levels of ACSL4 / 5 and ER stress-related genes (e.g., DDIT3 / CHOP, GPR78, and PERK / EIF2AK3) in SCC-15 and CAL-27 cell lines with or without REEP6 overexpression. The results showed that REEP6 overexpression significantly reduced the expression levels of ACSL4 / 5 and ER stress-related genes in OSCC cell lines ( Figure 7 B, C). In addition, we further examined the protein levels of ferroptosis-related classic biomarkers (GPX4, SLC7A11, TFRC, ACSL4, and ACSL5) and ER stress-related biomarkers (CHOP, GPR78, PERK, and p-PERK) in REEP6-overexpressed OSCC cell lines using western blotting experiments ( Figure 7 D). The results showed that REEP6 overexpression significantly reduced the protein levels of ER stress-related biomarkers (CHOP, GPR78, and p-PERK) and the expression levels of well-known drivers of ferroptosis (ACSL4 / 5, TFRC) in OSCC cell lines ( Figure 7 E, F). In contrast, the expression levels of ferroptosis-inhibiting proteins (GPX4, SLC7A11) were significantly increased in REEP6-overexpressed OSCC cell lines ( Figure 7 F). In summary, REEP6 overexpression inhibits ferroptosis by maintaining ER homeostasis through the CHOP / ACSL4 axis.
[0080] 2.6 DNA hypomethylation activates REEP6 expression in OSCC
[0081] According to the annotation of the REEP6 gene on the UCSC website, there is a CpG island in the promoter region of the REEP6 gene ( Figure 8 A). This CpG island contains more than 20 CpG sites, about half of which undergo extensive methylation modification ( Figure 8B). Moreover, the methylation level of these CpG sites was significantly negatively correlated with the expression level of REEP6 gene in TCGA_OSCC cohort (p < 0.05) Figure 8 B, C). These results suggest that the expression of REEP6 gene can be regulated by its promoter DNA methylation. To verify this possibility, we treated two OSCC cell lines with DNA methyltransferase inhibitor (5-Aza-CdR) for 48 hours, followed by transcriptome sequencing. After RNA-seq analysis, we noticed that 5-Aza-CdR greatly upregulated REEP6 expression in CAL-27 and SCC-15 cell lines (p < 0.05) Figure 8 D, E). Moreover, qRT-PCR and Western blot assays together indicated that REEP6 was significantly activated by 5-Aza-CdR in OSCC cell lines (p < 0.05) Figure 8 F, G). These results suggest that REEP6 gene expression is negatively regulated by its promoter DNA methylation. Considering the overexpression of REEP6 in OSCC, we further performed methylation analysis of REEP6 gene between cancer and normal tissues of OSCC patients. The results showed that the methylation level of REEP6 gene promoter in cancer tissues was significantly lower than that in normal tissues (p < 0.05) Figure 8 H). In other words, it is the DNA hypomethylation that leads to the overexpression of REEP6 in OSCC.
[0082] In summary, REEP 6 is a novel ferroptosis inhibitor. Our findings highlight that DNA methylation hypomediating REEP 6 overexpression promotes OSCC progression by inhibiting cellular ferroptosis (p < 0.05) Figure 9 ).
Claims
1. A drug for treating oral squamous cell carcinoma, characterized in that, The drug includes an inhibitor of the REEP6 gene; the nucleotide sequence of the REEP6 gene is shown in SEQ ID NO.1; the inhibitor is shRNA, and the target sequence of the shRNA is GCATGGCTCCCAGGCCCTGGAA.
2. The application of REEP6 gene inhibitors in the preparation of drugs for treating oral squamous cell carcinoma, characterized in that, The inhibitor described herein can reduce the expression level of the REEP6 gene in vitro and / or in vivo; the nucleotide sequence of the REEP6 gene is shown in SEQ ID NO.1; the inhibitor is shRNA, and the target sequence of the shRNA is GCATGGCTCCCAGGCCCTGGAA.
3. A method for in vitro non-therapeutic inhibition of the growth rate, proliferation rate, migration, and / or invasion of oral squamous cell carcinoma cells, characterized in that, Oral squamous cell carcinoma cells were cultured in the presence of an inhibitor of the REEP6 gene to inhibit the growth rate, proliferation rate, migration and / or invasion of oral squamous cell carcinoma cells; the nucleotide sequence of the REEP6 gene is shown in SEQ ID NO.1; the inhibitor is shRNA, and the target sequence of the shRNA is GCATGGCTCCCAGGCCCTGGAA.