Use of reagent for detecting circATP2B4 in preparation of product for diagnosing oral squamous cell carcinoma
By detecting the expression level of circATP2B4, the difficult problem of oral squamous cell carcinoma diagnosis was solved. As a biomarker, circATP2B4 plays an important role in the diagnosis and treatment of OSCC, significantly improving the diagnostic efficiency and inhibiting the malignant behavior of cancer cells.
Patent Information
- Application Number
- CN202411723113.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-28
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2044-11-28
AI Technical Summary
The existing technology lacks effective biomarkers for the diagnosis of oral squamous cell carcinoma, and OSCC patients are often diagnosed in the middle and late stages, with poor prognosis, unclear pathogenic mechanisms, and a lack of clinical targets.
circATP2B4 is used as a biomarker, and the risk of oral squamous cell carcinoma is determined by detecting its expression level. Reagents for detecting circATP2B4 and substances that inhibit circATP2B4 expression are provided to construct an oral squamous cell carcinoma risk assessment system, which can be used to prepare diagnostic products.
The expression level of circATP2B4 was significantly upregulated in OSCC patients, with an AUC value of 0.75, which can effectively diagnose OSCC. Inhibiting circATP2B4 expression can inhibit the proliferation, migration and invasion of OSCC cells, providing a preventive and therapeutic option.
Smart Images

Figure GDA0005211324980000081 
Figure GDA0005211324980000091 
Figure GDA0005211324980000092
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of a reagent for detecting circATP2B4 in the preparation of a product for diagnosing oral squamous cell carcinoma. Background Art
[0002] Oral squamous cell carcinoma (OSCC) is one of the most common oral malignancies in the oral and maxillofacial region. Most OSCC patients have a poor prognosis, with a 5-year overall survival rate of 55% to 65%. On the one hand, OSCC patients are often diagnosed in the advanced stage or have already developed lymph node metastasis. On the other hand, the pathogenic mechanism of OSCC is not fully understood, and there is a lack of effective targets for the diagnosis and treatment of OSCC in clinical practice. Therefore, the search for new biomarkers is crucial.
[0003] Circular RNA (circRNA) is a highly expressed, specialized noncoding RNA, with expression levels up to 10-fold higher than linear isomers and often exhibiting specific expression patterns at different developmental stages. Furthermore, the closed, circular structure of circRNA makes it less susceptible to degradation by RNases, allowing it to exist more stably in organisms. Multiple lines of evidence indicate that circRNAs are abnormally expressed in various types of cancer and may serve as potential clinical diagnostic biomarkers. However, currently, the potential biomarkers closely associated with the development and progression of OSCC are mostly proteins and miRNAs, while relatively few potential circRNA biomarkers for OSCC have been reported. Summary of the Invention
[0004] The present invention aims to solve at least one of the technical problems existing in the prior art.
[0005] To this end, the present invention proposes the use of a reagent for detecting circATP2B4 in the preparation of a product for diagnosing oral squamous cell carcinoma. circATP2B4 is a biomarker for oral squamous cell carcinoma, and the risk of oral squamous cell carcinoma in a subject can be determined by detecting its expression level.
[0006] The present invention also provides a risk assessment system for oral squamous cell carcinoma.
[0007] The present invention also provides the use of substances that inhibit the expression of circATP2B4.
[0008] The present invention also provides the application of circATP2B4.
[0009] According to a first aspect of the present invention, there is provided use of a reagent for detecting circATP2B4 in the preparation of a product for diagnosing oral squamous cell carcinoma.
[0010] The circBank ID of circATP2B4 is hsa_circATP2B4_017, and the circBase ID is hsa_circ_0007167. Its parent gene is ATPase Plasma Membrane Ca 2+ Transporting 4 (ATP2B4) gene, also known as ATP2B2, MXRA1, PMCA4, PMCA4b, and PMCA4x; this circular RNA is formed by the cyclization of exons 9 and 10 located at chr1:203676136-chr1:203677232, with a total length of 458 base pairs; the specific nucleotide sequence is as follows:
[0011] 5'-GTCTGCTCATGTCTGCTCTCACGGTTTTCATCCTGATTCTATACTTTGTGATTGAC AACTTTGTGATAAATCGCAGACCATGGCTCCCTGAGTGTACTCCCATCTACATCCAGTACTTTGTCAAGTTCTTCATCATCGGCATCACTGTACTGGTGGTGGCTGTGCCAGAGGGGCTGCCTCTGGCTGTCACCATCTCACTGGCCTACTCTGTGAAGAAAATGATGAAAGACAATAACCTAGTACGGCACTTGGATGCTTGT GAGACCATGGGCAACGCCACCGCCATCTGCTCTGATAAGACAGGCACGTTGACCATGAACCGCATGACTGTGGTACAAGCTTATATTGGGGGCATCCATTACCGTCAAATCCCAAGCCCTGATGTCTTCCTGCCCAAAGTCCTGGACCTCATTGTCAATGGCATTTCTATCAACAGTGCTTATACCTCCAAGATTCTG-3'(SEQ ID NO:1).
[0012] In some embodiments of the present invention, the reagent for detecting circATP2B4 includes a primer pair for amplifying circATP2B4.
[0013] In some embodiments of the invention, the primer pair comprises:
[0014] The primer pair shown in SEQ ID NO: 2-3; or,
[0015] The primer pair shown in SEQ ID NO:6-7.
[0016] In some embodiments of the present invention, the oral squamous cell carcinoma refers to a cancer with squamous differentiation originating from the oral mucosal epithelium, wherein the oral mucosa includes at least one of the buccal mucosa, gingival mucosa, retromolar trigone mucosa, tongue (anterior 2 / 3 of the terminal sulcus) mucosa, floor of mouth mucosa, hard palate mucosa and lip mucosa.
[0017] In some embodiments of the present invention, the reagent for detecting circATP2B4 is a reagent for detecting the expression level of circATP2B4 in a test sample.
[0018] In some embodiments of the present invention, the sample to be tested includes at least one of a cell sample, a tissue sample, and a body fluid sample.
[0019] In some embodiments of the present invention, the tissue sample comprises an oral mucosal tissue sample.
[0020] In some embodiments of the present invention, the expression level of circATP2B4 is the relative expression level of circATP2B4 relative to an internal reference gene, and the internal reference gene includes any one of β-Actin, GAPDH and tubulin.
[0021] In some embodiments of the present invention, the internal reference gene used to calculate the relative expression level is β-Actin.
[0022] In some embodiments of the present invention, the product further comprises a nucleic acid extraction reagent and a reverse transcription reagent.
[0023] In some embodiments of the present invention, the nucleic acid extraction reagent includes TRIzol.
[0024] In some embodiments of the present invention, the reverse transcription reagent includes reverse transcription polymerase, dNTPs and RT primers.
[0025] In some embodiments of the invention, the reverse transcriptase polymerase comprises Evo M-MLV RTase.
[0026] In some embodiments of the present invention, the RT primer comprises at least one of a random primer and oligo dT.
[0027] In some embodiments of the present invention, the reverse transcription reagent further comprises an RNase inhibitor, a gDNA removal reagent, and RNase-free water.
[0028] In some embodiments of the present invention, the product further comprises an internal reference primer pair.
[0029] In some embodiments of the present invention, the internal reference primer pair is a primer pair for detecting β-Actin.
[0030] According to a second aspect of the present invention, there is provided an oral squamous cell carcinoma risk assessment system, the oral squamous cell carcinoma risk assessment system comprising an acquisition module and an assessment module;
[0031] The acquisition module is used to obtain information on the expression level of circATP2B4 in the subject sample,
[0032] The evaluation module is used to compare the expression level of circATP2B4 with a threshold value, and indicate whether the subject has squamous cell carcinoma based on the comparison result.
[0033] In some embodiments of the present invention, the oral squamous cell carcinoma risk assessment system further comprises a detection module, which is configured to detect the expression level of circATP2B4 based on a sample from a subject.
[0034] It is understandable that the acquisition module can obtain the information on the expression level of circATP2B4 in the subject's sample based on the detection result of circATP2B4 in a direct or indirect manner.
[0035] In some embodiments of the present invention, the sample to be tested includes at least one of a cell sample, a tissue sample, and a body fluid sample.
[0036] In some embodiments of the present invention, the tissue sample comprises an oral mucosal tissue sample.
[0037] In some embodiments of the present invention, the expression level of circATP2B4 is the relative expression level of circATP2B4 relative to an internal reference gene, and the internal reference gene includes any one of β-Actin, GAPDH and tubulin.
[0038] In some embodiments of the present invention, the internal reference gene used to calculate the relative expression level is β-Actin.
[0039] In some embodiments of the present invention, the product further comprises a nucleic acid extraction reagent and a reverse transcription reagent.
[0040] In some embodiments of the present invention, the nucleic acid extraction reagent includes TRIzol.
[0041] In some embodiments of the present invention, the reverse transcription reagent includes reverse transcription polymerase, dNTPs and RT primers.
[0042] In some embodiments of the invention, the reverse transcriptase polymerase comprises Evo M-MLV RTase.
[0043] In some embodiments of the present invention, the RT primer comprises at least one of a random primer and oligo dT.
[0044] In some embodiments of the present invention, the reverse transcription reagent further comprises an RNase inhibitor, a gDNA removal reagent, and RNase-free water.
[0045] In some embodiments of the present invention, the product further comprises an internal reference primer pair.
[0046] In some embodiments of the present invention, the internal reference primer pair is a primer pair for detecting β-Actin.
[0047] In some embodiments of the present invention, in the evaluation module, when the expression level of circATP2B4 in the sample of the subject is higher than a threshold, it indicates that the subject has oral squamous cell carcinoma.
[0048] In some embodiments of the present invention, the threshold value is a cutoff value when a ROC curve constructed by the OSCC patient group and the control group meets a certain specificity and / or sensitivity, for example, the cutoff value when the sum of specificity and sensitivity is maximized.
[0049] In some embodiments of the present invention, the OSCC patient group and the control group are cancer tissues and paracancerous tissues of OSCC patients, or cancer tissues of OSCC patients and sample tissues of normal subjects, respectively.
[0050] According to a third aspect of the present invention, there is provided the use of a substance for inhibiting the expression of circATP2B4 in the preparation of (1) to (2):
[0051] (1) Drugs for the treatment and / or prevention of oral squamous cell carcinoma;
[0052] (2) Drugs that inhibit the proliferation, migration or invasion of oral squamous cell carcinoma cells.
[0053] In some embodiments of the present invention, the substance that inhibits the expression of circATP2B4 includes: any one of: antisense oligonucleotide (ASO) of circATP2B4, small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), clustered regularly interspaced short palindromic repeats (CRSIPR) system, transcription activator-like effector nuclease (TALEN) system, and zinc finger nuclease (ZFN) system.
[0054] In some embodiments of the present invention, the nucleotide sequences of the sense strand and antisense strand of the shRNA are shown as SEQ ID NO: 10 and SEQ ID NO: 11, respectively.
[0055] In some embodiments of the present invention, the substance that inhibits the expression of circATP2B4 further comprises a vector loaded with the above-mentioned ASO, siRNA, shRNA, miRNA, CRISPR system, TALEN system, or ZFN system.
[0056] In some embodiments of the present invention, the vector comprises any one of a plasmid, a lentivirus, an adenovirus, and an adeno-associated virus.
[0057] According to a fourth aspect of the present invention, there is provided a use of circATP2B4 in constructing a computational model for assessing the risk of oral squamous cell carcinoma.
[0058] In some embodiments of the present invention, the computational model uses the expression level of circATP2B4 as an input variable, performs calculations using bioinformatics methods, and outputs the risk of oral squamous cell carcinoma.
[0059] The present invention has at least the following beneficial effects:
[0060] The biomarker circATP2B4, provided by this study, exhibits tissue-specific expression and is significantly upregulated in tumor tissues and OSCC cells from patients, with a receiver operating characteristic curve (AUC) value reaching 0.75. Furthermore, circATP2B4 regulates the proliferation, migration, and invasion of OSCC cells. Therefore, circATP2B4 plays an important regulatory role in the development and progression of OSCC and can serve as an effective clinical diagnostic marker for OSCC, thereby guiding clinical prevention or treatment options.
[0061] Additional aspects and advantages of the present application will be given in part in the description below, and in part will become obvious from the description below, or will be learned through practice of the present application. BRIEF DESCRIPTION OF THE DRAWINGS
[0062] The present invention will be further described below with reference to the accompanying drawings and embodiments, in which:
[0063] Figure 1 Schematic diagram of the structure of circATP2B4 in Example 1 of the present invention;
[0064] Figure 2 The relative expression level of circATP2B4 in cancerous tissues and adjacent tissues of OSCC patients in Example 3 of the present invention is shown in the figure; “*” represents p<0.05;
[0065] Figure 3 The relative expression level of circATP2B4 in different OSCC cell lines in Example 3 of the present invention is shown in the figure; where "*" represents p < 0.05, "**" represents p < 0.01, and "***" represents p < 0.001;
[0066] Figure 4 : This is the ROC curve diagram of the diagnostic efficacy of circATP2B4 for OSCC using cancer tissue and adjacent paracancerous tissue in Example 3 of the present invention;
[0067] Figure 5 This is a diagram showing the knockdown efficiency test results of HSC3 and HN6 cells knocking down circATP2B4 in Example 4 of the present invention;
[0068] Figure 6 This is a graph showing the results of a CCK-8 experiment on the HSC3 stably transfected cell line with circATP2B4 knockdown in Example 4 of the present invention, where "***" represents p < 0.001;
[0069] Figure 7This is a graph showing the CCK-8 assay results of the HN6 stably transfected cell line with circATP2B4 knockdown in Example 4 of the present invention, where “*” represents p<0.05 and “***” represents p<0.001;
[0070] Figure 8 The figure shows the results of the scratch assay of the HSC3 stably transfected cell line with knockdown of circATP2B4 in Example 4 of the present invention, where "***" represents p < 0.001, and the scale bar is 100 μm;
[0071] Figure 9 The figure shows the results of the scratch assay of the HN6 stably transfected cell line with knockdown of circATP2B4 in Example 4 of the present invention, where "***" represents p < 0.001, and the scale bar is 100 μm;
[0072] Figure 10 Figure 4 shows the results of the cell migration experiment of the HSC3 and HN6 stably transfected cell lines with circATP2B4 knockdown in Example 4 of the present invention, where "***" represents p < 0.001, and the scale bar is 250 μm;
[0073] Figure 11 Figure 4 shows the results of the invasion experiment of the HSC3 and HN6 stably transfected cell lines with circATP2B4 knockdown in Example 4 of the present invention, where "***" represents p < 0.001, and the scale bar is 250 μm;
[0074] Figure 12 This is a graph showing the tumor size results in the control group and tumor-bearing mice after circATP2B4 knockdown in Example 5 of the present invention;
[0075] Figure 13 Statistical graph of tumor weights in the control group and tumor-bearing mice after circATP2B4 knockdown in Example 5 of the present invention; where “**” represents p<0.01. DETAILED DESCRIPTION
[0076] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.
[0077] In the description of the present invention, if there is a description of first, second, etc., it is only for the purpose of distinguishing technical features, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features or implicitly indicating the order of the indicated technical features.
[0078] When a numerical range is disclosed herein, the range is considered continuous and includes the minimum and maximum values of the range, as well as every value between such minimum and maximum values. Further, when a range refers to an integer, every integer between the minimum and maximum values of the range is included. In addition, when multiple ranges are provided to describe a feature or characteristic, the ranges can be combined. In other words, unless otherwise indicated, all ranges disclosed herein are understood to include any and all subranges subsumed therein.
[0079] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts are within the scope of the present invention.
[0080] Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.
[0081] Materials and instruments
[0082] The sources of the main materials and instruments used in the following examples of the present invention are as follows:
[0083] TRIzol reagent was purchased from Dalian TaKaRa Company;
[0084] High-fidelity PCR polymerase ApexHF HSDNA polymerase premix-FS (Cat.#AG12206), reverse transcription kit Evo M-MLV RT Mix Kit with gDNA Clean for qPCR (Cat.#AG11728), and fluorescent quantitative PCR reagent SYBR Green Premix Pro Taq HS qPCR Kit II (Cat.#AG11702) were purchased from Hunan Aikerui Bioengineering Co., Ltd.
[0085] RNase-free water was purchased from Biosharp, China;
[0086] The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.
[0087] HSC3 was purchased from Beina Biotechnology;
[0088] HN6 was obtained from Peking University School of Stomatology;
[0089] CAL27 and SCC15 were purchased from ATCC Biological Resource Center;
[0090] HOK was purchased from Shanghai Meixuan Biotechnology Co., Ltd.;
[0091] DMEM (Dulbecco's Modified Eagle Medium) and streptomycin-penicillin double antibody mixture were purchased from The RMO Fisher Scientific Company, USA;
[0092] Fetal bovine serum was purchased from PAN-Biotech, Germany;
[0093] Lentivirus and polybrene were purchased from Shanghai Hanbio Biotech Co., Ltd.;
[0094] CCK-8 (Cell Counting Kit-8) cell proliferation detection kit was purchased from Shenzhen Aipno Biomedical Technology Co., Ltd.;
[0095] Matrigel was purchased from Corning, USA;
[0096] 10% paraformaldehyde was purchased from Guangzhou Weigesi Biotechnology Co., Ltd.;
[0097] The PCR instrument was purchased from Applied Biosystems, USA;
[0098] NanoDrop One nucleic acid analyzer was purchased from Thermo Fisher Scientific, USA;
[0099] Lightcycler480Ⅱ real-time fluorescence quantitative PCR instrument was purchased from Roche, Switzerland;
[0100] Multiskan GO automatic microplate reader was purchased from Thermo Fisher Scientific, USA;
[0101] The DMi8 inverted fluorescence microscope was purchased from LEICA, Germany.
[0102] Example 1 Screening of differentially expressed circular RNAs in OSCC tissues
[0103] 1. Sample source:
[0104] In this example, OSCC tissues and corresponding adjacent normal mucosal tissues from 8 patients treated at the Department of Oral and Maxillofacial Surgery, Peking University Shenzhen Hospital were collected for screening of differentially expressed circular RNAs.
[0105] All experimental patient samples did not receive other treatments before surgery, and all OSCC cancer tissues were confirmed by rigorous pathological examination. The patients' clinical and pathological characteristics were based on the World Health Organization classification and the UICC TNM classification. Clinical samples were collected after the patients or their families agreed and signed informed consent forms with the approval of the Ethics Committee of Peking University Shenzhen Hospital.
[0106] 2. RNA extraction:
[0107] After obtaining clinical samples during surgery, they were immediately frozen in liquid nitrogen. OSCC tissues and adjacent tissues from 8 patients were ground, and total RNA was extracted using the TRIzol method. The total RNA concentration was measured using a NanoDrop One nucleic acid analyzer.
[0108] 3. Library construction and sequencing:
[0109] 1) After extracting total RNA from each sample, the total RNA was treated with RNase R to degrade linear RNA and purified using the RNeasy MinElute Cleanup Kit (purchased from QIAGEN);
[0110] 2) According to the manufacturer's instructions, VAHTS Total RNA-seq (H / M / R) Library Prep Kit for Illumi na (purchased from Vazyme) was used to remove ribosomal RNA and construct a strand-specific library;
[0111] 3) First, the enriched circRNA is fragmented into short fragments using a fragmentation buffer and reverse transcribed into cDNA using random primers; the second-strand cDNA is synthesized using DNA polymerase I, RNase H, dNTPs (dUTP instead of dTTP), and a buffer;
[0112] 4) Purify the cDNA fragments using VAHTS DNA Clean magnetic beads (purchased from Vazyme), repair the ends, add pol y(A), and ligate to Illumina sequencing adapters. Then, digest the second-strand cDNA with UNG (uracil-N-glycosylase);
[0113] 5) Purify the digestion product using VAHTS DNA Clean magnetic beads;
[0114] 6) The purified product was used as a template for PCR amplification, and high-throughput deep sequencing was performed by Guangzhou Kidio Biotechnology Co., Ltd. using the Illumina HiSeq 2500 sequencing system.
[0115] 4. Quantification of circular RNA abundance:
[0116] The reads obtained from the sequencer include raw reads containing adapters or low quality. In order to quantify high-quality circRNAs, the data of reverse splicing sites were normalized using RPM (Reads Per Million mapped reads); the calculated expression levels can be directly used to compare the differential expression between groups of samples.
[0117] 5. Data Analysis:
[0118] The edgeR software package (https: / / www.bioconductor.org / ) was used to screen for differentially expressed circRNAs in each sample group or between groups, with Fold change ≥ 2 and p-value < 0.05. Furthermore, after comparison and annotation with the circBase database, circATP2B4 was identified as one of the differentially expressed circular RNAs.
[0119] The circBank ID of circATP2B4 is hsa_circATP2B4_017, and the circBase ID is hsa_circ_0007167. Its parent gene is ATPase Plasma Membrane Ca 2+ Transporting 4 (ATP2B4) gene, also known as ATP2B2, MXRA1, PMCA4, PMCA4b, and PMCA4x; this circular RNA is formed by the cyclization of exons 9 and 10 located at chr1:203676136 to chr1:203677232 (its structural diagram is shown in Figure 1 The total length is 458 bp; the specific nucleotide sequence is as follows:
[0120] 5'-GTCTGCTCATGTCTGCTCTCACGGTTTTCATCCTGATTCTATACTTTGTGATTGAC AACTTTGTGATAAAATCGCAGACCATGGCTCCCTGAGTGTACTCCCATCTACATCCAGTACTTTGTCAAGTTCTTCATCATCGGCATCACTGTACTGGTGGTGGCTGTGCCAGAGGGGCTGCCTCTGGCTGTCACCATCTCACTGGCCTACTCTGTGAAGAAAATGATGAAAGACAATAACCTAGTACGGCACTTGGATGCTTGT GAGACCATGGGCAACGCCACCGCCATCTGCTCTGATAAGACAGGCACGTTGACCATGAACCGCATGACTGTGGTACAAGCTTATATTGGGGGCATCCATTACCGTCAAATCCCAAGCCCTGATGTCTTCCTGCCCAAAGTCCTGGACCTCATTGTCAATGGCATTTCTATCAACAGTGCTTATACCTCCAAGATTCTG-3'(SEQ ID NO:1).
[0121] Example 2 Identification of circATP2B4 in OSCC cells
[0122] In this example, total RNA was extracted from HSC3 and HN6 cells using the TRIzol method. cDNA was synthesized using the EvoM-MLV RT Mix Kit with gDNA Clean for qPCR. CircATP 2B4 was amplified in HSC3 and HN6 cells using the high-fidelity PCR polymerase 2× Vazyme Lamp Master Mix (Dye Plus) and a PCR instrument (the amplification primer sequences are shown in Table 1). The reaction mixture was then sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were consistent with the sequences provided by the circBank and circBase databases.
[0123] Table 1 Primer sequences for amplifying circATP2B4
[0124]
[0125]
[0126] Example 3 Detection of relative expression of circATP2B4 in OSCC patient tissue samples and different OSCC cell lines
[0127] 1. Source of clinical tissue samples:
[0128] In this example, based on the World Health Organization's diagnostic criteria for OSCC, cancer tissues and adjacent normal mucosal tissues (no tumor cells) were collected from 12 patients treated at the Department of Oral and Maxillofacial Surgery at Peking University Shenzhen Hospital after approval by the Ethics Committee of Peking University Shenzhen Hospital and written informed consent from the patients or their families. The patient selection criteria were as follows:
[0129] 1) All patients were diagnosed based on histopathological findings;
[0130] 2) All patients had complete follow-up data after surgery;
[0131] 3) All patients underwent thorough primary lesion clearance surgery and selective neck lymph node dissection.
[0132] All patients had not received preoperative chemoradiotherapy and had no history of other systemic diseases, such as rheumatoid arthritis, cardiovascular disease, diabetes, hyperthyroidism, or other tumors. The patients' pathological data are shown in Table 2.
[0133] Table 2 Clinicopathological information of OSCC patients
[0134]
[0135] 2. Total RNA Extraction and Detection of Relative Expression of circATP2B4:
[0136] 1) Liquid nitrogen-frozen OSCC tissues and adjacent adjacent tissues from 12 patients were ground and total RNA was extracted from each tissue using the TRIzol method. Total RNA was also extracted from HSC-3, HN6, and CAL-27 cell lines.
[0137] 2) After measuring the total RNA concentration using a nucleic acid analyzer, cDNA was obtained using the Evo M-MLV RT Mix Kit with gDNA Clean for qPCR.
[0138] 3) SYBR Green Premix Pro Taq HS qPCR Kit II and Lightcycler 480II real-time fluorescence quantitative PCR instrument were used to detect the cycle threshold (Ct) of the reference gene (β-Actin) and circATP2B4 in each sample. -ΔΔCtThe relative expression levels of circATP2B4 in each group of tissue samples and different OSCC cell lines were calculated using the formula; the primer sequences used for qRT-PCR are shown in Table 3; the results obtained by qRT-PCR are shown in Figure 2 and Figure 3 shown.
[0139] Depend on Figure 2 It can be seen that the expression level of circATP2B4 in OSCC cancer tissues was significantly upregulated compared with that in adjacent normal tissues. Figure 3 It can be seen that compared with HOK cells (human oral keratinocytes), the expression level of circATP2B4 was significantly increased in HSC3, CAL27, SCC15 and HN6 cells.
[0140] In addition, the ROC curve was established based on the relative expression levels of circATP2B4 in cancer tissues and adjacent normal tissues of 12 OSCC patients to verify its diagnostic efficacy. Figure 4 shown.
[0141] Depend on Figure 4 It can be seen that the area under the ROC curve was 0.7500 and the p value was 0.0377, indicating that circATP2B4 has a good diagnostic significance for OSCC.
[0142] Table 3 qRT-PCR primer sequences
[0143]
[0144] Example 4 Detection of the effect of circATP2B4 on OSCC cell proliferation, invasion and migration
[0145] 1. Construction of a stable cell line with knockdown of circATP2B4:
[0146] HSC3 and HN6 cells were seeded in cell culture plates, and then polybrene was used to infect HSC3 and HN6 cells with lentivirus containing short hairpin RNA (shRNA) vectors and control vector lentivirus, respectively, to obtain a stable cell line (CircATP2B4) with knockdown of circATP2B4 and a control cell line (Control). The knockdown efficiency of circATP2B4 was detected by qRT-PCR using the primers shown in Table 3 of Example 3. The results are shown in FIG. Figure 5 shown.
[0147] Depend on Figure 5 It can be seen that this example successfully constructed a stable cell line with knockdown of circATP2B4.
[0148] The above-mentioned vectors carrying shRNA include a control vector and a circATP2B4 interference vector, and both vectors used are lentiviral vectors (purchased from Hanbio Biotech (Shanghai) Co., Ltd.).
[0149] The shRNA sequences of the control vector (NC) above include:
[0150] Top strand: 5'-GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC-3' (SEQ ID NO: 8);
[0151] Bottom strand: 5'-AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAGAACG-3' (SEQ ID NO: 9).
[0152] The shRNA sequences of the above-mentioned circATP2B4 interference vector include:
[0153] Top strand: 5'-GATCCGCAAGATTCTGGTCTGCTCACTCGAGTGAGCAGACCAGAATCTTGTTTTTTG-3' (SEQ ID NO: 10);
[0154] Bottom strand: 5'-AATTCAAAAAACAAGATTCTGGTCTGCTCACTCGAGTGAGCAGACCAGAATCTTGCG-3' (SEQ ID NO: 11).
[0155] 2.CCK-8 assay:
[0156] In cell culture plates, control and experimental groups (CircATP2B4) cells were inoculated, and CCK-8 reagent (1:10) was added at 24h, 48h, 72h, and 96h, respectively. After incubation for 1h, the absorbance at 450nm was measured using a microplate reader. Graphpad Prism software was used to plot cell proliferation curves and perform statistical analysis (unpaired t test, p < 0.05 was considered significant). The results are shown in the figure below. Figure 6 and Figure 7 shown.
[0157] Depend on Figure 6 and Figure 7 It can be seen that knockdown of circATP2B4 inhibited the proliferation rate of both OSCC cell lines.
[0158] 3. Scratch and cell migration assays:
[0159] 1) Scratch test:
[0160] In a cell culture plate, cells were inoculated into a control group (Control) and an experimental group (CircATP2B4). When the cell coverage reached 100%, a uniform scratch was made by scraping the tip of the pipette perpendicular to the bottom of the plate. After culturing with serum-free DMEM for a period of time, the migration of cells at the scratch site was observed under a microscope and photographed. The scratch area was calculated using Image J. Cell migration rate (%) = (initial scratch area - scratch area at time t) / initial scratch area × 100%. Graphpad Prism software was used to draw statistical graphs and perform statistical analysis (unpaired t test, p < 0.05 was considered significant); the results are shown in the figure below. Figure 8 and Figure 9 shown.
[0161] 2) Cell migration assay:
[0162] The control group (Control) and experimental group (CircATP2B4) cells suspended in serum-free DMEM were inoculated into permeable cell culture chambers. DMEM containing 10% serum was added to the bottom of the chamber and cultured in an incubator (37°C, 5% CO2) until the cells migrated. The cells were then washed 2-3 times with PBS, fixed with 10% paraformaldehyde, and stained with 1% crystal violet solution. Finally, the dye was rinsed off and the residual dye in the chamber was wiped clean with a cotton swab. The cells were photographed under a microscope and the number of migrated cells was counted using Image J software. Graphpad Prism software was used to draw statistical graphs and perform statistical analysis (unpaired t test, p < 0.05 was considered significant). The results are shown in Figure 2. Figure 10 shown.
[0163] Depend on Figure 8 to Figure 10 It can be seen that knockdown of circATP2B4 inhibited the migration ability of both OSCC cell lines.
[0164] 4. Cell invasion assay:
[0165] Matrigel was added to the bottom of the permeable cell culture chamber. After drying the matrigel, cells of the control group (Control) and experimental group (CircATP2B4) suspended in serum-free DM EM were inoculated respectively. DMEM containing 10% serum was added to the bottom of the chamber. The cells were cultured in an incubator (37°C, 5% CO2) until the cells invaded. The cells were washed 2-3 times with PBS, fixed with 10% paraformaldehyde, and stained with 1% crystal violet solution. Finally, the dye was rinsed off and the residual dye in the chamber was wiped clean with a cotton swab. The cells were photographed under a microscope and the number of migrated cells was counted using Image J software. Graphpad prism software was used to draw statistical graphs and perform statistical analysis (unpaired t test, p < 0.05 was considered significant); the results are shown in the figure. Figure 11 shown.
[0166] Depend on Figure 11 It can be seen that knockdown of circATP2B4 inhibited the invasion ability of the two OSCC cell lines.
[0167] In summary, circATP2B4 expression is tissue-specific and significantly upregulated in tumor tissues and OSCC cells from patients with OSCC. Furthermore, circATP2B4 regulates the proliferation, migration, and invasion of OSCC cells. Therefore, circATP2B4 plays an important regulatory role in the development and progression of OSCC and is expected to become an effective clinical diagnostic marker and targeted therapeutic agent for OSCC.
[0168] Example 5: Validation of the effect of knockdown of circATP2B4 on tumor growth in tumor-bearing mice
[0169] This example used a mouse model to establish subcutaneous tumors and tested the subcutaneous growth of tumor cells with knockdown of circATP2B4. The specific detection method is as follows:
[0170] Four-week-old female NOD-SCID immunodeficient mice (purchased from Guangdong Yaokang Biotechnology Co., Ltd.) were randomly divided into two groups, with 5 mice in each group. HN6 stably transfected cells with knockdown of circATP2B4 (5×10 per mouse) were injected subcutaneously. 6 The cells were resuspended in 100 μL and injected into the abdomen of mice. The tumor growth and mouse body weight were then monitored every 3 days. This animal study was approved by the Experimental Animal Ethics Committee of the Shenzhen Peking University Hong Kong University of Science and Technology Medical Center. The results are shown in the figure below. Figure 12 and Figure 13 shown.
[0171] Depend on Figure 12 and Figure 13It can be seen that 3 weeks after injection, the tumor volume and weight of mice with circATP2B4 knockdown cells were smaller than those in the control group, indicating that knockdown of circATP2B4 can significantly inhibit the proliferation of HN6 cells in vivo.
[0172] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.
Claims
1. Use of a reagent for detecting circATP2B4 in the preparation of a product for diagnosing oral squamous cell carcinoma, characterized in that: The nucleotide sequence of circATP2B4 is shown in SEQ ID NO:
1.
2. The use according to claim 1, characterized in that The reagent for detecting circATP2B4 includes a primer pair for amplifying circATP2B4.
3. The use according to claim 2, characterized in that The primer pair comprises: The primer pair shown in SEQ ID NO: 2-3; or, The primer pair shown in SEQ ID NO:6-7.
4. The use according to claim 1, characterized in that The product also includes nucleic acid extraction reagents and reverse transcription reagents.
5. Oral squamous cell carcinoma risk assessment system, characterized in that: The oral squamous cell carcinoma risk assessment system includes an acquisition module and an assessment module; The acquisition module is used to obtain information on the expression level of circATP2B4 in the subject sample, The evaluation module is used to compare the expression level of circATP2B4 with a threshold value, and indicate whether the subject has squamous cell carcinoma according to the comparison result; The nucleotide sequence of circATP2B4 is shown in SEQ ID NO:
1.
6. The oral squamous cell carcinoma risk assessment system according to claim 5, characterized in that: The oral squamous cell carcinoma risk assessment system further includes a detection module, which is used to detect the expression level of circATP2B4 based on a sample from a subject.
7. Use of substances that inhibit circATP2B4 expression in the preparation of (1) to (2): (1) Drugs for the treatment of oral squamous cell carcinoma; (2) Drugs that inhibit the proliferation, migration, or invasion of oral squamous cell carcinoma cells; The substance that inhibits the expression of circATP2B4 is shRNA; The nucleotide sequences of the sense strand and antisense strand of the shRNA are shown in SEQ ID NO: 10 and SEQ ID NO: 11, respectively.
8. Application of circATP2B4 in constructing a computational model for assessing the risk of oral squamous cell carcinoma, characterized by: The nucleotide sequence of circATP2B4 is shown in SEQ ID NO:
1.
9. The use according to claim 8, characterized in that The computational model uses the expression level of circATP2B4 as an input variable, performs calculations using bioinformatics methods, and outputs the risk of oral squamous cell carcinoma.
Citation Information
Patent Citations
Methods for treating solid tumors and the use of biomarkers as a predictor of clinical sensitivity to immunomodulatory therapies
WO2016060702A1