Gene, primer probe combination and application for identifying species of giant bumblebee

Abstract

The invention provides a gene, a primer probe combination and application for species identification of giant bumblebee, and belongs to the technical field of biology.The gene, the primer probe combination and the application have the advantages that conserved sequence fragment COI genes of giant bumblebee are screened as targets through massive DNA (deoxyribonucleic acid) sequencing and sequence comparative analysis, and optimal primers and specific fluorescent probes are selected; the method has the advantages that double control on a target in a real-time fluorescent PCR reaction process can be realized, the specificity on species identification of the giant bumblebees is very high, cross reaction with other bumblebee species is avoided, and the sensitivity is high and can reach about 2.5 copies / mu L. Compared with a recombinase polymerase isothermal nucleic acid amplification technology, the method has the advantages that the requirement on the length of the real-time fluorescent PCR primer is short, a primer dimer is not easy to generate, the amplification effect is better, and the repeatability is better. Meanwhile, data are collected through real-time fluorescence, the amplification condition of nucleic acid does not need to be detected through electrophoresis, and the whole reaction can be completed within one hour. The operation is simple and fast.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a gene, primer and probe combination and application for identifying bumblebee species. Background Art

[0002] Bumblebees are widely used in greenhouse tomatoes, sweet peppers and other plants for pollination due to their long and dense hair, long beak, sonic pollination, strong adaptability to temperature and climate, strong collection ability and long pollination period. They can increase production, improve quality, save time and effort and improve ecological and environmental benefits. They have become a low-cost, high-efficiency and pollution-free modern high-tech agricultural technology measure. B. terrestris is the most widely used pollinating bee species in the world. Due to its fast reproduction speed and strong adaptability, B. terrestris will cause serious food competition, reproductive interference and epidemics to local bumblebees, resulting in a decrease in the biodiversity of local bumblebees, and even destroying the local ecological balance, resulting in biological invasion.

[0003] Since there are many species of bumblebees and their morphologies are similar, it is impossible to accurately identify the species of bumblebees from a morphological perspective. Therefore, quarantine personnel cannot meet the species identification needs of on-site quarantine of imported bumblebees based solely on morphological methods, and there is a risk of the influx of harmful foreign organisms. In view of this, a method for accurately identifying B. terrestris is urgently needed to study and develop primer-probe combinations and detection methods for identifying terrestris species, which can be used for species identification of B. terrestris and its identification from other bumblebees, to prevent the introduction of foreign harmful organisms and cause biological invasions. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a gene, primer probe combination and application for identifying bumblebee species.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] A COI gene for identifying bumblebees, the nucleotide sequence of the COI gene is shown as SEQ ID No. 1.

[0007] The present invention provides a primer-probe combination for identifying ground bumblebees, the primer-probe combination comprising a primer pair and a probe;

[0008] The primer pair is used for specific amplification of the COI gene, and comprises a forward primer B. terrestris -F and a reverse primer B. terrestris -R;

[0009] The nucleotide sequence of the forward primer B. terrestris-F is shown in SEQ ID No. 2;

[0010] The nucleotide sequence of the reverse primer B. terrestris-R is shown in SEQ ID No.3.

[0011] Preferably, the probe is a fluorescent probe B. terrestris-P;

[0012] The nucleotide sequence of the fluorescent probe B. terrestris-P is shown in SEQ ID No.4.

[0013] Preferably, the 5' end of the fluorescent probe B. terrestris-P is labeled with a fluorescent group, and the 3' end is labeled with a quenching group;

[0014] The fluorescent group includes FAM, 6-FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705 or Texas Red;

[0015] The quenching group includes TAMRA, BHQ1, BHQ2, BHQ3, MGB or Dabcy1.

[0016] The present invention provides application of the primer-probe combination in preparing a product for identifying bumblebees.

[0017] The present invention provides a kit for identifying ground bumblebees, the kit comprising the primer-probe combination, Taq DNA polymerase, dNTP, PCR buffer, Mg 2+ .

[0018] The present invention provides a method for identifying bumblebees, comprising the following steps:

[0019] (1) Extracting DNA from the sample to be tested;

[0020] (2) using the primer-probe combination to perform PCR amplification on the DNA of the sample to be tested to obtain a PCR amplification product;

[0021] (3) determining whether the sample to be tested contains the COI gene based on the PCR amplification product, thereby determining whether the sample to be tested is a ground bumblebee or whether the bee colony from which the sample to be tested originates contains a ground bumblebee;

[0022] The COI gene is the COI gene;

[0023] The samples to be tested include individual bees, beehives or honey.

[0024] Preferably, the reaction system of the PCR amplification in step (2) is 2×PCR buffer 8-12 μL, MgCl2 1.0-3.0 μL, dNTPs 0.5-3.0 μL, primer B.terrestris-F 0.2-1.0 μL, primer B.terrestris-R 0.2-1.0 μL, probe B.terrestris-P 0.1-0.6 μL, DNA polymerase 0.3-0.7 μL, sample DNA to be tested 1.0-3.0 μL, ddH2O 2.0-3.0 μL;

[0025] The initial concentration of the MgCl2 is 20 to 30 mmol / L; the initial concentration of the dNTPs is 2.0 to 3.0 mmol / L; the initial concentration of the forward primer B.terrestris-F is 5 to 15 μmol / L; the initial concentration of the reverse primer B.terrestris-R is 5 to 15 μmol / L; the initial concentration of the fluorescent probe B.terrestris-P is 5 to 15 μmol / L; and the initial concentration of the DNA polymerase is 4 to 6 U / μL.

[0026] Preferably, the reaction procedure of the PCR amplification is pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 55-65°C for 30 s, for a total of 40 cycles.

[0027] Preferably, the determination method in step (3) is any one of the following methods:

[0028] S1. Determine the PCR amplification product. If the amplification product contains the COI gene, it is determined that the sample to be tested is a ground bumblebee or the bee colony from which the sample to be tested originates contains a ground bumblebee; if the amplification product does not contain the COI gene, it is determined that the sample to be tested is not a ground bumblebee or the bee colony from which the sample to be tested originates does not contain a ground bumblebee;

[0029] S2. Determine the amplification curve of the PCR amplification product. If the amplification curve is an S-shaped curve, it is determined that the sample to be tested is a ground bumblebee or the bee colony from which the sample to be tested originates contains a ground bumblebee; if the amplification curve is not an S-shaped curve, it is determined that the sample to be tested is not a ground bumblebee or the bee colony from which the sample to be tested originates does not contain a ground bumblebee;

[0030] S3. Determine the Ct value of the PCR amplification product. If the Ct value is ≤35, it is determined that the sample to be tested is a ground bumblebee or the bee colony from which the sample to be tested comes contains ground bumblebees; if the Ct value is >35, it is determined that the sample to be tested is not a ground bumblebee or the bee colony from which the sample to be tested comes does not contain ground bumblebees.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] The present invention screens the conservative sequence fragments of ground bumblebees as the target through a large amount of DNA sequencing and sequence comparison analysis, selects the best primers after comparing multiple sets of primers, and designs and screens a specific fluorescent probe, which can perform dual control on the target during the real-time fluorescent PCR reaction process, has a very strong species identification specificity for ground bumblebees, has no cross reaction with other bumblebee species, and has high sensitivity, which can reach about 2.5 copies / μL. Compared with the recombinase polymerase isothermal nucleic acid amplification technology, the real-time fluorescent PCR primer length requirement is short, primer dimers are not easily generated, the amplification effect is better, and has good repeatability. At the same time, real-time fluorescence data is collected, and there is no need to perform electrophoresis to detect the amplification of nucleic acids, and the entire reaction can be completed within 1 hour. The operation is simple and fast. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the optimization result of real-time fluorescence PCR annealing temperature.

[0034] Figure 2 This is a diagram showing the optimization results of the real-time fluorescence PCR reaction system.

[0035] Figure 3 This is a sensitivity test chart, where 1 to 8 represent the concentration of the plasmid DNA standard of 2.5×10 7 Copies / μL~2.5×10 0 copies / μL.

[0036] Figure 4 It is a standard curve graph.

[0037] Figure 5 This is a graph showing the determination of the Ct value.

[0038] Figure 6 This is a graph showing specificity test results. DETAILED DESCRIPTION

[0039] A COI gene for identifying bumblebees, wherein the nucleotide sequence of the COI gene is shown in SEQ ID No. 1:

[0040] SEQ ID No.1:

[0041] accagtattagccggtgcaattactatattattatttgatcgaaattttaatacttcattttttgacccaataggagga ggagacccaatcctttatcaacatttattttgattttttggccacccagaagtata.

[0042] The present invention provides a primer-probe combination for identifying ground bumblebees, the primer-probe combination comprising a primer pair and a probe;

[0043] The primer pair is used for specific amplification of the COI gene, and comprises a forward primer B. terrestris -F and a reverse primer B. terrestris -R;

[0044] The nucleotide sequence of the forward primer B. terrestris-F is shown in SEQ ID No. 2:

[0045] SEQ ID No.2: ACCAGTATTAGCCGGTGCAA;

[0046] The nucleotide sequence of the reverse primer B. terrestris-R is shown in SEQ ID No. 3:

[0047] SEQ ID No. 3: TATACTTCTGGGTGGCCAAA.

[0048] In the present invention, the probe is the fluorescent probe B. terrestris-P;

[0049] The nucleotide sequence of the fluorescent probe B. terrestris-P is shown in SEQ ID No. 4:

[0050] TGGGTCTCCTCCTCCTATTGGGTCA.

[0051] In the present invention, the 5' end of the fluorescent probe B. terrestris-P is labeled with a fluorescent group, and the 3' end is labeled with a quenching group;

[0052] The fluorescent group preferably includes FAM, 6-FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705 or Texas Red, and is further preferably EAM;

[0053] The quenching group preferably includes TAMRA, BHQ1, BHQ2, BHQ3, MGB or Dabcy1, and more preferably BAQ1.

[0054] The present invention provides an application of the primer-probe combination in the preparation of a product for identifying ground bumblebees, which can stably and accurately identify whether a sample is a ground bumblebee or whether a bee colony contains a ground bumblebee.

[0055] The present invention provides a kit for identifying bumblebees, wherein the kit preferably comprises the primer-probe combination, Taq DNA polymerase, dNTP, PCR buffer, Mg 2+ .

[0056] The present invention provides a method for identifying bumblebees, comprising the following steps:

[0057] (1) Extracting DNA from the sample to be tested;

[0058] (2) using the primer-probe combination to perform PCR amplification on the DNA of the sample to be tested to obtain a PCR amplification product;

[0059] (3) determining whether the sample to be tested contains the COI gene based on the PCR amplification product, thereby determining whether the sample to be tested is a ground bumblebee or whether the bee colony from which the sample to be tested originates contains a ground bumblebee;

[0060] The COI gene is the COI gene;

[0061] The sample to be tested preferably includes individual bees, beehives or honey. The beehives or honey are produced by bee colonies and contain gene fragments of the bee colonies. By screening the beehives and honey, it can be determined whether the bee colonies contain bumblebees.

[0062] In the present invention, the reaction system of the PCR amplification in step (2) is:

[0063] 2×PCR buffer is preferably added in an amount of 8 to 12 μL, more preferably 9 to 11 μL, and even more preferably 10 μL;

[0064] MgCl2 is preferably added in an amount of 1.0 to 3.0 μL, more preferably 1.5 to 2.5 μL, and even more preferably 2 μL;

[0065] dNTPs are preferably added in an amount of 0.5 to 3.0 μL, more preferably 1.0 to 2.0 μL, and even more preferably 1.5 μL;

[0066] The primer B. terrestris-F is preferably added in an amount of 0.2 to 1.0 μL, more preferably 0.5 to 0.8 μL, and even more preferably 0.6 μL;

[0067] The primer B. terrestris-R is preferably added in an amount of 0.2 to 1.0 μL, more preferably 0.5 to 0.8 μL, and even more preferably 0.6 μL;

[0068] The probe B. terrestris-P is preferably added in an amount of 0.1 to 0.6 μL, more preferably 0.3 to 0.5 μL, and even more preferably 0.4 μL;

[0069] The DNA polymerase is preferably added in an amount of 0.3 to 0.7 μL, more preferably 0.4 to 0.6 μL, and even more preferably 0.5 μL;

[0070] The sample DNA to be tested is preferably added in an amount of 1.0 to 3.0 μL, more preferably 1.5 to 2.5 μL, and even more preferably 2.0 μL;

[0071] ddH2O is preferably added in an amount of 2.0 to 3.0 μL, more preferably 2.2 to 2.8 μL, and even more preferably 2.4 μL;

[0072] The initial concentration of MgCl2 is preferably 20-30 mmol / L, more preferably 22-28 mmol / L, and more preferably 25 mmol / L; the initial concentration of dNTPs is preferably 2.0-3.0 mmol / L, more preferably 2.2-2.8 mmol / L, and more preferably 2.5 mmol / L; the initial concentration of the forward primer B. terrestris-F is 5-15 μmol / L, more preferably 8-12 μmol / L, and more preferably 10 μmol / L. L; the initial concentration of the reverse primer B.terrestris-R is 5-15 μmol / L, further preferably 8-12 μmol / L, further preferably 10 μmol / L; the initial concentration of the fluorescent probe B.terrestris-P is 5-15 μmol / L, further preferably 8-12 μmol / L, further preferably 10 μmol / L; the initial concentration of the DNA polymerase is 4-6 U / μL, further preferably 4.5-5.5 U / μL, further preferably 5 U / μL.

[0073] In the present invention, the reaction procedure of the PCR amplification is 95° C. pre-denaturation for 5 min; 95° C. denaturation for 15 s, 55-65° C. annealing for 30 s, for a total of 40 cycles.

[0074] In the present invention, the annealing temperature is preferably 55 to 65°C, more preferably 57 to 62°C, and even more preferably 59°C.

[0075] In the present invention, the determination method in step (3) is any one of the following methods:

[0076] S1. Determine the PCR amplification product. If the amplification product contains the COI gene, it is determined that the sample to be tested is a ground bumblebee or the bee colony from which the sample to be tested originates contains a ground bumblebee; if the amplification product does not contain the COI gene, it is determined that the sample to be tested is not a ground bumblebee or the bee colony from which the sample to be tested originates does not contain a ground bumblebee;

[0077] S2. Determine the amplification curve of the PCR amplification product. If the amplification curve is an S-shaped curve, it is determined that the sample to be tested is a ground bumblebee or the bee colony from which the sample to be tested originates contains a ground bumblebee; if the amplification curve is not an S-shaped curve, it is determined that the sample to be tested is not a ground bumblebee or the bee colony from which the sample to be tested originates does not contain a ground bumblebee;

[0078] S3. Determine the Ct value of the PCR amplification product. If the Ct value is ≤35, it is determined that the sample to be tested is a ground bumblebee or the bee colony from which the sample to be tested comes contains ground bumblebees; if the Ct value is >35, it is determined that the sample to be tested is not a ground bumblebee or the bee colony from which the sample to be tested comes does not contain ground bumblebees.

[0079] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0080] Sources:

[0081] pUC57 vector was purchased from Fuzhou Boshang Biotechnology Co., Ltd.;

[0082] 2×PCR buffer was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0083] Example 1 Design of primers and probes

[0084] In this embodiment, the DNA sequence of Bombus terrestris registered in GenBank (accession number MT175101.1) is used for BLAST comparison to screen the conservative nucleic acid sequence as the target. The highly conserved region screened is the COI gene, and the nucleotide sequence of the COI gene is SEQ ID No.1. The present invention uses the recombinant vector pUC57-B.terrestris carrying the COI gene as a test sample (i.e., a plasmid standard). The recombinant vector pUC57-B.terrestris is a recombinant vector obtained by replacing the fragment between the NruI and ApaI restriction endonuclease recognition sites of the pUC57 vector with the DNA fragment shown in SEQ ID No.1 in the sequence table, while keeping the other nucleotide sequences of the pUC57 vector unchanged.

[0085] A specific primer pair and probe for detecting ground bumblebees are designed for the highly conserved COI gene of the screened ground bumblebees. The designed primer pair consists of primer B.terrestris-F and primer B.terrestris-R, wherein the primer B.terrestris-F is a single-stranded DNA molecule shown in SEQ ID No.2; the primer B.terrestris-R is a single-stranded DNA molecule shown in SEQ ID No.3, and the primer pair can be used to specifically amplify the COI gene. The designed probe for specifically recognizing the COI gene is a TaqMan probe named B.terrestris-P, the nucleotide sequence of the probe B.terrestris-P is SEQ ID No.4, the 5' end of the probe B.terrestris-P is labeled with FAM, and the 3' end is labeled with BHQ1.

[0086] Example 2 Optimization of real-time fluorescence PCR annealing temperature

[0087] The COI gene in the highly conserved region of Bombus terrestris was used as a template, and PCR amplification was performed using the primers B. terrestris -F and primer B. terrestris -R prepared in Example 1. The real-time fluorescence PCR reaction system was: 2×PCR buffer 10 μL, 25 mmol / LMgCl2 2.0 μL, 2.5 mmol / L dNTPs 1.5 μL, 10 μmol / L upstream and downstream primers 0.8 μL each, 10 μmol / L probe 0.8 μL, 5 U / μL DNA polymerase 0.5 μL, and 2.0 μL of the sample DNA to be tested. Then, ddH2O 1.6 μL was added to make the total reaction volume 20.0 μL.

[0088] The real-time fluorescence PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing temperature was set to 8 gradient temperatures, the gradient temperatures were 55°C, 55.7°C, 57°C, 59°C, 61.4°C, 63.3°C, 64.5°C, 65°C, reaction, annealing extension for 30 s, each gradient temperature was set to 3 repetitions, for a total of 40 cycles;

[0089] The annealing temperature of real-time fluorescence PCR identification of Bombus terrestris was optimized according to the above method. Figure 1 shown.

[0090] Figure 1 The results showed that when the annealing temperature was 59°C, the Ct value was the smallest, the fluorescence intensity was high, and the amplification curve was a typical "S" shape. On the basis of maintaining the amplification efficiency, a higher annealing temperature was selected to improve the specificity, so the optimal annealing temperature was selected as 59°C. ( Figure 1 There are three lines for each temperature, and there will be overlap, so one curve is selected for each gradient temperature).

[0091] Example 3 Optimization of real-time fluorescence PCR reaction system

[0092] According to the lowest CT value, higher fluorescence intensity increase value and amplification curve morphology and the principle of economy, the real-time fluorescence PCR reaction system was optimized according to the reaction procedure optimized in Example 2. The amounts of other reagents in the reaction system remained unchanged, and the final concentrations of upstream and downstream primers (0.2 μmol / L to 1.0 μmol / L) and the final concentration of the probe (0.1 μmol / L to 0.5 μmol / L) were optimized and selected by using a square array ratio test.

[0093] The reaction system of real-time fluorescence PCR identification of bumblebees was optimized according to the above method. Figure 2 shown.

[0094] Figure 2 It shows that when the content of B.terrestris-F / R (10μmol / L) in the reaction system is 0.6μL (final concentration is 0.3μmol / L) and the content of B.terrestris-P (10μmol / L) is 0.4μL (final concentration is 0.2μmol / L), the Ct value, fluorescence intensity and amplification curve morphology can all reach an ideal state, so the real-time fluorescence PCR reaction system is selected as follows: 2×PCR buffer 10μL, 25mmol / L MgCl2 2.0μL, 2.5mmol / L dNTPs 1.5μL, 10μmol / L upstream and downstream primers 0.6μL each, 10μmol / L probe 0.4μL, 5U / μL DNA polymerase 0.5μL, test sample DNA 2.0μL, and then add ddH2O 2.4μL.

[0095] Example 4 Establishment of real-time fluorescence PCR identification method

[0096] 1) Prepare plasmid standards according to the highly conserved COI gene selected in Example 1. The construction method is as follows: using the DNA of ground bumblebee as a template, PCR amplification is performed according to the self-designed primers B.terrestris-F / R, the reaction system: 2×Taq PCR mix 12.5μL, upstream and downstream primers B.terrestris-F / R 1.0μL each, template DNA 2.0μL, ddH2O supplemented 25μL; reaction conditions: 94℃ pre-denaturation 5min; 94℃ denaturation 45s, 55℃ annealing 30s, 72℃ extension 45s, a total of 35 cycles; 72℃ 10min. After the reaction, the product was identified by 2.0% agarose gel electrophoresis, the target fragment was recovered by DNA gel recovery kit, cloned into pUC57 vector, transformed into DH5α, cloned into LB liquid culture medium containing ampicillin, cultured at 37℃ for 8h, and the recombinant plasmid was extracted with a plasmid extraction kit and sequenced. The recombinant plasmid with the correct sequencing result was used as a positive standard.

[0097] The constructed plasmid standard is named pUC57-B.terrestris. The recombinant plasmid pUC57-B.terrestris is a recombinant vector obtained by replacing the fragment between the NruI and ApaI restriction endonuclease recognition sites of the pUC57 vector with the DNA fragment shown in SEQ ID No. 1 in the sequence table, while keeping the other nucleotide sequences of the pUC57 vector unchanged.

[0098] 2) Extract DNA from the sample to be tested

[0099] The genomic DNA of the sample to be tested was extracted using a genomic DNA extraction kit, and the extraction method was based on the kit instructions.

[0100] 3) Real-time fluorescence PCR identification method

[0101] Using the DNA extracted in step 2) as a template, the primers B.terrestris-F, primer B.terrestris-R and probe B.terrestris-P designed in Example 1 were used to perform real-time fluorescent PCR amplification reaction on the sample to be tested, wherein:

[0102] The real-time fluorescence PCR reaction system was: 2×PCR buffer 10μL, 25mmol / LMgCl22.0μL, 2.5mmol / LdNTPs 1.5μL, 10μmol / L upstream and downstream primers 0.6μL each, 10μmol / L probe 0.4μL, 5U / μL DNA polymerase 0.5μL, test sample DNA 2.0μL, and then ddH2O 2.4μL was added.

[0103] The real-time fluorescence PCR reaction program was: 95°C pre-denaturation for 5 min; 95°C denaturation for 15 s, 59°C annealing for 30 s, for a total of 40 cycles. Single-point fluorescence detection was performed at 59°C.

[0104] The negative control was sterile water.

[0105] The positive control was plasmid pUC57-B. terrestris.

[0106] 4) Result determination

[0107] Determine whether the sample to be tested is a ground bumblebee or whether the bee colony contains a ground bumblebee based on the PCR amplification product in step 3). The specific criteria for determining the test results are:

[0108] If the experiment is valid, the sample to be tested has no Ct value and no amplification curve, indicating that the sample to be tested is not a ground bumblebee or the bee colony from which the sample to be tested comes does not contain a ground bumblebee; if the Ct value of the sample to be tested is ≤35 and a typical amplification curve appears, it means that the sample to be tested is a ground bumblebee or the bee colony from which the sample to be tested comes contains a ground bumblebee; if the Ct value of the sample to be tested is >35, the sample is tested repeatedly, and if the repeated test results have no Ct value or the Ct value is >35, the sample is not a ground bumblebee or the bee colony from which the sample to be tested comes does not contain a ground bumblebee; if the repeated test results have a Ct value and the Ct value is ≤35, the sample is a ground bumblebee or the bee colony from which the sample to be tested comes contains a ground bumblebee;

[0109] The experiment is effective when: the negative control has no Ct value and no amplification curve, while the positive control Ct value is ≤35 and a typical amplification curve appears, indicating that the experiment is effective.

[0110] Example 5 Sensitivity Experiment

[0111] The plasmid standard containing the Bombus terrestris COI gene prepared in step 1) of Example 4 was diluted 10 times with sterile water to 2.5×10 7 Copies / μL~2.5×10 0 Plasmid DNA standards at copies / μL concentration.

[0112] The diluted plasmid DNA standard of different concentrations was used as a template, and each concentration of the plasmid DNA standard was treated 3 times, and other bumblebee tissue DNA was used as a control, and sterile water was used as a blank control. Real-time fluorescence PCR identification was performed according to the detection method of step 3) of Example 4. Figure 3 The amplification curves shown were used to test the sensitivity and Figure 4 The standard curve for Bombus terrestris is shown.

[0113] from Figure 3 It can be seen that this method can detect a minimum of about 2.5 copies / μL of Bombus terrestris DNA template. Figure 4 The regression equation of the constructed standard curve is Y = -3.281x + 35.018; R represents the correlation coefficient, and the determination coefficient R 2 The value of the real-time fluorescence PCR identification method is 1.000, and the amplification efficiency is 101.8%. The results show that the real-time fluorescence PCR identification method of the present invention has high sensitivity.

[0114] Example 6 Determination of Ct value

[0115] The standard plasmid was prepared at 2.5 copies / μL (i.e., 2.5×10 0 The plasmid DNA standard with a concentration of 2.5 copies / μL was used as the starting concentration, and three dilutions were obtained with concentrations of 2.5 copies / μL, 1.25 copies / μL, and 0.625 copies / μL. The plasmid standard with these three dilutions was used as a template, and real-time fluorescence PCR identification was performed according to the detection method of step 3) of Example 4. The detection results are shown in FIG. Figure 5 shown.

[0116] Figure 5 The results showed that when the template concentration was 2.5 copies / μL, amplification occurred in all four replicate tubes, with an average Ct value of 34.991; when the template concentration was 1.25 copies / μL, there was one amplification curve, and no amplification curve appeared in the other three replicate tubes; when the template concentration was 0.625 copies / μL, no amplification curve appeared, so the positive judgment Ct value of this method was determined to be 35.

[0117] Example 7 Specificity Experiment

[0118] Seven common bee species, namely, Bombus terrestris, Bombus rubrum, Bombus brachycephalus, Bombus lanzhouensis, Bombus flamingo, Apis mellifera, and Apis mellifera, were used as samples. DNA was extracted according to the method of step 2) of Example 4, and then real-time fluorescence PCR identification was performed using the detection method of step 3) of Example 4. The result determination method of step 4) of Example 4 was also used for determination. The detection results are shown in FIG. Figure 6 shown.

[0119] Depend on Figure 6 It can be seen that only the ground bumblebee produced a typical amplification curve (Ct value was 17.981), and other bee species had no amplification curve, indicating that the real-time fluorescent PCR identification method of the present invention has good specificity.

[0120] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A COI gene for identifying bumblebees, characterized in that: The nucleotide sequence of the COI gene is shown in SEQ ID No.

1.

2. A primer-probe combination for identifying bumblebees, characterized in that: The primer-probe combination comprises a primer pair and a probe; The primer pair is used for specifically amplifying the COI gene according to claim 1, and comprises a forward primer B. terrestris -F and a reverse primer B. terrestris -R; The nucleotide sequence of the forward primer B. terrestris-F is shown in SEQ ID No. 2; The nucleotide sequence of the reverse primer B. terrestris-R is shown in SEQ ID No.

3.

3. The primer-probe combination according to claim 2, characterized in that: The probe is the fluorescent probe B. terrestris-P; The nucleotide sequence of the fluorescent probe B. terrestris-P is shown in SEQ ID No.

4.

4. The primer-probe combination according to claim 3, characterized in that: The 5' end of the fluorescent probe B. terrestris-P is labeled with a fluorescent group, and the 3' end is labeled with a quenching group; The fluorescent group includes FAM, 6-FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705 or Texas Red; The quenching group includes TAMRA, BHQ1, BHQ2, BHQ3, MGB or Dabcy1.

5. Use of the primer-probe combination according to any one of claims 2 to 4 in the preparation of a product for identifying bumblebees.

6. A kit for identifying bumblebees, characterized in that: The kit comprises the primer-probe combination according to any one of claims 2 to 4, Taq DNA polymerase, dNTP, PCR buffer, Mg 2+ .

7. A method for identifying bumblebees, characterized in that: The steps include: (1) Extracting DNA from the sample to be tested; (2) using the primer-probe combination to perform PCR amplification on the DNA of the sample to be tested to obtain a PCR amplification product; (3) determining whether the sample to be tested contains the COI gene based on the PCR amplification product, thereby determining whether the sample to be tested is a ground bumblebee or whether the bee colony from which the sample to be tested originates contains a ground bumblebee; The primer-probe combination is the primer-probe combination according to any one of claims 2 to 4; The COI gene is the COI gene according to claim 1; The samples to be tested include individual bees, beehives or honey.

8. The method according to claim 7, characterized in that The reaction system of the PCR amplification in step (2) is 2×PCR buffer 8-12 μL, MgCl2 1.0-3.0 μL, dNTPs 0.5-3.0 μL, primer B.terrestris-F 0.2-1.0 μL, primer B.terrestris-R 0.2-1.0 μL, probe B.terrestris-P 0.1-0.6 μL, DNA polymerase 0.3-0.7 μL, sample DNA to be tested 1.0-3.0 μL, and ddH2O 2.0-3.0 μL; The initial concentration of the MgCl2 is 20 to 30 mmol / L; the initial concentration of the dNTPs is 2.0 to 3.0 mmol / L; the initial concentration of the forward primer B.terrestris-F is 5 to 15 μmol / L; the initial concentration of the reverse primer B.terrestris-R is 5 to 15 μmol / L; the initial concentration of the fluorescent probe B.terrestris-P is 5 to 15 μmol / L; and the initial concentration of the DNA polymerase is 4 to 6 U / μL.

9. The method according to claim 8, characterized in that The reaction procedure of the PCR amplification is 95° C. pre-denaturation for 5 min; 95° C. denaturation for 15 s, 55-65° C. annealing for 30 s, for a total of 40 cycles.

10. The method according to claim 7, characterized in that The determination method in step (3) is any one of the following methods: S1. Determine the PCR amplification product. If the amplification product contains the COI gene, it is determined that the sample to be tested is a ground bumblebee or the bee colony from which the sample to be tested originates contains a ground bumblebee; if the amplification product does not contain the COI gene, it is determined that the sample to be tested is not a ground bumblebee or the bee colony from which the sample to be tested originates does not contain a ground bumblebee; S2. Determine the amplification curve of the PCR amplification product. If the amplification curve is an S-shaped curve, it is determined that the sample to be tested is a ground bumblebee or the bee colony from which the sample to be tested originates contains a ground bumblebee; if the amplification curve is not an S-shaped curve, it is determined that the sample to be tested is not a ground bumblebee or the bee colony from which the sample to be tested originates does not contain a ground bumblebee; S3. Determine the Ct value of the PCR amplification product. If the Ct value is ≤35, it is determined that the sample to be tested is a ground bumblebee or the bee colony from which the sample to be tested comes contains ground bumblebees; if the Ct value is >35, it is determined that the sample to be tested is not a ground bumblebee or the bee colony from which the sample to be tested comes does not contain ground bumblebees.

Images