A method, probe and kit for DNA single nucleotide variation detection and application thereof
By combining rapid heating and unwinding with cooling, along with a DNA equilibrium probe and a fluorescently labeled reporter probe, the complexity and high cost of DNA single nucleotide variant detection in existing technologies are solved, achieving efficient and accurate single nucleotide variant detection.
Patent Information
- Application Number
- CN202080105561.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2020-09-30
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2040-09-30
AI Technical Summary
Existing DNA single nucleotide variant detection technologies suffer from problems such as complex operation, insufficient sensitivity, low detection throughput, and large DNA sample requirements, making it difficult to achieve high accuracy, simple operation, and low cost detection.
A rapid heating-unwinding and cooling method, combined with a DNA equilibrium probe and a fluorescently labeled reporter probe, is used to detect single nucleotide variants in single-stranded DNA via fluorescence signals. This combination of DNA equilibrium probes and reporter probes enables efficient detection of single nucleotide variants.
It achieves high accuracy, simple operation and low cost DNA single nucleotide variant detection, can detect multiple variant sites at the same time, is suitable for targets of different lengths, and improves detection efficiency and sensitivity.
Smart Images

Figure CN116724124B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection technology, specifically to a method, probe, and kit for detecting single nucleotide variants in DNA and their applications. Background Technology
[0002] Single nucleotide variations (SNVs) have garnered significant attention due to their association with disease susceptibility, drug response variability, human evolution, and population diversity. An SNV is a variation of a single nucleotide in the genome, including substitutions, transversions, deletions, and insertions. If an SNV is located in a coding region, it may affect the encoded amino acid, thus influencing protein function. Generally, SNVs with a frequency of less than 1% in the population are called point mutations, while SNVs with a frequency of 1% or higher are called SNPs. Currently, the number of human genome SNP sites stored in dbSNP exceeds 9 million.
[0003] SNVs have the following advantages as genetic markers: (1) SNVs are diallelic in the population, and their allele frequencies can be estimated in any population; (2) They are widely distributed in the genome; (3) Compared with tandem repeat microsatellite loci, SNVs are highly stable, especially SNVs located in coding regions, while the high mutation rate of the former can easily cause difficulties in genetic analysis of the population; (4) Some SNVs located inside genes may directly affect the structure of the product protein or the gene expression level, so they themselves may be candidate alteration sites for the genetic mechanism of diseases; (5) They are easy to automate, shortening the research time. Due to the above advantages, SNVs have important application value in molecular diagnostics, clinical testing, forensic medicine, pathogen detection, drug efficacy evaluation, new drug development and population evolution.
[0004] Currently, traditional techniques for detecting SNVs are mainly based on four basic principles: restriction enzyme digestion, allele-specific hybridization, primer extension, and oligonucleotide ligation.
[0005] Enzyme digestion-based detection methods:
[0006] This includes techniques such as restriction endonuclease fragment length polymorphism (SNP) and primer invasion analysis. Restriction endonucleases are enzymes that recognize specific sites on DNA and cleave it at those sites. This technique requires that the SNP site to be detected contain restriction endonuclease recognition sequences flanking it. This method is simple, rapid, and can analyze large numbers of samples. Its disadvantages include the inability to directly analyze the DNA sequence, and the fact that nearly half of the SNP sites do not result in changes to the restriction enzyme cleavage site.
[0007] Detection methods based on allele-specific hybridization:
[0008] The reaction principle is based on the complementary pairing of bases. In hybridization, probes are designed targeting the mutation site and flanking sequences. Typically, probes differ by only one base, each corresponding to a different allele. After processing, all sequence-specific oligonucleotide probes are spotted onto solid or liquid carriers such as nylon membranes, glass slides, or silicon wafers, and hybridized with the DNA template to be detected. SNV typing is performed based on the detected signal. This method includes DNA microarray detection technology, TaqMan probe technology, allele-specific oligonucleotide hybridization, and molecular beacon technology. This method has high specificity and sensitivity and can be used for gene diagnosis and screening of genetic diseases with gene mutations. It is particularly valuable in screening for fixed-point mutations, such as the p53 gene and human breast cancer gene 1 and 2 mutation hotspots. However, the defect of the gene to be tested must be known to synthesize targeted oligonucleotide probes, and the typing cost is relatively high.
[0009] Detection methods based on primer extension:
[0010] The principle of this method is to first amplify a DNA segment containing the variant site, then anneal an oligonucleotide primer directly upstream or downstream of the base to be detected. Extension of one or more bases is achieved by adding different fluorescently labeled dNTPs or ddNTPs, and the site information is determined based on the extension signal. Key techniques include single-base extension and pyrolysis sequencing. The advantages of this method are high sensitivity and resolution, but its disadvantages include the need for a multicolor fluorescence system and corresponding detection system, and the fact that the excitation and emission spectra of various dyes often overlap significantly, interfering with the accuracy of fluorescence intensity measurement.
[0011] Detection methods based on oligonucleotide ligation reactions:
[0012] Two adjacent oligonucleotide sequences anneal to the template and will only ligate together under the action of ligase if they perfectly match the template at the junction. Therefore, allele-specific oligonucleotide ligation technology can explore the nature of single-base variation sites. Oligonucleotide ligation analysis was established by Samiotaki et al. in 1994. Its principle is to denature the PCR product into a single strand and then add two probes, A and B (approximately 20 nucleotides long). The sequences of A and B are complementary to the sequences flanking the variation site in the target DNA, with the 5' end of A adjacent to the 3' end of B. If the two adjacent probes bind to the target DNA single strand with perfect complementarity, the 5' phosphate group and 3' hydroxyl group of the two probes form a phosphodiester bond under the action of DNA ligase, thus linking them together.
[0013] If a mismatched base exists at the 3' end of probe B, the ligation reaction will not occur. After denaturation, the ligation product can be used as a template for primers. The denaturation-annealing-ligation cycle is repeated, and the signal is measured using specialized methods to determine whether a ligation reaction has occurred. This signal serves as the basis for determining whether there are base changes in the template DNA single strand. The advantages of oligonucleotide ligation analysis are that it requires only 1 / 10 the amount of DNA sample commonly used to evaluate the internal DNA sequence, and the detection results are not affected by non-specific products in PCR amplification. Furthermore, the results can be directly transferred to a computer for storage and statistical analysis, enabling automated detection and significantly improving efficiency. The disadvantages are that the location of the mutation site must be known to synthesize a targeted probe, and when multiple sites are present, multiple probes need to be synthesized for detection.
[0014] The aforementioned endonuclease digestion, allele-specific hybridization, primer extension, and oligonucleotide ligation techniques have drawbacks such as complex procedures, insufficient sensitivity, low throughput, or large DNA sample requirements. An ideal detection method should possess high accuracy, ease of operation, high throughput, and low cost. Therefore, exploring and establishing efficient and low-cost detection methods for SNVs remains essential. Summary of the Invention
[0015] To overcome the shortcomings of existing technologies, this invention provides a method for detecting single nucleotide variants in DNA, comprising:
[0016] The DNA to be tested is mixed with the reaction system, heated to decompose, then rapidly cooled, and detected.
[0017] In this test, the two strands of the DNA to be tested are designated as strand A and strand B, with the strand to be tested being strand A.
[0018] Specifically, the heating and unwinding temperature is 80-99°C (e.g., 80, 82, 84, 86, 88, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99°C); in one embodiment of the present invention, the temperature is 95°C.
[0019] Specifically, the heating time is 1-10 minutes (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 minutes); in one embodiment of the present invention, the time is 5 minutes.
[0020] Specifically, the rapid cooling described above can be cooling to 0-4°C (e.g., 0, 1, 2, 3, 4 or 5 minutes) within 1-5 minutes; in one embodiment of the present invention, the rapid cooling described above is cooling to 4°C within 2 minutes.
[0021] Specifically, the above tests are performed within 2 hours after rapid cooling (e.g., within 2 hours, 1 hour, 30 minutes, 15 minutes, 5 minutes).
[0022] Specifically, the above reaction system includes: n DNA equalizer probes (DEPs):
[0023] DEP-1, ..., DEP-n;
[0024] Where n is an integer greater than 1 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10).
[0025] The nucleotide sequences of DEP-1, ..., DEP-n are identical to a portion of the sequence of the single-stranded DNA to be tested, and they do not overlap. Furthermore, the sequence combination of DEP-1, ..., DEP-n is either the complete sequence or a portion of the single-stranded DNA to be tested (i.e., DEP-1 + ... + DEP-n ≤ single-stranded DNA to be tested).
[0026] In one embodiment of the present invention, n=2.
[0027] In one embodiment of the present invention, the sequence combination of DEP-1, ..., DEP-n is the complete sequence of the single-stranded DNA to be tested (i.e., DEP-1 + ... + DEP-n = single-stranded DNA to be tested).
[0028] In one embodiment of the present invention, n=2, and the nucleotide sequences of DEP-1 and DEP-2 are identical to a portion of the sequence of the single-stranded DNA to be tested, and the sequence combination of DEP-1 and DEP-2 is the complete sequence of the single-stranded DNA to be tested (i.e., DEP-1+DEP-2=single-stranded DNA to be tested).
[0029] Specifically, the molar ratio of DEP to the DNA to be tested is 1-500:1 (e.g., 1:1, 2:1, 5:1, 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1, 100:1, 200:1, 300:1, 400:1, 500:1).
[0030] Specifically, the above reaction system may also contain Mg 2+ Especially 0-10 mM Mg (e.g., 0, 1.25, 2.5, 5, 10 mM). 2+ .
[0031] Specifically, the above reaction system also contains a nucleotide protectant, such as Tween 20, to prevent potential loss of DNA oligonucleotides during dilution and pipetting; wherein the content of the nucleotide protectant can be 0.1%-0.5% (v / v).
[0032] Specifically, the above reaction system also includes a buffer system, such as Tris buffer.
[0033] Specifically, the above detection includes the following steps: heating the rapidly cooled mixture at 35-40°C (e.g., 35, 36, 37, 38, 39, 40°C) for 1-10 minutes (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 minutes), and adding a molecular probe for detecting single-stranded DNA to trigger the detection reaction; in one embodiment of the present invention, the above detection includes: transferring the rapidly cooled mixture to a microplate and heating it in a microplate reader set to 37°C for 5 minutes, and adding a molecular probe for detecting single-stranded DNA. The detection probe may be fluorescently labeled, and the above detection also includes the step of collecting fluorescence data when the detection reaction reaches equilibrium.
[0034] Specifically, the above detection probes include: 2m reporter probes:
[0035] reporter-F1,
[0036] reporter-Q1,
[0037] ...
[0038] reporter-F m ,
[0039] reporter-Q m ;
[0040] Where m is an integer greater than or equal to 1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10).
[0041] Each reporter-F consists of two nucleotide sequences: F-S1 and F-S2. The nucleotide sequence of F-S1 is complementary to a portion of the single-stranded DNA to be tested, while F-S2 is an arbitrary sequence unrelated to the single-stranded DNA to be tested (it is not complementary to the single-stranded DNA to be tested, and its length can be 1-10 nucleotides).
[0042] The nucleotide sequence of each reporter-Q is complementary to the nucleotide sequence of the corresponding reporter-F, and the length of the nucleotide sequence of reporter-Q is shorter than the length of the nucleotide sequence of the corresponding reporter-F.
[0043] Furthermore, each F-S1 sequence is different and does not overlap.
[0044] Specifically, the single-stranded DNA to be tested must have a sequence interval of at least one (e.g., one, two, three, four, or five) nucleotides that is complementary to each F-S1 sequence.
[0045] Specifically, at least one of the aforementioned F-S1 sequences is complementary to the site to be detected in the single-stranded DNA to be tested (a site in which single nucleotide variations may occur that could cause problems of concern, such as drug resistance or disease, according to published information).
[0046] Specifically, the length of each F-S1 sequence is independently 15-30 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides).
[0047] Specifically, the length of each F-S2 sequence is independently 1-10 nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides), such as TGTAC, CGCTT.
[0048] Specifically, each F-S2 sequence is independent and may be the same or different.
[0049] Specifically, the sequence length of each reporter-Q is independently 15-25 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides).
[0050] Specifically, the sequence length of each reporter-Q differs from the sequence length of the reporter-Q by 5-10 nucleotides (e.g., 5, 6, 7, 8, 9, 10 nucleotides).
[0051] Specifically, each of the above-mentioned reporters is fluorescently labeled; wherein each reporter-F is labeled with a fluorescent reporter group and each reporter-Q is labeled with a fluorescent quencher group. For example, the 5' end of reporter-F is labeled with a fluorescent reporter group, and the 3' end of the corresponding reporter-Q is labeled with a fluorescent quencher group; or the 3' end of reporter-F is labeled with a fluorescent reporter group, and the 5' end of the corresponding reporter-Q is labeled with a fluorescent quencher group.
[0052] Specifically, the aforementioned fluorescent reporter groups can be, for example, FAM, Texas Red, ROX, TET, VIC, JOE, HEX, Cy3, Cy3.5, Cy5, Cy5.5, LC RED640, LC RED705, etc.
[0053] Specifically, the aforementioned fluorescence quenching groups can be, for example, Iowa Black, TAMRA, DABCYL, ECLIPSE, BHQ1, BHQ2, BHQ3, etc.
[0054] Specifically, the fluorescent reporter groups labeled on each of the above reporter-Fs are different.
[0055] In one embodiment of the present invention, m=1.
[0056] In another embodiment of the invention, m=2.
[0057] Specifically, the molar ratio of each of the above-mentioned reporters to the DNA to be tested is 1-500:1 (e.g., 1:1, 2:1, 5:1, 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1, 100:1, 200:1, 300:1, 400:1, 500:1).
[0058] In one embodiment of the present invention, the above method may further include the step of amplifying the DNA to be tested using nucleic acid amplification technology (such as polymerase chain reaction (PCR)).
[0059] Specifically, the above method also includes a step of detecting a standard (whose sequence is identical to that of the unmutated DNA to be tested, and which can be artificially synthesized) (the same detection steps as for the DNA to be tested).
[0060] Specifically, the above-mentioned tests can be qualitative or quantitative.
[0061] In one embodiment of the present invention, the above detection is a qualitative detection, which can be performed by comparing the intensity of the detection signal (e.g., fluorescence signal) of the DNA sample to be tested with that of an equal amount of standard.
[0062] Specifically, the above method includes the step of establishing a standard curve, for example, by using the amount of standard and the corresponding detection signal (e.g., fluorescence signal) of the standard to establish a standard curve.
[0063] In one embodiment of the present invention, the above detection is a quantitative detection. The amount of non-mutant DNA in the DNA sample to be tested can be calculated using a standard curve based on the detection signal (e.g., fluorescence signal) of the DNA sample to be tested, thereby obtaining the amount of mutant DNA in the sample.
[0064] In one embodiment of the present invention, the above detection is a quantitative detection, and the detection signal is a fluorescence signal. This can be achieved by normalizing the fluorescence data and applying the formula η = ((FF)). b )) / ((F m -F b The result is converted into apparent hybridization yield, where F is the fluorescence reading of the sample at equilibrium. m This indicates the maximum fluorescence observed for a 50-fold excess of true ssDNA target-to-strand displacement beacon, F bBackground fluorescence generated solely by the protected beacon.
[0065] Specifically, this method is applicable to targets of different length ranges, such as the DNA to be tested, which can be, for example, 32-87 bp.
[0066] Specifically, the aforementioned single nucleotide variants can be substitutions (substitution with one of A, T, C, or G), insertions (insertion with one of A, T, C, or G), or deletions.
[0067] Specifically, the above method can simultaneously detect one or more single nucleotide variant sites in the same DNA sample, or it can simultaneously detect multiple different DNA samples.
[0068] Specifically, the subjects tested by the above method can be parasites (such as Trichodina flavescens). Trichuris trichiura ),roundworms( Ascaris lumbricoides ), viruses (such as HBV) or animals (such as mammals (such as humans)).
[0069] This invention also provides a probe for detecting single nucleotide variants in DNA, comprising: 2m reporter probes:
[0070] reporter-F1,
[0071] reporter-Q1,
[0072] ...
[0073] reporter-F m ,
[0074] reporter-Q m ;
[0075] Where m is an integer greater than or equal to 1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10).
[0076] Each reporter-F consists of two nucleotide sequences: F-S1 and F-S2. The nucleotide sequence of F-S1 is complementary to a portion of the single-stranded DNA to be tested, while F-S2 is an arbitrary sequence unrelated to the single-stranded DNA to be tested (it is not complementary to the single-stranded DNA to be tested, and its length can be 1-10 nucleotides).
[0077] The nucleotide sequence of each reporter-Q is complementary to the nucleotide sequence of the corresponding reporter-F, and the length of the nucleotide sequence of reporter-Q is shorter than the length of the nucleotide sequence of the corresponding reporter-F.
[0078] Furthermore, each F-S1 sequence is different and does not overlap.
[0079] Specifically, the aforementioned reporting probe has the corresponding definition of the present invention.
[0080] The present invention also provides a kit for detecting single nucleotide variants in DNA, which includes the probes for detecting single nucleotide variants in DNA described above.
[0081] Specifically, the kit also includes: n DNA equalizer probes (DEPs):
[0082] DEP-1, ..., DEP-n;
[0083] Where n is an integer greater than 1 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10).
[0084] The nucleotide sequences of DEP-1, ..., DEP-n are identical to a portion of the sequence of the single-stranded DNA to be tested, and they do not overlap. Furthermore, the sequence combination of DEP-1, ..., DEP-n is either the complete sequence or a portion of the single-stranded DNA to be tested (i.e., DEP-1 + ... + DEP-n ≤ single-stranded DNA to be tested).
[0085] Specifically, the DEP described above has the corresponding definition of the present invention.
[0086] Specifically, the above-mentioned kit may also contain Mg 2+ Especially 0-10 mM Mg (e.g., 0, 1.25, 2.5, 5, 10 mM). 2+ .
[0087] Specifically, the kit also contains a nucleotide protectant, such as Tween 20, to prevent potential loss of DNA oligonucleotides during dilution and pipetting; the concentration of the nucleotide protectant can be 0.1%-0.5% (v / v).
[0088] Specifically, the kit also includes a buffer system, such as Tris buffer.
[0089] In one embodiment of the present invention, the detection system comprises: 1 mM Mg 2+ 0.1% Tween 20 (v / v), 1×Tris buffer, DEP, reporter probe.
[0090] Specifically, the kit also includes standards whose sequences are identical to unmutated test DNA and can be synthesized artificially.
[0091] Specifically, the above kit may also include a negative control, which is a system that does not contain the DNA to be tested, such as H2O (e.g., sterile double-distilled water, sterile deionized water, etc.).
[0092] Specifically, the kit may also include DNA extraction reagents and materials for extracting DNA from the sample to be tested, and any suitable reagents and materials known in the art for DNA extraction may be used.
[0093] Specifically, if necessary, the above kit may also include a sample pretreatment reagent, which may be a reagent known in the art for pretreating samples to facilitate DNA extraction, such as physiological saline.
[0094] This invention also provides a method for treating Trichodina flavescens (… Trichuris trichiura A probe for detecting single nucleotide variants (e.g., a mutation from the sequence shown in SEQ ID NO:1 to the sequence shown in SEQ ID NO:2), comprising: reporter-F and reporter-Q; wherein reporter-F has a nucleotide sequence as shown in SEQ ID NO:5 (or the nucleotide sequence of reporter-F consists of the nucleotide sequence shown in SEQ ID NO:5), and reporter-Q has a nucleotide sequence as shown in SEQ ID NO:6 (or the nucleotide sequence of reporter-Q consists of the nucleotide sequence shown in SEQ ID NO:6).
[0095] Specifically, the reporter-F is labeled with a fluorescent reporter group, and the reporter-Q is labeled with a fluorescent quencher group; for example, the 5' end of the reporter-F is labeled with a fluorescent reporter group, and the 3' end of the reporter-Q is labeled with a fluorescent quencher group; or the 3' end of the reporter-F is labeled with a fluorescent reporter group, and the 5' end of the reporter-Q is labeled with a fluorescent quencher group.
[0096] In one embodiment of the present invention, the above-mentioned reporter-F is 5'– G GAC GAA ACA TAC TGC ATAGA CATGT–FAM –3'; reporter-Q is 5'– Iowa Black FQ– ACATG TC TAT GCA GTA TGT –3'.
[0097] The present invention also provides a probe for detecting HBV single nucleotide variants, comprising: reporter-F and reporter-Q, wherein reporter-F has a nucleotide sequence as shown in SEQ ID NO: 10 (or the nucleotide sequence of reporter-F is composed of the nucleotide sequence shown in SEQ ID NO: 10), and reporter-Q has a nucleotide sequence as shown in SEQ ID NO: 11 (or the nucleotide sequence of reporter-Q is composed of the nucleotide sequence shown in SEQ ID NO: 11).
[0098] Specifically, the reporter-F is labeled with a fluorescent reporter group, and the reporter-Q is labeled with a fluorescent quencher group; for example, the 5' end of the reporter-F is labeled with a fluorescent reporter group, and the 3' end of the reporter-Q is labeled with a fluorescent quencher group; or the 3' end of the reporter-F is labeled with a fluorescent reporter group, and the 5' end of the reporter-Q is labeled with a fluorescent quencher group.
[0099] In one embodiment of the present invention, the above-mentioned reporter-F is 5'– FAM– CGCTT AGG TTG GTG AGTGATT GG AGG TT –3'; reporter-Q is 5'– A ATC ACT CAC CAA CCT AAGCG –Iowa Black FQ–3'.
[0100] This invention also provides a method for treating Trichodina flavescens (… Trichuris trichiuraA probe for detecting single nucleotide variants (e.g., a mutation from the sequence shown in SEQ ID NO:12 to the sequence shown in SEQ ID NO:13), comprising: reporter-F1, reporter-Q1, reporter-F2, and reporter-Q2, wherein reporter-F1 has the nucleotide sequence shown in SEQ ID NO:16 (or the nucleotide sequence of reporter-F1 is composed of the nucleotide sequence shown in SEQ ID NO:16), reporter-Q1 has the nucleotide sequence shown in SEQ ID NO:17 (or the nucleotide sequence of reporter-Q1 is composed of the nucleotide sequence shown in SEQ ID NO:17), reporter-F2 has the nucleotide sequence shown in SEQ ID NO:18 (or the nucleotide sequence of reporter-F2 is composed of the nucleotide sequence shown in SEQ ID NO:18), and reporter-Q2 has the nucleotide sequence shown in SEQ ID NO:19 (or the nucleotide sequence of reporter-Q2 is composed of the nucleotide sequence shown in SEQ ID NO:19).
[0101] Specifically, the aforementioned reporter-F is labeled with a fluorescent reporter group, and reporter-Q is labeled with a fluorescent quencher group; for example, the 5' end of reporter-F is labeled with a fluorescent reporter group, and the 3' end of reporter-Q is labeled with a fluorescent quencher group; or the 3' end of reporter-F is labeled with a fluorescent reporter group, and the 5' end of reporter-Q is labeled with a fluorescent quencher group; and the fluorescent reporter groups labeled on reporter-F1 and reporter-F2 are different.
[0102] In one embodiment of the present invention, the above-mentioned reporter-F1 is 5'– AT GAA GC G CTT TAC GATATT TGT TTC CGA -Cy5–3'; reporter-Q is 5'– Iowa Black RQ – TCG GAA ACA AAT ATCGTA AAG C –3'.
[0103] The present invention also provides a probe for detecting the cancer-related gene mutation BRAF-D594G (e.g., a mutation from the sequence shown in SEQ ID NO:20 to the sequence shown in SEQ ID NO:21), comprising: reporter-F and reporter-Q, wherein reporter-F has a nucleotide sequence as shown in SEQ ID NO:24 (or the nucleotide sequence of reporter-F is composed of the nucleotide sequence shown in SEQ ID NO:24), and reporter-Q has a nucleotide sequence as shown in SEQ ID NO:25 (or the nucleotide sequence of reporter-Q is composed of the nucleotide sequence shown in SEQ ID NO:25).
[0104] Specifically, the reporter-F is labeled with a fluorescent reporter group, and the reporter-Q is labeled with a fluorescent quencher group; for example, the 5' end of the reporter-F is labeled with a fluorescent reporter group, and the 3' end of the reporter-Q is labeled with a fluorescent quencher group; or the 3' end of the reporter-F is labeled with a fluorescent reporter group, and the 5' end of the reporter-Q is labeled with a fluorescent quencher group.
[0105] In one embodiment of the present invention, the above-mentioned reporter-F is 5'– AGA CCA A AA CCA CCT ATTTTT CATGT - FAM–3'; reporter-Q is 5'– Iowa Black FQ-ACATG AAA AAT AGG TGG TT –3'.
[0106] The present invention also provides a probe for detecting the cancer-related gene mutation BRAF-V600E (e.g., a mutation from the sequence shown in SEQ ID NO:26 to the sequence shown in SEQ ID NO:27), comprising: reporter-F and reporter-Q, wherein reporter-F has a nucleotide sequence as shown in SEQ ID NO:30 (or the nucleotide sequence of reporter-F is composed of the nucleotide sequence shown in SEQ ID NO:30), and reporter-Q has a nucleotide sequence as shown in SEQ ID NO:31 (or the nucleotide sequence of reporter-Q is composed of the nucleotide sequence shown in SEQ ID NO:31).
[0107] Specifically, the reporter-F is labeled with a fluorescent reporter group, and the reporter-Q is labeled with a fluorescent quencher group; for example, the 5' end of the reporter-F is labeled with a fluorescent reporter group, and the 3' end of the reporter-Q is labeled with a fluorescent quencher group; or the 3' end of the reporter-F is labeled with a fluorescent reporter group, and the 5' end of the reporter-Q is labeled with a fluorescent quencher group.
[0108] In one embodiment of the present invention, the above-mentioned reporter-F is 5'– ATC GAG A TT TCT CTG TAGCTA CATGT - FAM–3'; reporter-Q is 5'– Iowa Black FQ- ACATG TAG CTA CAG AGA AA–3'.
[0109] The present invention also provides a probe for detecting cancer-related gene mutations EGFR-G719A (e.g., a mutation from the sequence shown in SEQ ID NO:32 to the sequence shown in SEQ ID NO:33), comprising: reporter-F and reporter-Q, wherein reporter-F has a nucleotide sequence as shown in SEQ ID NO:36 (or the nucleotide sequence of reporter-F is composed of the nucleotide sequence shown in SEQ ID NO:36), and reporter-Q has a nucleotide sequence as shown in SEQ ID NO:37 (or the nucleotide sequence of reporter-Q is composed of the nucleotide sequence shown in SEQ ID NO:37).
[0110] Specifically, the reporter-F is labeled with a fluorescent reporter group, and the reporter-Q is labeled with a fluorescent quencher group; for example, the 5' end of the reporter-F is labeled with a fluorescent reporter group, and the 3' end of the reporter-Q is labeled with a fluorescent quencher group; or the 3' end of the reporter-F is labeled with a fluorescent reporter group, and the 5' end of the reporter-Q is labeled with a fluorescent quencher group.
[0111] In one embodiment of the present invention, the above-mentioned reporter-F is 5'–FAM- TGTAC CGC ACC GGA GGCCA G CAC TTT –3'; reporter-Q is 5'–T GGC CTC CGG TGC G GTACA -Iowa Black FQ–3'.
[0112] The present invention also provides a probe for detecting cancer-related gene mutations EGFR-L858R (e.g., a mutation from the sequence shown in SEQ ID NO:38 to the sequence shown in SEQ ID NO:39), comprising: reporter-F and reporter-Q, wherein reporter-F has a nucleotide sequence as shown in SEQ ID NO:42 (or the nucleotide sequence of reporter-F is composed of the nucleotide sequence shown in SEQ ID NO:42), and reporter-Q has a nucleotide sequence as shown in SEQ ID NO:43 (or the nucleotide sequence of reporter-Q is composed of the nucleotide sequence shown in SEQ ID NO:43).
[0113] Specifically, the reporter-F is labeled with a fluorescent reporter group, and the reporter-Q is labeled with a fluorescent quencher group; for example, the 5' end of the reporter-F is labeled with a fluorescent reporter group, and the 3' end of the reporter-Q is labeled with a fluorescent quencher group; or the 3' end of the reporter-F is labeled with a fluorescent reporter group, and the 5' end of the reporter-Q is labeled with a fluorescent quencher group.
[0114] In one embodiment of the present invention, the above-mentioned reporter-F is 5'– ACA GAT T TT GGG CGG GCCAAA CATGT A -FAM–3'; reporter-Q is 5'–Iowa Black FQ- T ACATG T TTG GCC CGC CCA A–3'.
[0115] The present invention also provides a probe for detecting cancer-related gene mutations EGFR-L861Q (e.g., a mutation from the sequence shown in SEQ ID NO:44 to the sequence shown in SEQ ID NO:45), comprising: reporter-F and reporter-Q, wherein reporter-F has a nucleotide sequence as shown in SEQ ID NO:48 (or the nucleotide sequence of reporter-F is composed of the nucleotide sequence shown in SEQ ID NO:48), and reporter-Q has a nucleotide sequence as shown in SEQ ID NO:49 (or the nucleotide sequence of reporter-Q is composed of the nucleotide sequence shown in SEQ ID NO:49).
[0116] Specifically, the reporter-F is labeled with a fluorescent reporter group, and the reporter-Q is labeled with a fluorescent quencher group; for example, the 5' end of the reporter-F is labeled with a fluorescent reporter group, and the 3' end of the reporter-Q is labeled with a fluorescent quencher group; or the 3' end of the reporter-F is labeled with a fluorescent reporter group, and the 5' end of the reporter-Q is labeled with a fluorescent quencher group.
[0117] In one embodiment of the present invention, the above-mentioned reporter-F is 5'–FAM- TGTAC GGC CAA ACA GCTGG G TGC G –3'; reporter-Q is 5'– CCA GCT GTT TGG CC GTACA -Iowa Black FQ–3'.
[0118] The present invention also provides a probe for detecting cancer-related gene mutations KRAS-G12A (e.g., a mutation from the sequence shown in SEQ ID NO:50 to the sequence shown in SEQ ID NO:51), comprising: reporter-F and reporter-Q, wherein reporter-F has a nucleotide sequence as shown in SEQ ID NO:54 (or the nucleotide sequence of reporter-F is composed of the nucleotide sequence shown in SEQ ID NO:54), and reporter-Q has a nucleotide sequence as shown in SEQ ID NO:55 (or the nucleotide sequence of reporter-Q is composed of the nucleotide sequence shown in SEQ ID NO:55).
[0119] Specifically, the reporter-F is labeled with a fluorescent reporter group, and the reporter-Q is labeled with a fluorescent quencher group; for example, the 5' end of the reporter-F is labeled with a fluorescent reporter group, and the 3' end of the reporter-Q is labeled with a fluorescent quencher group; or the 3' end of the reporter-F is labeled with a fluorescent reporter group, and the 5' end of the reporter-Q is labeled with a fluorescent quencher group.
[0120] In one embodiment of the present invention, the above-mentioned reporter-F is 5'–FAM- TGTAC TTG CCT ACG CCAGC A GCT C –3'; reporter-Q is 5'– GCT GGC GTA GGC AA GTACA -Iowa Black FQ–3'.
[0121] The present invention also provides a probe for detecting cancer-related gene mutations KRAS-G13V (e.g., a mutation from the sequence shown in SEQ ID NO:56 to the sequence shown in SEQ ID NO:57), comprising: reporter-F and reporter-Q, wherein reporter-F has a nucleotide sequence as shown in SEQ ID NO:60 (or the nucleotide sequence of reporter-F is composed of the nucleotide sequence shown in SEQ ID NO:60), and reporter-Q has a nucleotide sequence as shown in SEQ ID NO:61 (or the nucleotide sequence of reporter-Q is composed of the nucleotide sequence shown in SEQ ID NO:61).
[0122] Specifically, the reporter-F is labeled with a fluorescent reporter group, and the reporter-Q is labeled with a fluorescent quencher group; for example, the 5' end of the reporter-F is labeled with a fluorescent reporter group, and the 3' end of the reporter-Q is labeled with a fluorescent quencher group; or the 3' end of the reporter-F is labeled with a fluorescent reporter group, and the 5' end of the reporter-Q is labeled with a fluorescent quencher group.
[0123] In one embodiment of the present invention, the above-mentioned reporter-F is 5'–FAM- TGTAC TTG CCT ACG ACACC A GCT C–3'; reporter-Q is 5'–GGT GTC GTA GGC AA GTACA -Iowa Black FQ–3'.
[0124] The present invention also provides a probe for detecting the cancer-related gene mutation PIK3CA-H1047R (e.g., a mutation from the sequence shown in SEQ ID NO: 62 to the sequence shown in SEQ ID NO: 63), comprising: reporter-F and reporter-Q, wherein reporter-F has a nucleotide sequence as shown in SEQ ID NO: 66 (or the nucleotide sequence of reporter-F is composed of the nucleotide sequence shown in SEQ ID NO: 66), and reporter-Q has a nucleotide sequence as shown in SEQ ID NO: 67 (or the nucleotide sequence of reporter-Q is composed of the nucleotide sequence shown in SEQ ID NO: 67).
[0125] Specifically, the reporter-F is labeled with a fluorescent reporter group, and the reporter-Q is labeled with a fluorescent quencher group; for example, the 5' end of the reporter-F is labeled with a fluorescent reporter group, and the 3' end of the reporter-Q is labeled with a fluorescent quencher group; or the 3' end of the reporter-F is labeled with a fluorescent reporter group, and the 5' end of the reporter-Q is labeled with a fluorescent quencher group.
[0126] In one embodiment of the present invention, the above-mentioned reporter-F is 5'–CA GCC A CC ATG ACG TGC ATCCATGT -FAM–3'; the reporter-Q is 5'–Iowa Black FQ- ACATG GAT GCA CGT CAT GG–3'.
[0127] The present invention also provides a probe for detecting the cancer-related gene mutation STK11-F354L (e.g., a mutation from the sequence shown in SEQ ID NO: 68 to the sequence shown in SEQ ID NO: 69), comprising: reporter-F and reporter-Q, wherein reporter-F has a nucleotide sequence as shown in SEQ ID NO: 72 (or the nucleotide sequence of reporter-F is composed of the nucleotide sequence shown in SEQ ID NO: 72), and reporter-Q has a nucleotide sequence as shown in SEQ ID NO: 73 (or the nucleotide sequence of reporter-Q is composed of the nucleotide sequence shown in SEQ ID NO: 73).
[0128] Specifically, the reporter-F is labeled with a fluorescent reporter group, and the reporter-Q is labeled with a fluorescent quencher group; for example, the 5' end of the reporter-F is labeled with a fluorescent reporter group, and the 3' end of the reporter-Q is labeled with a fluorescent quencher group; or the 3' end of the reporter-F is labeled with a fluorescent reporter group, and the 5' end of the reporter-Q is labeled with a fluorescent quencher group.
[0129] In one embodiment of the present invention, the above-mentioned reporter-F is 5'–TTG GAC A TC GAG GAT GACATC CATGT -FAM–3'; reporter-Q is 5'–Iowa Black FQ- GTACA GAT GTC ATC CTC GA–3'.
[0130] This invention also provides a method for treating Trichodina flavescens (… Trichuris trichiuraA kit for detecting single nucleotide variants, comprising the probes described above for detecting single nucleotide variants in Trichodina flavescens.
[0131] Specifically, the kit also includes DEP-1 and DEP-2, wherein the nucleotide sequences of DEP-1 and DEP-2 are identical to a portion of the sequence of the single-stranded DNA to be tested, the sequences do not overlap, and the combination of the sequences of DEP-1 and DEP-2 is the complete sequence or a portion of the sequence of the single-stranded DNA to be tested (i.e., DEP-1 + DEP-2 ≤ single-stranded DNA to be tested).
[0132] Specifically, DEP-1 has the nucleotide sequence shown in SEQ ID NO: 3 (or DEP-1 is composed of the nucleotide sequence shown in SEQ ID NO: 3), and DEP-2 has the nucleotide sequence shown in SEQ ID NO: 4 (or DEP-2 is composed of the nucleotide sequence shown in SEQ ID NO: 4).
[0133] Specifically, the kit also includes standards having (or consisting of) the nucleotide sequence shown in SEQ ID NO: 4.
[0134] Specifically, since a specific A-to-T mutation (such as the mutation in SEQ ID NO:1 to SEQ ID NO:2) in codon 200 of β-tubulin of Trichodina flavescens is a recognized hotspot for TT resistance to benzimidazole (BZ, the drug), the above kit can be used to screen or identify drug resistance in Trichodina flavescens.
[0135] The present invention also provides a kit for detecting HBV single nucleotide variants, which includes the probes for detecting HBV single nucleotide variants described above.
[0136] Specifically, the kit also includes DEP-1 and DEP-2, wherein the nucleotide sequences of DEP-1 and DEP-2 are identical to a portion of the sequence of the single-stranded DNA to be tested, the sequences do not overlap, and the combination of the sequences of DEP-1 and DEP-2 is the complete sequence or a portion of the sequence of the single-stranded DNA to be tested (i.e., DEP-1 + DEP-2 ≤ single-stranded DNA to be tested).
[0137] Specifically, DEP-1 has a nucleotide sequence as shown in SEQ ID NO: 8 (or is composed of therefrom), and DEP-2 has a nucleotide sequence as shown in SEQ ID NO: 9 (or is composed of therefrom).
[0138] Specifically, the kit also includes standards having (or consisting of) the nucleotide sequence shown in SEQ ID NO: 7.
[0139] This invention also provides a method for treating Trichodina flavescens (… Trichuris trichiura A kit for detecting single nucleotide variants, comprising: reporter-F1, reporter-Q1, reporter-F2, and reporter-Q2, wherein reporter-F1 has the nucleotide sequence shown in SEQ ID NO: 16, reporter-Q1 has the nucleotide sequence shown in SEQ ID NO: 17, reporter-F2 has the nucleotide sequence shown in SEQ ID NO: 18, and reporter-Q2 has the nucleotide sequence shown in SEQ ID NO: 19.
[0140] Specifically, the kit also includes DEP-1 and DEP-2, wherein the nucleotide sequences of DEP-1 and DEP-2 are identical (non-edge) to the internal portion of the single-stranded DNA to be tested, the sequences do not overlap, and the combination of the sequences of DEP-1 and DEP-2 is the internal portion of the single-stranded DNA to be tested (i.e., DEP-1 + DEP-2 ≤ single-stranded DNA to be tested).
[0141] Specifically, DEP-1 has a nucleotide sequence as shown in SEQ ID NO: 3 (or is composed of therefrom), and DEP-2 has a nucleotide sequence as shown in SEQ ID NO: 4 (or is composed of therefrom).
[0142] Specifically, the kit also includes a pair of primers (DEP-3 and DEP-4), wherein the nucleotide sequence of the forward primer (DEP-3) is identical to the edge portion sequence of the single-stranded DNA to be tested and does not overlap with DEP-1 and DEP-2, and the sequence combination of DEP-1, DEP-2 and DEP-3 is a partial sequence of the single-stranded DNA to be tested, and DEP-4 is the complementary sequence of the remaining portion of the single-stranded DNA to be tested.
[0143] Specifically, DEP-3 has (or consists of) the nucleotide sequence shown in SEQ ID NO: 14, and DEP-4 has (or consists of) the nucleotide sequence shown in SEQ ID NO: 15.
[0144] Specifically, the aforementioned reporter-F is labeled with a fluorescent reporter group, and reporter-Q is labeled with a fluorescent quencher group; for example, the 5' end of reporter-F is labeled with a fluorescent reporter group, and the 3' end of reporter-Q is labeled with a fluorescent quencher group; or the 3' end of reporter-F is labeled with a fluorescent reporter group, and the 5' end of reporter-Q is labeled with a fluorescent quencher group; and the fluorescent reporter groups labeled on reporter-F1 and reporter-F2 are different.
[0145] In one embodiment of the present invention, the above-mentioned reporter-F1 is 5'– AT GAA GC G CTT TAC GATATT TGT TTC CGA -Cy5–3'; reporter-Q is 5'– Iowa Black RQ – TCG GAA ACA AAT ATCGTA AAG C –3'.
[0146] In one embodiment of the present invention, the above-mentioned reporter-F2 is 5'– G GAC GAA ACA TAC TGC ATAGA CATGT–FAM –3'; reporter-Q is 5'– Iowa Black FQ– ACATG TC TAT GCA GTA TGT –3'.
[0147] Specifically, the kit also includes standards having (or consisting of) the nucleotide sequence shown in SEQ ID NO: 12.
[0148] Specifically, since a specific A-to-T mutation (such as the mutation in SEQ ID NO:12 to SEQ ID NO:13) in codon 200 of β-tubulin of Trichodinae is a recognized hotspot for TT resistance to benzimidazole (BZ, the drug), the reporter in the above detection system covers both the mutation site and the non-mutation site, which can be used to detect Trichodinae infection and screen or identify drug resistance in Trichodinae.
[0149] The present invention also provides a kit for detecting the cancer-related gene mutation BRAF-D594G (e.g., a mutation from the sequence shown in SEQ ID NO:20 to the sequence shown in SEQ ID NO:21), which contains the probes described above for detecting the cancer-related gene mutation BRAF-D594G of the present invention.
[0150] Specifically, the kit also includes DEP-1 and DEP-2, wherein the nucleotide sequences of DEP-1 and DEP-2 are identical to a portion of the sequence of the single-stranded DNA to be tested, the sequences do not overlap, and the combination of the sequences of DEP-1 and DEP-2 is the complete sequence or a portion of the sequence of the single-stranded DNA to be tested (i.e., DEP-1 + DEP-2 ≤ single-stranded DNA to be tested).
[0151] Specifically, DEP-1 has a nucleotide sequence as shown in SEQ ID NO: 22 (or consists of therewith), and DEP-2 has a nucleotide sequence as shown in SEQ ID NO: 23 (or consists of therewith).
[0152] Specifically, the kit also includes standards having (or consisting of) the nucleotide sequence shown in SEQ ID NO: 20.
[0153] The present invention also provides a kit for detecting cancer-related gene mutation BRAF-V600E (e.g., a mutation from the sequence shown in SEQ ID NO:26 to the sequence shown in SEQ ID NO:27), which contains the probes described above for detecting cancer-related gene mutation BRAF-V600E of the present invention.
[0154] Specifically, the kit also includes DEP-1 and DEP-2, wherein the nucleotide sequences of DEP-1 and DEP-2 are identical to a portion of the sequence of the single-stranded DNA to be tested, the sequences do not overlap, and the combination of the sequences of DEP-1 and DEP-2 is the complete sequence or a portion of the sequence of the single-stranded DNA to be tested (i.e., DEP-1 + DEP-2 ≤ single-stranded DNA to be tested).
[0155] Specifically, DEP-1 has a nucleotide sequence as shown in SEQ ID NO: 28 (or is composed of therefrom), and DEP-2 has a nucleotide sequence as shown in SEQ ID NO: 29 (or is composed of therefrom).
[0156] Specifically, the kit also includes standards having (or consisting of) the nucleotide sequence shown in SEQ ID NO: 26.
[0157] The present invention also provides a kit for detecting cancer-related gene mutation EGFR-G719A (e.g., a mutation from the sequence shown in SEQ ID NO:32 to the sequence shown in SEQ ID NO:33), which contains the probes described above for detecting cancer-related gene mutation EGFR-G719A of the present invention.
[0158] Specifically, the kit also includes DEP-1 and DEP-2, wherein the nucleotide sequences of DEP-1 and DEP-2 are identical to a portion of the sequence of the single-stranded DNA to be tested, the sequences do not overlap, and the combination of the sequences of DEP-1 and DEP-2 is the complete sequence or a portion of the sequence of the single-stranded DNA to be tested (i.e., DEP-1 + DEP-2 ≤ single-stranded DNA to be tested).
[0159] Specifically, DEP-1 has a nucleotide sequence as shown in SEQ ID NO: 34 (or is composed of therefrom), and DEP-2 has a nucleotide sequence as shown in SEQ ID NO: 35 (or is composed of therefrom).
[0160] Specifically, the kit also includes standards having (or consisting of) the nucleotide sequence shown in SEQ ID NO: 32.
[0161] The present invention also provides a kit for detecting cancer-related gene mutation EGFR-L858R (e.g., a mutation from the sequence shown in SEQ ID NO:38 to the sequence shown in SEQ ID NO:39), which contains the probes described above for detecting cancer-related gene mutation EGFR-L858R of the present invention.
[0162] Specifically, the kit also includes DEP-1 and DEP-2, wherein the nucleotide sequences of DEP-1 and DEP-2 are identical to a portion of the sequence of the single-stranded DNA to be tested, the sequences do not overlap, and the combination of the sequences of DEP-1 and DEP-2 is the complete sequence or a portion of the sequence of the single-stranded DNA to be tested (i.e., DEP-1 + DEP-2 ≤ single-stranded DNA to be tested).
[0163] Specifically, DEP-1 has a nucleotide sequence as shown in SEQ ID NO: 40 (or consists of therewith), and DEP-2 has a nucleotide sequence as shown in SEQ ID NO: 41 (or consists of therewith).
[0164] Specifically, the kit also includes standards having (or consisting of) the nucleotide sequence shown in SEQ ID NO: 38.
[0165] The present invention also provides a kit for detecting cancer-related gene mutation EGFR-L861Q (e.g., a mutation from the sequence shown in SEQ ID NO:44 to the sequence shown in SEQ ID NO:45), which contains the probes described above for detecting cancer-related gene mutation EGFR-L861Q of the present invention.
[0166] Specifically, the kit also includes DEP-1 and DEP-2, wherein the nucleotide sequences of DEP-1 and DEP-2 are identical to a portion of the sequence of the single-stranded DNA to be tested, the sequences do not overlap, and the combination of the sequences of DEP-1 and DEP-2 is the complete sequence or a portion of the sequence of the single-stranded DNA to be tested (i.e., DEP-1 + DEP-2 ≤ single-stranded DNA to be tested).
[0167] Specifically, DEP-1 has a nucleotide sequence as shown in SEQ ID NO: 46 (or is composed of therefrom), and DEP-2 has a nucleotide sequence as shown in SEQ ID NO: 47 (or is composed of therefrom).
[0168] Specifically, the kit also includes standards having (or consisting of) the nucleotide sequence shown in SEQ ID NO: 44.
[0169] The present invention also provides a kit for detecting cancer-related gene mutation KRAS-G12A (e.g., a mutation from the sequence shown in SEQ ID NO:50 to the sequence shown in SEQ ID NO:51), which contains the probes described above for detecting cancer-related gene mutation KRAS-G12A of the present invention.
[0170] Specifically, the kit also includes DEP-1 and DEP-2, wherein the nucleotide sequences of DEP-1 and DEP-2 are identical to a portion of the sequence of the single-stranded DNA to be tested, the sequences do not overlap, and the combination of the sequences of DEP-1 and DEP-2 is the complete sequence or a portion of the sequence of the single-stranded DNA to be tested (i.e., DEP-1 + DEP-2 ≤ single-stranded DNA to be tested).
[0171] Specifically, DEP-1 has a nucleotide sequence as shown in SEQ ID NO: 52 (or is composed of therefrom), and DEP-2 has a nucleotide sequence as shown in SEQ ID NO: 53 (or is composed of therefrom).
[0172] Specifically, the kit also includes standards having (or consisting of) the nucleotide sequence shown in SEQ ID NO: 50.
[0173] The present invention also provides a kit for detecting cancer-related gene mutation KRAS-G13V (e.g., a mutation from the sequence shown in SEQ ID NO:56 to the sequence shown in SEQ ID NO:57), which contains the probes described above for detecting cancer-related gene mutation KRAS-G13V of the present invention.
[0174] Specifically, the kit also includes DEP-1 and DEP-2, wherein the nucleotide sequences of DEP-1 and DEP-2 are identical to a portion of the sequence of the single-stranded DNA to be tested, the sequences do not overlap, and the combination of the sequences of DEP-1 and DEP-2 is the complete sequence or a portion of the sequence of the single-stranded DNA to be tested (i.e., DEP-1 + DEP-2 ≤ single-stranded DNA to be tested).
[0175] Specifically, DEP-1 has a nucleotide sequence as shown in SEQ ID NO: 58 (or is composed of therefrom), and DEP-2 has a nucleotide sequence as shown in SEQ ID NO: 59 (or is composed of therefrom).
[0176] Specifically, the kit also includes standards having (or consisting of) the nucleotide sequence shown in SEQ ID NO: 56.
[0177] The present invention also provides a kit for detecting the cancer-related gene mutation PIK3CA-H1047R (e.g., a mutation from the sequence shown in SEQ ID NO: 62 to the sequence shown in SEQ ID NO: 63), which contains the probes described above for detecting the cancer-related gene mutation PIK3CA-H1047R of the present invention.
[0178] Specifically, the kit also includes DEP-1 and DEP-2, wherein the nucleotide sequences of DEP-1 and DEP-2 are identical to a portion of the sequence of the single-stranded DNA to be tested, the sequences do not overlap, and the combination of the sequences of DEP-1 and DEP-2 is the complete sequence or a portion of the sequence of the single-stranded DNA to be tested (i.e., DEP-1 + DEP-2 ≤ single-stranded DNA to be tested).
[0179] Specifically, DEP-1 has a nucleotide sequence as shown in SEQ ID NO: 64 (or consists of therewith), and DEP-2 has a nucleotide sequence as shown in SEQ ID NO: 65 (or consists of therewith).
[0180] Specifically, the kit also includes standards having (or consisting of) the nucleotide sequence shown in SEQ ID NO: 62.
[0181] The present invention also provides a kit for detecting the cancer-related gene mutation STK11-F354L (e.g., a mutation from the sequence shown in SEQ ID NO: 68 to the sequence shown in SEQ ID NO: 69), which contains the probes described above for detecting the cancer-related gene mutation STK11-F354L of the present invention.
[0182] Specifically, the kit also includes DEP-1 and DEP-2, wherein the nucleotide sequences of DEP-1 and DEP-2 are identical to a portion of the sequence of the single-stranded DNA to be tested, the sequences do not overlap, and the combination of the sequences of DEP-1 and DEP-2 is the complete sequence or a portion of the sequence of the single-stranded DNA to be tested (i.e., DEP-1 + DEP-2 ≤ single-stranded DNA to be tested).
[0183] Specifically, DEP-1 has a nucleotide sequence as shown in SEQ ID NO: 70 (or is composed of therefrom), and DEP-2 has a nucleotide sequence as shown in SEQ ID NO: 71 (or is composed of therefrom).
[0184] Specifically, the kit also includes standards having (or consisting of) the nucleotide sequence shown in SEQ ID NO: 68.
[0185] Specifically, the above-mentioned reagent kit of the present invention may further contain Mg 2+Especially 0-10 mM Mg (e.g., 0, 1.25, 2.5, 5, 10 mM). 2+ .
[0186] Specifically, the kit described above in this invention also contains a nucleotide protectant, such as Tween 20, to prevent potential loss of DNA oligonucleotides during dilution and pipetting; wherein the content of the nucleotide protectant can be 0.1%-0.5% (v / v).
[0187] Specifically, the kit described above in this invention also includes a buffer system, such as Tris buffer.
[0188] In one embodiment of the present invention, the above-mentioned kit comprises: 1 mM Mg 2+ 0.1% Tween 20 (v / v), 1×Tris buffer, and the corresponding probes and DEP.
[0189] Specifically, the above-mentioned kit of the present invention may also include a negative control, which is a system that does not contain the DNA to be tested, such as H2O (e.g., sterile double-distilled water, sterile deionized water, etc.).
[0190] Specifically, the kit described above may also include DNA extraction reagents and materials for extracting DNA from the sample to be tested, and any suitable reagents and materials known in the prior art for DNA extraction may be used.
[0191] Specifically, if necessary, the above kit may also include a sample pretreatment reagent, which may be a reagent known in the art for pretreating samples to facilitate DNA extraction, such as physiological saline.
[0192] The present invention also provides the application of the above-mentioned detection methods, probes, and kits in the detection of DNA single nucleotide variants.
[0193] The present invention also provides the above-mentioned detection method, probe, and kit for DNA single nucleotide variants.
[0194] The present invention also provides the application of the above-mentioned detection methods, probes, and kits in the detection of pathogen infections.
[0195] The present invention also provides the above-mentioned detection method, probe, and kit for detecting pathogen infection.
[0196] Specifically, the aforementioned pathogens can be microorganisms, parasites, or other vectors. Specifically, the aforementioned microorganisms can be selected from one or more of the following: viruses, chlamydia, rickettsia, mycoplasma, bacteria, spirochetes, fungi, etc.
[0197] In one embodiment of the present invention, the aforementioned pathogen is a virus, for example, but not limited to, adenoviridae (e.g., adenovirus), herpesviruses (e.g., HSV1 (oral herpes), HSV2 (genital herpes), VZV (varicella), EBV (Ebola virus), CMV (cytomegalovirus)), poxviruses (e.g., smallpox virus, vaccinia virus), papillomaviruses (e.g., papillomavirus), parvoviruses (e.g., B19 virus), hepatotropic DNA viruses (e.g., hepatitis B virus), polyomaviruses (e.g., polyomavirus), reoviridae (e.g., reovirus, rotavirus), and picoronaviridae (e.g., Enteroviruses, Foot-and-Mouth Disease Viruses; Calicoviridae (e.g., Norwalk virus, Hepatitis E virus); Clonorchitiviruses (e.g., Rubella virus); Arenaviridae (e.g., Lymphocytic choriomeningitis virus); Retroviridae (HIV-1, HIV-2, HTLV-1); Flaviviridae (e.g., Dengue virus, Zika virus, Japanese encephalitis virus, Chikungunya virus, Yellow fever virus, Hepatitis C virus, West Nile virus, etc.); Orthomyxoviridae (e.g., Influenza viruses (e.g., Influenza A virus, Influenza B virus, Influenza C virus, etc.)); Paramyxoviridae (e.g., Human Parainfluenza Virus Type 1 (HPV), HPV Type 2, HPV Type 3, etc.). Type 1 HPV, Type 4 HPV, Sendai virus, mumps virus, measles virus, respiratory syncytial virus, Newcastle disease virus, etc.), Bunyaviridae (such as California encephalitis virus, Hantavirus), Rhabdoviridae (such as rabies virus), Filoviridae (such as Ebola virus, Marburg virus), Coronaviridae (such as HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV, MERS-CoV, SARS-CoV-2, etc.), Astroviridae (such as astrovirus), Bornaviridae (such as Bornavirus).
[0198] In one embodiment of the present invention, the aforementioned pathogen is a parasite, such as, but not limited to, roundworms, whipworms, pinworms, hookworms, tapeworms, Entamoeba histolytica, Trichomonas vaginalis, liver flukes, echinococcosis, Paragonimus westermani, cysticercosis, Toxoplasma gondii, schistosomes, trichinella, filarial worms, Plasmodium, Leishmania, nematodes, mites, lice, ticks, etc.
[0199] The present invention also provides the application of the above-mentioned detection methods, probes, and kits in screening or identifying parasite drug resistance.
[0200] The present invention also provides the above-mentioned detection methods, probes, and kits for screening or identifying parasite drug resistance.
[0201] In one embodiment of the present invention, the parasite is Trichodina flavescens.
[0202] The present invention also provides the application of the above-mentioned detection methods, probes, and kits in the diagnosis of diseases and the assessment of disease risk.
[0203] The present invention also provides the above-mentioned detection methods, probes, and kits, which are used for disease diagnosis and disease risk assessment.
[0204] The present invention also provides the use of the above-described probe in the preparation of products (such as kits) for the diagnosis of diseases and the assessment of disease risk.
[0205] In one embodiment of the present invention, the aforementioned disease is a malignant tumor, including, but not limited to, lymphoma, blastoma, medulloblastoma, retinoblastoma, sarcoma, liposarcoma, synovial cell sarcoma, neuroendocrine tumor, carcinoid tumor, gastrinoma, islet cell carcinoma, mesothelioma, schwannoma, acoustic neuroma, meningioma, adenocarcinoma, melanoma, leukemia or lymphoid malignant tumor, squamous cell carcinoma, epithelial squamous cell carcinoma, lung cancer, small cell lung cancer, non-small cell lung cancer, adenocarcinoma lung cancer, squamous cell carcinoma of the lung, peritoneal carcinoma, hepatocellular carcinoma, gastric cancer, intestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, liver cancer, breast cancer, metastatic breast cancer, colon cancer, rectal cancer, colorectal cancer, uterine cancer, salivary gland cancer, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver cancer, anal cancer, penile cancer, Merkel cell carcinoma, esophageal cancer, biliary tract tumor, head and neck cancer, and hematologic malignancies.
[0206] The present invention also provides a method for diagnosing diseases and assessing disease risk, which includes the steps of using the detection method, probe, and kit described above.
[0207] This invention discloses a novel method for simulating and guiding the design of nucleic acid hybridization probes—the DNA Equalizer Gate (DEG). Through a user-definable quantitative relationship between the detection signal and target concentration, it significantly expands the detection window for distinguishing single nucleotide variants in double-stranded DNA (dsDNA). The invention also discloses a thermodynamically driven theoretical model to quantitatively simulate and predict the performance of the DEG. Computer simulations and experimental verification have demonstrated the effectiveness of the DEG in expanding the detection window and improving sequence selectivity. Because the DEG acts directly on dsDNA, it is readily applicable to nucleic acid amplification techniques such as polymerase chain reaction (PCR). The practicality of the DEG has been confirmed through infection detection and drug resistance screening of clinical parasite samples collected from rural Honduras. The detection method provided by this invention does not require the use of expensive reagents such as enzymes, which have stringent reaction condition requirements. Therefore, the method is simple to operate, low in cost, and easy for enterprises and laboratories to apply. Attached Figure Description
[0208] Figure 1The diagram shows the experimental steps and DNA reaction in DEG.
[0209] Figure 2 The diagram shows the optimization of asymmetric PCR using different ratios of forward and reverse primer concentrations; the kinetic curves show the measurement of ssDNA output generated by asymmetric PCR using a reporter probe with toehold exchange operation.
[0210] Figure 3 The diagram illustrates the DEG process. a. Overall workflow for quantifying dsDNA using DEG. Using autonomous molecular calculations, a mixture of target dsDNA and DEP is heated and rapidly cooled in a test tube to produce a controlled amount of ssDNA output. A fluorescent signal is then generated via a reporter probe. b. Mechanistically, during the heating and rapid cooling process, the dsDNA target (AB) is denatured into A and B. Then, during renaturation, competition occurs between DEP (C and D) and A to hybridize with B. The net amount of ssDNA output (A) is quantified by an autonomous calculation process that compares the initial concentrations of the target and DEP. c. When [AB] ≤ [DEP], the reaction between B and DEP (i.e., the formation of BCD) is thermodynamically favorable, maximizing the yield of A. d. When [AB] > [DEP], BC and BD are generated as intermediates, which then consume A through strand displacement. e. Through this calculation process, DEG transforms the quantitative relationship between the detection signal and the target concentration from a typical sigmoid function to a single-peak function. This effectively suppresses the detection signal of false targets, thereby greatly expanding the detection window and improving the discrimination coefficient (DF).
[0211] Figure 4 The diagram shows simulation results of obtaining an expanded detection window (top) and an increased energy barrier (bottom) for activating the toehold exchange probe via DEG. The increased energy barrier can be achieved by extending the length of the reverse toehold by 2 bp.
[0212] Figure 5 The diagram shows the theoretical model of the DEG. a. A schematic diagram of all possible component reactions occurring in the DEG. b. Linearizing the complex reaction network in the DEG to 0 = RM∙reactants to extract independent equations, where RM is a stoichiometric matrix and reactants represent DNA. The rank of RM is determined to be 4, indicating that four independent equilibrium equations need to be solved. Thus, reactions [i-iv] are selected to build the mathematical model. c. Computer prediction of the yields of A and AB based on the dsDNA target concentration without probability correction. d. A schematic diagram illustrating the need for probability correction when [AB] > [DEP].
[0213] Figure 6 The simulation results for DEG are shown. In the computer simulation, for typical toehold-exchange(a) and DEG with DEP concentrations of 50, 100, 200, and 500 nM, the reaction yield varies with target concentration and The variation of the classical toehold-exchange can be considered a special case of DEG, where [DEPs] = ∞. DEG has a maximum yield, where [AB] = [DEP]. The yield of the spurious target is significantly suppressed over a wide concentration range, which can help improve specificity and expand the detection range. The discriminant factors of classical toehold-exchange (c) and DEG (d) are predicted on a computer. The detection window that distinguishes SNVs can be adjusted by changing the concentration of DEP. The robustness factors of classical toehold-exchange (e) and DEG (f) are predicted on a computer. The use of DEG dramatically increases the RF value from a finite value to infinity.
[0214] Figure 7 The experimental validation of DEG is shown below. a. The target concentrations of DEG with different DEP concentrations are plotted as experimentally determined yields (Exp) and compared with simulations (Sim). The classic toehold-exchange can be considered a special case of DEG, where [DEPs] = ∞. b. Plotting is performed using a pair of synthesized true and dummy targets for target concentrations. c. The discriminant factor determined experimentally at a concentration of 2.29 kcal / mol and compared with the target concentration simulated by computer. d. Robustness factor plotted against the target concentration and compared with computer simulation. d. Schematic diagram of the target and DEP sequences. Single nucleotide mutations were performed on the target at positions 1, 6, 14, and 17. e. Experimentally determined yields against the true and spurious targets at four specified positions carrying mutations. All experiments were performed at 37°C in 1×PBS buffer containing 1 mM Mg2+ and 20 nM toehold exchange beacons. Each error bar represents one standard deviation of a replicate analysis.
[0215] Figure 8 The theoretical concentration dependence of the discrimination factor (DF) is shown. a. The theoretical DF as a function of the target concentration of the true target relative to five theoretical spurious targets defined by their thermodynamic parameters. The reaction free energy of the spurious targets is shown in the box, its color being the same as the DF curve. b. The yield difference between a pair of true and spurious targets as a function of target concentration. c. Simulated DF by including correction using LOD.
[0216] Figure 9The following diagram illustrates the dependence of RF on reaction yield and target concentration. a. Theoretical prediction of RF value as a function of reaction yield η. b. Absolute concentration difference between sham and true targets as a function of yield. c. RF as a function of target concentration. d. Absolute concentration difference between sham and true targets as a function of target concentration at the same yield. e. RF corrected using LOD and LOL.
[0217] Figure 10 The image shows the detection window of the nucleic acid hybridization probe. ac. Through simulation calculations, the theoretical prediction was... The reaction yield, DF, and RF of a pair of true and sham targets. df. Computer analysis. Yields, DF, and RF for all possible mutations ranging from 0 to 5 kcal / mol.
[0218] Figure 11 The following shows the theoretical predictions of the yield for producing ssDNA output A from dsDNA input AB using DEG. a. Output ssDNA (A) and input dsDNA (AB) concentrations as a function of initial input concentration. The probability function is crucial for ensuring model accuracy. b. ssDNA (A) yield as a function of initial input concentration. c. The effect of DEP on DEG-generated ssDNA output. A maximum yield exists for each titration curve, where [input] = [DEP]. d. Titration curves used to analyze the correct dsDNA targets for three single nucleotide mutations. [DEP] = 500 nM.
[0219] Figure 12 As shown Corrections were made using toehold exchange reporter molecules to measure the true target and three single nucleotide mutations. Yields were predicted using the predicted ΔG for each DNA substance (left curve). A correction of -1.575 kcal / mol was required to fit the experimental results to the theoretical curve. This correction was applied to all simulations throughout the work. [AB = 10 nM, [reporter molecule] = 20 nM, theoretical ΔG predicted for all DNA substances using NUPACK software.]
[0220] Figure 13 The theoretical and experimental free radical response (RF) is shown. The theoretical RF was determined by extracting the concentrations of a pair of true and sham targets producing the same yield using Matlab software. First, the experimental data were fitted to the calibration curve using a 4-parameter nonlinear model. Then, the concentrations of a pair of true and sham targets were extracted using Matlab to determine the experimental RF. The RF at each concentration was then calculated using Equation 6 and plotted as a function of the target (true target) concentration.
[0221] Figure 14The diagram illustrates the effects of DEP and thermal scheme on DEG performance. a. Real-time fluorescence monitoring of the reporter gate kinetics to measure X generated by the DEG. + b. Yield of each reaction based on A measured by endpoint fluorescence at 20 minutes. Yield was calculated by setting the fluorescence of the positive control to 1. c. Detailed reactants and experimental procedures for each sample or control. Each sample was incubated at 37°C in 1×Tris buffer (1 mM MgSO4). 2+ The 0.1% Tween 20 (v / v) contains 10 nM AB, 20 nM reporter molecule, and 200 nM DEP. Each error bar represents one standard deviation from repeated analysis.
[0222] Figure 15 The effect of DEP on DEG performance is shown. a. Real-time fluorescence monitoring of reporter gate kinetics to measure A produced by DEG. b. Yield of each reaction based on A measured by endpoint fluorescence at 20 minutes. c. Detailed reactants and experimental procedures for each sample or control. Each error bar represents one standard deviation of the repeated analysis.
[0223] Figure 16 The diagram illustrates the optimization of the thermal protocol for the denaturation and renaturation processes. Maximum yield was achieved when all DNA material was premixed in the same tube and heated, then rapidly cooled to 4°C. a. It was found that adding DEP before (pre) or after (post) the thermal protocol significantly affected the yield of A. b. It was also found that the rapid cooling step was crucial for ensuring high yields of A. c. Maximum yield was obtained when rapidly cooling to 4°C as the final temperature. Increasing the final temperature to 25, 55, and 75°C progressively decreased the reaction yield.
[0224] Figure 17 The image shows Mg 2+ Impact on DEG performance. Each error bar represents one standard deviation of the repeated analysis.
[0225] Figure 18 The stability of the output ssDNA A generated by DEG is shown. Each error bar represents one standard deviation of the repeated analysis.
[0226] Figure 19The diagram shows the predicted signal leakage from DEP. a. Schematic diagram of signal leakage caused by the interaction between DEP and the reporter molecule. b. Predicted leakage as a function of DEP concentration (blank), also compared with target-specific fluorescence (sample). The target concentration was fixed at 10 nM, and the DEP concentration ranged from 10 nM to 5 μM. No fluorescence leakage was observed even when 1 µM DEP was applied. This indicates that there is no cross-reactivity between DEP and the probe, and therefore no competition between DEP and the probe's ssDNA output. Each error bar represents one standard deviation of the replicate analysis.
[0227] Figure 20 The diagram shows the LOD estimated using DEG for detecting AB. When a single-chain output A is generated using a 200 nM DEP, the LOD estimate is 0.5 nM. The error bars represent one standard deviation of the repeated analysis.
[0228] Figure 21 The diagram illustrates the analysis of single nucleotide mutations in the subgenome of Trichodina flavescens (TT). a. Sequences and point mutations of the TT target. b. Sequences of a pair of DEPs designed for the TT target. c. Sequence design of reporter probes using toehold exchange operations.
[0229] Figure 22 The diagram shows the experimental validation of DEG for identifying single nucleotide T>A, T>G, and T>C mutations in the 42-bp dsDNA TT target. Each error bar represents one standard deviation of a replicate analysis.
[0230] Figure 23 The figure shows a comparison between the experimentally determined yield and the simulated predicted yield using DEG analysis of T>G and T>C mutations in the double-stranded TT target.
[0231] Figure 24 The image shows a comparison of experimental measurements and simulated DF for T>G and T>C mutations in double-stranded TT targets using DEG.
[0232] Figure 25 The image shows a comparison of experimental measurements and simulated RF of T>G and T>C mutations in double-stranded TT targets using DEG.
[0233] Figure 26 The figure shows the experimental measurement of DF for the target TT-28 with different mutations.
[0234] Figure 27 The figure shows experimental RF measurements of the target TT-28 with different mutations.
[0235] Figure 28The diagram illustrates the analysis of single nucleotide mutations in the HBV S gene subgenome. a. Target sequence and point mutation. b. Sequences of a pair of DEPs designed targeting the HBV gene. c. Design of reporter probes using toehold exchange operations.
[0236] Figure 29 The diagram shows the detection of synthetic HBV targets with different mutations and insertions / deletions using DEG. The shaded area represents the detection window, where DEG outperforms the toehold exchange beacon in identifying the most challenging SNV27G.
[0237] Figure 30 The diagram shows the DF values experimentally measured using DEG for three single nucleotide mutations (SNV27C, SNV27T, and SNV27G) in a 44 bp HBV target. The shaded area represents the detection window, where DEG outperforms the toehold exchange beacon in identifying the most challenging SNV27G.
[0238] Figure 31 The figure shows the RF values measured experimentally using DEG for single nucleotide mutations in a 44 bp HBV target.
[0239] Figure 32 The diagram shows the design and sequences for nine clinically important single nucleotide variants that are common in cancer.
[0240] Figure 33 The experimentally measured yields, DF, and RF for analyzing BRAF-D594G, BRAF-V600E, EGFR-G7119A, EGFR-L858R, and EGFR-L861Q are shown. The DEG concentration was fixed at 200 nM.
[0241] Figure 34 The experimentally measured yields, DF, and RF for KRAS-G12A, KRAS-G13V, PIK3CA-H1047R, and STK11-F354L are shown. The DEG concentration was fixed at 200 nM.
[0242] Figure 35 The image shows that DEG can effectively detect mutant targets as low as 0.5% against a background of high concentrations of unmutated sequences.
[0243] Figure 36 The results show the results of simultaneously operating TT and HBV targets using two sets of DEP in the same test tube.
[0244] Figure 37 The images show sequences with different TT targets and corresponding DEP lengths to verify the length effect of the target / DEP.
[0245] Figure 38 The figures show the yield, DF, and RF of dsDNA target lengths (from 87 bp to 32 bp) measured experimentally using the corresponding DEP at a concentration of 200 nM.
[0246] Figure 39 The figure shows the experimentally measured yield, DF, and RF of the target TT-32 using DEP at concentrations of 50, 100, and 200 nM.
[0247] Figure 40 The diagram illustrates the integration of DEG and PCR. a. Schematic diagram of dsDNA analysis using a 4-DEP design. b. Experimental validation of the 4-DEP design, used to detect 87 bp dsDNA as a simulant for PCR amplicon. The outer DEP concentration was fixed at 500 nM, and the inner DEP concentration was set to 200 nM. c. Schematic diagram of DEG-PCR designed using 4-DEP. The two outer DEPs were designed identical to the PCR primers. d. Real-time monitoring of DEG-PCR using a toehold exchange reporter molecule. A wide detection window was achieved, clearly distinguishing true templates down to 10 aM from spurious targets containing a single nucleotide mutation at 1 pM. e. Schematic diagram of asymmetric PCR, followed by detection using a toehold exchange reporter molecule. f. Real-time monitoring of asymmetric PCR amplicon detection revealed a much narrower detection window than DEG-PCR; in DEG-PCR, only samples above 1 fM could be correctly distinguished.
[0248] Figure 41 The diagram illustrates the sequence design of a set of four DEPs. These DEPs target an 87 bp amplicon (AB) to detect drug resistance hotspots in *Trichoderma truncatella*. a. The scheme shows the 4-DEP design for the PCR amplicon. b. Two inner DEPs are designed to expose the ssDNA domain that can be detected by the reporter probe. To facilitate the generation of ssDNA output (A), two outer DEPs are designed with sequences identical to a pair of forward and reverse PCR primers. c. The design of the reporter probe via toehold exchange manipulation.
[0249] Figure 42 The image shows the validation of DEG for detecting ssDNA output A using a 4-DEP design.
[0250] Figure 43 The image shows DEG analysis of PCR amplicons using internal DEP concentrations ranging from 50 nM to 200 nM. This demonstrates that DEG allows for the detection of double-stranded PCR amplicons while simultaneously identifying single nucleotide mutations across a wide concentration range.
[0251] Figure 44 The image shows the application of DEG-PCR in the analysis of clinical parasite samples. a. Used for the analysis of parasites collected from fecal samples of school-aged children in rural Honduras. Trichuris trichiura The typical workflow for (TT) samples was followed, and then DEG-PCR was used for detection. b. A dual-channel design (FAM-Reporter and Cy5-Reporter) was used to simultaneously detect parasitic infection and perform drug resistance screening. PCR primers were designed to amplify nucleotides 1246-1333 in the β-tubulin gene containing codon 200. Single nucleotide A-to-T mutations at this codon are hotspots for drug resistance screening. A toehold exchange reporter molecule labeled with FAM (FAM-reporter) was used to distinguish this point mutation, while a strand substitution reporter molecule without reverse toehold (Cy5-reporter) was used to detect conserved regions near codon 200. Experimental testing of dual-channel DEG-PCR was performed using synthetic DNA standards (dots) and 13 (DR-) clinical samples (circles) as the training set (c) and 8 unknown clinical parasite samples. d. Test results were divided into three regions, defined as infection-positive and drug-resistant (DR+), infection-positive and drug-free (DR-), and infection-negative (NC). DR+ and DR- were defined using an error Eclipse with 99% confidence intervals and 2 degrees of freedom (two fluorescence channels). Eight clinical worm specimens were tested (including six Trichodinae whipworms (TT-1 to TT-6) and two Ascaris lumbricoides (AL, as a negative control)) and plotted in d.
[0252] Figure 45 The diagram shows the sequence design for DEG-PCR used to analyze clinical parasite samples. a. A pair of primers was designed using the primer design software BLAST to amplify the β-tubulin gene from 1246 bp to 1333 bp. A FAM reporter molecule (green) was designed to detect specific A-to-T mutations at codon 200 of the β-tubulin gene from 1271 to 1299 bp. A Cys5 reporter molecule (red) was designed to analyze 1301-13320 bp of the β-tubulin gene. b. Representative fluorescence kinetic curves indicating positive infection (red) and positive drug resistance (green, DR+). c. Representative fluorescence kinetic curves indicating positive infection (red) but negative drug resistance (green, DR-). d. Representative fluorescence kinetic curves showing no infection and no drug resistance.
[0253] Figure 46 The diagram shows the sequence design of DEP and two reporter molecules.
[0254] Figure 47The image shows the validation of the 4-DEP-dual reporter molecule DEG for detecting a double-stranded TT target with an A-to-T mutation at codon 200 of β-tubulin. Real-time fluorescence monitoring of the kinetics of the FAM- and Cys5-reporter molecules was used to determine the double-stranded TT target (AB) at two different sites, as shown. Figure 45 As shown, when a set of four DEPs (200 nM each) were used to detect 20 nM A, a rapid increase in fluorescence was observed in both channels.
[0255] Figure 48 The diagram shows the limits of detection (LODs) for the 4-DEP dual reporter molecule DEG used to analyze synthetic DNA targets (drug-resistant mutants with positive resistance (DR+) or wild-type drugs with negative resistance (DR-)). a. Normalized fluorescence in the FAM and Cys5 channels as a function of target concentration for detecting drug-resistant mutants. b. Fluorescence ratio in the FAM and Cys5 channels as a function of target concentration. c. Dual-channel fluorescence distribution of targets (DR+ or DR-) at 0.16, 0.31, 0.62, 1.25, 2.5, 5, 10, 20, 40, and 80 nM. The LOD for drug-resistant targets is 0.62 nM, and the LOD for drug-resistant targets is 1.25 nM. The gray shaded areas in the subplots indicate indistinguishable fluorescence distributions for DR+ and DR- targets.
[0256] Figure 49 The diagram shows the detection limits (LODs) of the 4-DEP dual reporter molecule DEG for analyzing synthetic DNA targets (using 800 nM DEP). a. Normalized fluorescence in the FAM and Cys5 channels as a function of target concentration for detecting drug-resistant positive mutants. b. Fluorescence ratio in the FAM and Cys5 channels as a function of target concentration. c. Dual-channel fluorescence distribution of targets (DR+ or DR-) at 0.16, 0.31, 0.62, 1.25, 2.5, 5, 10, 20, 40, and 80 nM. The LOD for both drug-resistant positive and negative targets is 0.62 nM. The gray shaded areas in the subplots indicate indistinguishable fluorescence distributions between DR+ and DR- targets.
[0257] Figure 50 The following figures illustrate the detection of drug-resistant mutants in the presence of different concentrations of wild-type. a. Normalized fluorescence intensity of the FAM and Cys5 channels as a function of the percentage of spiked mutants in the wild-type control. The total target concentration was fixed at 20 nM. b. Experimental and theoretical calibration curves using the FAM / Cy5 ratio as readout values. c. Linear regression of experimental calibration.
[0258] Figure 51The image shows the analysis of clinical parasite samples using dual-reporter molecule DEG-PCR. a. Normalized fluorescence intensity of the FAM and Cys5 channels as a function of the original concentration of the synthesized DNA template before PCR amplification. This template has the same subgenomic sequence as the drug-resistant mutant. b. Normalized fluorescence intensity of the FAM and Cys5 channels for clinical parasite samples (including 6 Trichoderma flavescens (TT) samples and 2 Ascaris lumbricoides (AL) samples). All TT samples were positive for infection but negative for drug resistance; while the two AL samples were negative for TT infection. Negative fluorescence intensity indicates that the fluorescence signal of AL was lower than that of the blank. Each error bar represents one standard deviation of the replicate analysis.
[0259] Figure 52 The results of clinical parasite samples were analyzed using standard PCR and subsequent polyacrylamide gel electrophoresis (PAGE). a. PAGE analysis of PCR amplicon results for standard synthetic DNA templates in the range of 1 μM to 1 pM. b. PAGE analysis of PCR amplicon results for 8 clinical parasite samples.
[0260] Figure 53 The image shows the genomic sequencing data of clinical parasites. The first row shows the DNA sequence of codons 186 to 214 of the wild-type *Trichoderma flavescens* β-tubulin gene. Codons 198 and 200 are highlighted as drug-resistant mutation hotspots. The sequences of six worm samples extracted from patients were consistent with the wild type, which is highly consistent with the diagnostic results measured using DEG-PCR. Detailed Implementation
[0261] Unless otherwise defined, all scientific and technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art.
[0262] The abbreviations used in this article and their corresponding meanings are as follows:
[0263] DEG DNA equalizer gate
[0264] DEP DNA equalizer probe
[0265] dsDNA double-stranded DNA
[0266] ssDNA single-stranded DNA
[0267] SNV (Single Nucleotide Variation)
[0268] All publications, patents, and published patent specifications cited in this article are incorporated herein in their entirety through citation.
[0269] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0270] The materials and methods used in the embodiments are as follows:
[0271] DNA oligonucleotides
[0272] The DNA oligonucleotides used in these embodiments were purchased from Integrated DNA Technologies (IDT, Coralville, IA). The DNA oligonucleotides containing fluorophores (FAM- and Cy5-) and quenchers (Iowa Blank) were purified by high-performance liquid chromatography (HPLC). Other DNA materials were used without purification. The sequences and modifications of the oligonucleotides used are listed in the table below.
[0273] Table 1 DNA Sequence Information
[0274]
[0275] Buffer conditions
[0276] DNA oligonucleotides were resuspended by dissolving them in 1×tris-EDTA (TE) buffer (10 mM Tris-HCl, pH 8.0, 1 M EDTA, Sigma) and then stored at -20°C. A 1×TE buffer containing 10 mM MgCl2 and 0.5% (v / v) TWEEN 20 (Sigma) was used as the molecular reporter buffer. A 1×PBS (pH 7.4, Sigma) containing 1 mM MgCl2 and 0.5% (v / v) TWEEN 20 was used as the reaction buffer. TWEEN 20 was used to prevent potential loss of DNA oligonucleotides during dilution and pipetting.
[0277] Preparation of fluorescent reporter molecules
[0278] All chain substitution (SDR) and toehold exchange (TER) reporter molecules were annealed in molecular reporter buffer using a BioRad T100 thermal cycler. Samples (typically a final concentration of 5 μM) were heated to 95 °C for 5 min and then gradually cooled to room temperature at a constant rate over 40 min. The quencher-to-fluorophore ratio for SDR was 1.5, while that for TER was 3. The prepared reporter molecule solutions were stored at 4 °C until use.
[0279] Mathematical model establishment
[0280] The free energies of the DNA strand and complex were estimated using NUPACK. For the thermodynamic parameter settings of DEG, the temperature was set to 4°C (in an ice-water bath), and Na... + The concentration is 0.1 M, Mg 2+ The concentration was set to 0.001 M; and the temperature for the DNA material in the Toehold exchange reaction was set to 37°C. Other parameters were left at their default settings.
[0281] Analytical solutions to the concentration-dependent equations for η, DF, and RF were calculated using a symbolic method in MATLAB (2019a, MathWorks). Matrix analysis (RM) and solving of the equilibrium equations were performed on the same platform. Numerical methods were necessary, particularly in the equation system, due to the strong coupling (third order) between variables. Boundary conditions were limited to true values and reasonable solutions (e.g., yield must be greater than 0 but less than 1). To calculate the theoretical RF values, two inverse functions were used: the first converts the yield (normalized) to the concentration of the ssDNA target; the second considers a probability function to inversely convert the ssDNA target to the corresponding dsDNA concentration. Experimental RF values were calculated by fitting a nonlinear curve function. Two-dimensional curves were plotted in Graphpad Prism 8, and three-dimensional heatmaps were generated in MATLAB.
[0282] Using DEG
[0283] Prepare an ice-water cooling bath (4°C) beforehand. Mix the double-stranded DNA target and the user-defined concentration of DNA probe in a 0.2 mL PCR tube, adjusting the volume to 100 μL. Then place the sample tube in a thermal cycler (Bio-Rad T100™) and heat to 95°C for 5 minutes (set to 10 minutes for the next step). While the sample remains at a high temperature in the thermal cycler, quickly transfer the tube and immerse it in an ice-water bath (4°C) for 2 minutes. Figure 190 μL of sample was transferred to a Corning microplate and heated for 5 minutes in a Molecular Device at 37 °C. Afterward, 10 μL of a 200 nM toehold exchange reporter molecule was added to trigger the reaction.
[0284] DEG-PCR
[0285] In a typical PCR protocol, 4 μL of DNA template, 20 μL of Taq 2×Master Mix, and appropriate concentrations (usually 500 nM) of forward and reverse primers are mixed to a final volume of 40 μL. PCR is initiated by incubation at 94°C for 3 minutes, followed by 35 cycles (denaturation at 94°C, annealing at 52°C, and extension at 72°C for 30 seconds), with a final extension at 72°C for 30 minutes. The cycle is then performed for 5 minutes in a Bio-Rad T100™ thermal cycler. For asymmetric PCR, the thermal protocol remains the same, but the primer concentrations are unbalanced (500 nM forward primer and 40 nM reverse primer). Figure 2 The PCR amplicon was then mixed with four DEPs, and the volume was adjusted to 90 μL. To avoid potential side reactions, the outer DEP (same as the primers) was set to 500 nM, and the two inner DEPs were set to 200 nM. Dual reporter molecules (separate FAM and Cy5 fluorescence channels) were added to initiate the reaction.
[0286] Time-based fluorescence studies
[0287] Real-time fluorescence data were acquired using a SpectraMax i3 microplate reader (Molecular Devices). The temperature was set to 37°C, and fluorescence was monitored for 1 hour at a frequency of 1 data point per minute. The excitation / emission wavelengths for the FAM channel were set to 485nm / 515nm, and the excitation / emission wavelengths for the Cy5 channel were set to 640nm / 675nm. The fluorescence data were normalized and analyzed according to the formula η = ((FF...) b )) / ((F m -F b The result is converted into apparent hybridization yield, where F is the fluorescence reading of the sample at equilibrium. m This indicates the maximum fluorescence observed for a 50-fold excess of true ssDNA target-to-strand displacement beacon, F b Background fluorescence is generated solely by the protected beacon. For practical purposes, equilibrium fluorescence data are collected at approximately 20–30 minutes after the reaction has roughly reached equilibrium.
[0288] STH clinical samples were analyzed using DEG-PCR.
[0289] STH worm samples were recovered from eight school-aged children in the rural region of La Chicaca, northwestern Honduras. Ethical approval was obtained from both the Honduran National Autonomous University and Brock University. The eight participants received a treatment regimen based on pamoate and ocantane salt (Conmetel) for the first three days and an albendazole treatment regimen on the fourth day. Adult worms excreted in feces were washed with saline solution and stored in 70% ethanol. After sample recovery, DNA was extracted using the Automatic Express DNA extraction system (ThermoFisher Scientific Inc.) and the commercial PrepFiler Express BTA kit, according to the manufacturer's procedures. These clinical DNA samples were then tested following a typical DEG-PCR procedure (250 nM per PCR primer; 200 nM per probe).
[0290] Using the same DEG-PCR protocol and clinical samples, two batches (two replicates per batch) of synthesized DNA templates, ranging from 1 aM to 1 pM (containing both DR(-) and DR(+)), were used to establish fluorescence distribution maps. Furthermore, to simulate a heterozygous genotype with a DR(+) mutation on only one chromosome, the WT and MT synthesized DNA templates were mixed equally at final concentrations from 1 aM to 1 pM. The complete fluorescence distribution map is shown below. Figure 10 As shown. Due to batch-to-batch PCR errors, error Eclipse was used instead of a linear fitting curve.
[0291] Polyacrylamide gel electrophoresis
[0292] 5 μL of PCR amplicon solution was mixed with loading buffer (Bio-Rad) and then loaded onto an 8% native PAGE gel to validate and evaluate the PCR procedure. Electrophoresis was driven using 110 V. The gel was then stained with ethidium bromide and imaged using a Gel Doc XR+ imaging system (Bio-Rad).
[0293] Example 1: Design Principle of DNA Equalizer Gate (DEG)
[0294] The purpose of designing the DEG is to suppress the detection signal of spurious targets by transforming the quantitative relationship between the detection signal and the target concentration, thereby maximizing the detection window used to distinguish single nucleotide variants. To quantitatively describe the detection window, the inventors introduced the robustness factor (RF), which is defined as the concentration ratio between the spurious target and the correct target that produces the same level of detection signal. Thus, the higher the RF value, the wider the detection window. Although DEG acts on dsDNA, it can also detect single-stranded DNA (ssDNA). Furthermore, when detecting single-stranded DNA (ssDNA), the concentration of the DNA equalizer probe (DEP) is close to infinity.
[0295] DEG's design is Figure 3 As shown in the diagram, the double-stranded input AB is rapidly heated to 95°C and then rapidly cooled to 0°C in a splitter gate to produce a single-stranded target A and its complementary sequence B. Figure 3 c). Then, B is consumed by DEP, which has the same sequence as A. DEP is split into two or more parts (Σ1, ...) in annihilator gate 1. Figure 3 d). Therefore, the yield (η) of A was quantified by the concentration of DEP. When the concentration of AB was less than that of DEP, A was the major product, despite competition for hybridization with B between A and DEP. When the concentration of AB was greater than that of DEP, unconsumed B would rehybridize with A in annihilator gate 2 (∑2, Figure 3 d). Therefore, the maximum yield of A exists when the concentration of AB equals the concentration of DEP. Finally, the remaining A ( ) is quantified using a toehold exchange reporter molecule designed to be sensitive to SNV. Figure 3 e). Because each DEP is designed to contain only the toehold or branching migration domain of the reporter molecule, it cannot generate a fluorescence signal in the absence of a target. With DEG, the conventional S-shaped detection curve of the hybridization probe is transformed into an asymmetric single-peak curve ( Figure 3 b).
[0296] The conversion of the quantitative relationship between the detection signal and the target concentration from an sigmoid function to an asymmetric unimodal function offers three significant advantages. First, this transformation suppresses the detection signal only at the higher concentration end. Thus, it allows for a significant expansion of the detection window without compromising sensitivity at the lower concentration end. Figure 6 Second, the detection window operation is user-definable and can be implemented at any target concentration. In principle, both true and spurious targets simultaneously achieve maximum yield in DEG units, both determined by the DEP concentration. Thus, the detection window can be determined and adjusted simply by changing the DEP concentration. Furthermore, the detection signal for true targets remains significantly higher than that for spurious targets across the entire concentration range (RF = ∞). Figure 3 (b on the right), while the detection window of a conventional probe is much narrower ( Figure 3 b is on the left side. Figure 4 Third, because the detection signal of spurious targets is significantly suppressed, the discriminant factor (DF) is significantly enhanced over a wide concentration range. Figure 2 (b on the right). At the molecular level, B acts as a competitive molecular sink for consuming A, regardless of the identity or location of the mutation, which is significantly different from existing strategies that utilize molecular sinks or reservoirs specifically designed for known mutations. A theoretical model was established to quantitatively simulate and predict the effectiveness of DEG-expanded detection windows and improved sequence selectivity, and is detailed in the next section.
[0297] Example 2: Theoretical Model of DEG
[0298] Introducing mathematical models to quantitatively analyze DEG by considering all possible responses. Figure 5 a). To determine the yield and sequence design of each DNA substance in this reaction network (( The functional relationship between the concentration of the stoichiometric matrix (SEM) and the concentration of the equalizer probe requires solving a set of eight equilibrium equations. However, the inventors found that these equations are coupled together, which is mathematically difficult to solve. Therefore, a stoichiometric matrix (RM) was introduced to help simplify the calculations. Figure 5 a), where the first four rows are listed as essential (specifically as described in Example 4, Section 4.4). Then, the basic equilibrium equations are solved numerically, where the distributions of A and AB are solved as a function of the target concentration, and... Figure 5 The drawing is performed in c.
[0299] The thermodynamically driven model successfully predicted the distributions of A and AB within the concentration range, where [AB] ≥ [DEP] ( Figure 5 c). However, it cannot simulate the thermodynamic behavior of DEG when [AB] < [DEP]. The inventors then corrected the model by introducing a probability function that considers the possible distribution of DEP on AB. Figure 5 d). Mathematically, the probability of successfully forming a DEP-B triplet (BCD) is: ( Figure 5 d). The combination of thermodynamic driving model and probability correction leads to a characteristic asymmetric unimodal curve ( Figure 5 e), which has also been experimentally confirmed.
[0300] Example 3: Computer Prediction and Experimental Verification
[0301] Using the theoretical model of this invention, a quantitative analysis of η, DF, and RF in DEG was first performed on a computer. These three key factors include target concentration, sequence design, and RF. The detection window is defined by DEP. The detection of ssDNA can also be described in the model of this invention by setting the concentration of DEP to infinity, whereby... A The yield is 100%. Figure 6 The simulation results describe the theoretical transition from ssDNA detection ([DEP]=∞) to dsDNA detection at different DEP concentrations of 50, 100, 200, and 500 nM. This differs from conventional frustrating probes (Toehold exchanges or molecular beacons) that are saturated with η above a certain target concentration. Figure 6 a) At a single target concentration, a maximum η exists in DEG, which is solely determined by DEP ([T)). max = [DEP]) is defined and is independent of sequence ( Figure 6 b). The simulation results also revealed a significant expansion of the detection window, enabling highly specific identification of single nucleotide mutations (SNPs). Figure 6 d). Improved DF levels can also be determined by the concentration of DEP ( Figure 6 d). Due to the complete suppression of η by high concentrations of SNVs, RF was observed to decrease from a finite value ( Figure 6 e) to infinity Figure 6 A significant shift in f).
[0302] exist Figure 7 The values of η, DF, and RF measured experimentally at different concentrations of synthetic dsDNA targets were plotted and compared with computer-predicted values. Experimental validation and optimization are detailed in Example 5 below. It was found that... A correction of +1.58 kcal / mol significantly improved the consistency between experimental observations and computer predictions. η and DF at specific target concentrations were calculated directly using fluorescence readings from the reporter molecule. Consistent with computer predictions, a maximum η was observed for both true and spurious targets, which was strictly defined by the concentration of DEP. Figure 7 a). As theoretically predicted, the η of the pseudo-target was significantly suppressed by DEG, and as a result, an improved DF was also observed, which is in good agreement with the simulations. Figure 7 b). RF was indirectly measured by first fitting the calibration curve using a nonlinear model, then calculating according to the definition, and then calculating according to the definition (see Part 4.2 of Example 4, Equation 8 for details). Again, an infinite RF was determined over a wide concentration range. Figure 7 c). The effectiveness and flexibility of DEG were experimentally validated using different types and locations of single nucleotide mutations, dsDNA targets of varying lengths, and nine clinically important SNVs (see Examples 6-9 for details). DEG was effective for all targets except when mutations occurred at the very edge of the dsDNA.
[0303] Example 4: Theoretical Framework and Mathematical Simulation of DEG
[0304] Concentration is a crucial variable for evaluating the sensitivity and specificity of DNA hybridization probes; however, the concentration dependence of yield, discriminant factor (DF), and robustness factor (RF) remains largely unexplored. The inventors first analyzed the concentration dependence of hybridization yield and sequence specificity over a wide concentration range. In their system, toehold exchange probes were chosen as the testing platform. To highlight the numerical relationships between variables, the inventors applied dimensionless transformations to all concentrations before derivation.
[0305] 4.1 Concentration dependence and robustness
[0306] The Toehold exchange reaction can be simplified to a bimolecular reversible reaction (Equation 1):
[0307] (Equation 1)
[0308] Where T is the target, C is a partially complementary strand of T, and P is the protecting strand of C. The thermodynamics of the toehold exchange probe can be adjusted by changing the lengths of the forward and reverse toeholds or by controlling the stoichiometry between CP and P. The free energies of each reactant and product can be calculated using NUPACK software.
[0309] Zhang and colleagues had previously defined the reaction yield as: ,in and These are the initial concentrations of T and CP, respectively. The inventors believe this definition can guide the sequence design of Toehold exchange probes, but it is not suitable for predicting the analytical behavior of probes under specified experimental conditions because the initial target concentration is usually an unknown variable in the system. In practice, the concentration of CP is fixed, and T is a variable; therefore, the inventors define the reaction yield as: The inventor also chose As a characteristic concentration of dimensionless transformation.
[0310] For a typical reversible reaction, the equilibrium constant can be determined by the reaction free energy (Equation 2) and the concentration of all nucleic acid substances following the law of conservation of mass. (Equation 2)
[0311] The inventors further made the formula for converting concentration into numerical values dimensionless, where the dimensionless target concentration is represented as τ and the target concentration of [P]0 is represented as γ (Equation 3). (Equation 3)
[0312] The concentration dependence of η can be solved using Equation 4:
[0313] (Equation 4)
[0314] when , .
[0315] To quantitatively describe and compare sequence specificity, a discriminant factor (DF) is typically used, where DF = η. 真 / η 假 Under normal circumstances, the true target ( ) and fake targets ( The equilibrium constants of all ) are not 1, and the discriminant factor (DF) is expressed as:
[0316] (Equation 5)
[0317] for( With a well-designed probe adjusted to 1, the DF formula can be simplified to:
[0318] (Equation 6)
[0319] In fact, the DF value of a pair of true and false targets is a function of sequence design (ΔG and Keq) and target concentration τ (Equations 5 and 6).
[0320] Figure 8 Mathematical predictions of the yield distribution (DF) of the true target against five spurious targets as a function of target concentration (τ) are presented. The DF values for all spurious targets containing single nucleotide mutations decrease monotonically with increasing target concentration τ. Simulated DF values reach a maximum in the low target concentration range as the spurious target yield approaches a minimum. However, when the target concentration approaches or falls below the limit of detection (LOD) of a particular analytical technique, the yield and DF values become meaningless. Despite high DF, simulations show that the absolute difference in yield between the true and spurious targets becomes very small in the concentration range τ < 0.6, making it difficult to resolve experimentally. Figure 8 (b) Therefore, the inventors modified the mathematical model by incorporating the LOD of the analysis method into the simulation. LOD can be arbitrarily defined as the minimum yield that allows an experiment to distinguish the signal generated by a real or sham target from the background. Figure 8 c shows a simulation of DF using the modified model when the dummy target becomes undetectable (LOD set to 1% yield). In practice, the inventors could also set the LOD to the minimum detectable yield of the true target.
[0321] 4.2 Robustness Factors
[0322] To quantitatively describe the detection window for identifying SNVs, the inventors mathematically defined a robustness factor (RF), which is the concentration ratio when the yields of a pair of spurious and true targets are equal. To this end, the inventors first derived the target concentration τ as a function of yield and equilibrium constant (Equation 7). Then, RF can be mathematically derived using Equation 8. (Equation 7)
[0323] (Equation 8)
[0324] In the optimal trade-off between sensitivity and specificity, With a yield of 50%, the practically useful RF can be simplified to:
[0325] (Equation 9)
[0326] The theoretical RF value increases linearly as a function of η. Figure 9 a). However, this deviates significantly from experimental observations because the absolute concentration difference (τS-τC) between the spurious and true targets becomes less significant when the yield of the hybridization method approaches 0 or 100%. Figure 9 b). To better reflect the analytical performance, the inventors considered LOD and the linear limit (LOL) to refine the model. Figure 9 e shows the corrected RF simulation by setting LOD to 1% yield and LOL to 95% yield. To understand the concentration dependence of RF, the inventors further transformed the x-axis from yield η to target concentration τ_correct ( Figure 9 ce).
[0327] 4.3 Detection window of the toehold exchange probe
[0328] To demonstrate the concentration dependence of the detection window of the toehold exchange probe, the inventors then used numerical methods in MATLAB to simulate η, DF, and RF. 42 nt synthetic DNA (see Example 6, Section 6.1) was used as the model target, and a single T-to-A mutation was introduced to generate a spurious target. The standard Gibbs free energy of each DNA substance could be calculated using NUPACK software. And therefore, the following calculation can be made for each toehold exchange reaction: : The thermodynamic difference between a pair of true and false targets can be used to... Quantitative, of which In the inventor's model system, The concentration was determined to be 2.30 kcal / mol. The yield of this synthetic sequence can then be predicted using a computer. Figure 10a) Sequence selectivity ( Figure 10 b) and concentration robustness ( Figure 10 c). As expected, all three parameters are strongly dependent on concentration ( Figure 10 (a-10c) This suggests that a well-designed and optimized toehold exchange probe may only perform well within a certain concentration range.
[0329] By further including in the model As variables, the inventors were able to model the concentration dependence of the toehold exchange probe on all possible mutations that elicit different responses in transfusion. value( Figure 10 (d-10f). The inventors' simulation results quantitatively reflect an inverse relationship between the detection window and the difficulty in identifying a particular mutation: The smaller the value, the narrower the range of concentrations that can be effectively identified. Figure 10 e).
[0330] 4.4 DNA Equalizer Gate (DEG)
[0331] DEG is designed to quantitatively convert dsDNA targets into ssDNA output in a manner with a defined detection window. To simulate this process, the inventors assumed that all reactions are thermodynamically driven and that all DNA material is in its thermodynamically stable state. Under this assumption, a set of equilibrium equations can be used to predict the concentration distribution of the newly formed DNA material. Figure 5 (The main content in section a). However, only independent equations need to be solved; otherwise, meaningless answers will be produced. To help determine the independent equilibrium equations, the inventors extracted the numerical reaction matrix (RM) from the reaction system:
[0332]
[0333] The order of the RM is 4 (verified via Matlab), which is less than the dimension of the RM. Therefore, only four independent reactions exist in this reaction system, and the inventors selected the first four reactions in the model. NUPACK was used to predict all... The values and equilibrium equations are as follows:
[0334]
[0335] Calculate the standard reaction free energy at 4℃ based on DEG's experimental conditions. In this case, a probability function is introduced into the model to quantitatively describe the probabilistic binding that occurs between the DEP and the complementary chain.
[0336] Figure 11This represents a mathematical prediction of the yield of each DNA substance at different target concentrations. Without using a probability function correction, the yield of the output DNA (A) decreases linearly as a function of the input target concentration. Figure 11 (The dashed lines in a and 11b). Through probability correction, a sharp shift occurs when [target] equals [DEP], which has also been experimentally confirmed. This shift is determined solely by the concentration of DEP, thus allowing for... Figure 11 In C, the detection window is limited, and as follows: Figure 11 The signal for suppressing the spurious target is shown in d.
[0337] The combination of the DEG model and the classic toehold exchange model enabled the inventors to accurately simulate the yield and discriminant factors against the true target and any given mutation. To simulate the RF in the DEG system, using Matlab's built-in mathematical inverse function, the reaction yield was first converted into ssDNA output concentration using the toehold exchange model, and then the ssDNA concentration was converted into dsDNA target concentration using the DEG model.
[0338] 4.5 Comparison between DEG and the increase in energy barrier used to expand the detection window
[0339] By increasing the energy barrier used to activate the probe ( Figure 4 (bottom right) or use the DEG method ( Figure 6 (upper right corner), which can expand the established detection window for identifying single nucleotide mismatches ( Figure 12 (Left side). For example, via Figure 12 The simulation results demonstrate that the inventors' DEG method performs better in terms of scalability (virtually to infinity) and is more sensitive at low concentrations.
[0340] 4.6 Parameter Correction and Fitting
[0341] 4.6.1 Correction
[0342] Zhang and colleagues previously found that, based on predictions made using NUPACK software... Corrections to the values are necessary to improve the consistency between theoretical predictions and experimental observations. Similar corrections were made in the inventors' research to improve the accuracy of mathematical predictions. Figure 12 By comparing in different Based on theoretical predictions and experimentally determined yields, a correction value of 1.575 kcal / mol was established and applied throughout the study.
[0343] 4.6.2 Determining the experimental RF through fitting
[0344] Since both calibration curves for the real and dummy targets are established using scattering data points, the experimental RF cannot be directly determined. Therefore, the inventors combined experimental fitting and mathematical transformation to solve this problem. Figure 13 First, a four-parameter nonlinear fitting method is used to fit the experimental results. A set of four parameters, including M, L, s, and E (Equation 12), will be determined through fitting. M and L represent the highest and lowest signals in the curve; E represents the target concentration between the maximum and minimum limits; and s represents the steepness of the fitted curve. Once the mathematical model is established through fitting, the inventors can convert any yield of the toehold exchange reaction into the corresponding concentration of the true or dummy target. The experimental RF can then be determined. For the DEG system, the calibration curve first needs to be divided into two parts: [target] = <[DEP] and [target] > [DEP] (Equation 12). Figure 13 ).
[0345] Nonlinear model:
[0346] (Equation 10)
[0347] M, L, s, and E are the parameters to be fitted.
[0348] Example 5: Experimental verification and optimization of DEG
[0349] A schematic diagram of the experimental steps and DNA reaction in DEG is shown below. Figure 1 As shown.
[0350] Characterizing the impact of DEP and thermal scheme on DEG performance, as follows: Figure 14 As shown, DEP and the thermal scheme are crucial for ensuring high yields of DEG used to produce single-chain outputs. This will be achieved using 1 mM Mg... 2+ Each sample containing 10 nM X, 20 nM reporter molecule and 200 nM DEP in 1×Tris buffer of 0.1% Tween 20 (v / v) was incubated at 37°C.
[0351] The impact of DEP on DEG performance is as follows: Figure 15 As shown, each DEP probe partially annihilates B and thus promotes the conversion of X to A. However, maximum yield is achieved only when both DEPs are present in the reaction.
[0352] Optimization of thermal schemes for separator and annihilator gates, such as Figure 16As shown. The maximum yield was determined when all DNA materials were premixed in the same test tube and heated, then rapidly cooled to 4°C. Specifically: a. It was found that adding DEP before or after the heating process significantly affected the yield. Premixing DEP and the target was chosen as the optimal step because it both improved the reaction yield and simplified the operation. b. It was also found that the rapid cooling step was crucial for ensuring high yields of A. c. The maximum yield was obtained when rapidly cooling to 4°C as the final temperature. It was found that increasing the final temperature to 25, 55, and 75°C gradually decreased the reaction yield.
[0353] Mg 2+ Impact on DEG performance, such as Figure 17 As shown. DEG was found in Mg 2+ It is stable in the 0-10 mM range. When Mg is increased... 2+ A slight decrease in reaction yield was observed at a concentration of 20 mM, due to the higher concentration of Mg. 2+ It may promote the formation of X by accelerating refolding.
[0354] The stability results of the output DNA A generated by DEG are as follows: Figure 18 As shown. Once generated by DEG, B is blocked by DEP and therefore cannot react with B by renaturation. To accurately quantify X via DEG and the reporter molecule, ensuring the stability of free A in the reaction mixture is crucial. The inventors monitored the concentration of A in solution after the DEG reaction at room temperature for 5 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 6 hours, 12 hours, and 24 hours. The results showed that A was highly stable, with no significant loss in the first 2 hours. In fact, the inventors analyzed A using the reporter probe within the first 30 minutes.
[0355] The predicted results of signal leakage from DEP are as follows: Figure 19 As shown. The possible source of the fluorescence background is the signal caused by the interaction between the DEP and the reporter probe. Therefore, the inventors estimated the signal leakage at different DEP concentrations. The target concentration was fixed at 10 nM, and the DEP concentration ranged from 20 nM to 5 μM. No fluorescence leakage was observed even when 1 µM DEP was applied. When using 5 µM DEP, leakage of less than 5% was observed.
[0356] Using DEG estimation to detect the LOD of X, as shown below. Figure 20 As shown in the figure. The results indicate that when a single-chain output A is generated using a 200 nM DEP, the LOD estimate is 0.5 nM.
[0357] Example 6: Detection of different single nucleotide mutations using DEG
[0358] The inventors used two components to create a target, namely the parasite *Trichodina flavescens* (…). Trichuris trichiura The analytical performance and versatility of DEG in identifying single nucleotide variants were tested by analyzing 42 bp subgenome sequences of the β-tubulin gene of hepatitis B virus (HBV) and 44 bp subgenome sequences of the S gene of hepatitis B virus (HBV). Both diseases are major threats to human health worldwide. Different types of mutations and insertions / deletions were tested using the DEG detection platform of this invention. The inventors also demonstrated the possibility of DEG multiplexing by mixing two sets of targets and corresponding DEPs in the same test tube.
[0359] 6.1. Detection of single nucleotide mutations in Trichodina flavescens
[0360] A schematic diagram analyzing single nucleotide mutations in the subgenome of Trichodina flavescens (TT) is shown below. Figure 21 As shown.
[0361] Experimental validation of DEG for identifying single nucleotide T>A, T>G, and T>C mutations in 42-bp dsDNA TT targets is as follows: Figure 22 As shown. The original fluorescence signals of the correct TT target and three single nucleotide mutations were detected at DEP concentrations of 100 nM, 200 nM, and 500 nM. Single-stranded TT targets were also analyzed directly using reporter probes, which are equivalent to the DEG system with unlimited DEP.
[0362] A comparison of the experimentally determined yield with the simulated predicted yield obtained by analyzing the T>G and T>C mutations in the double-stranded TT target using DEG is shown below. Figure 23 As shown.
[0363] Experimental measurements and simulations of DF were performed using DEG to measure T>G and T>C mutations in double-stranded TT targets, as well as for comparisons. Figure 24 As shown.
[0364] Experimental measurements and simulated RF comparisons of T>G and T>C mutations in double-stranded TT targets were performed using DEG. Figure 25 As shown.
[0365] Experimental measurements of DF for the target TT-28 with different mutations, such as Figure 26 As shown.
[0366] Experimental measurements of RF for the target TT-28 with different mutations, such as Figure 27 As shown.
[0367] 6.2. Detection of HBV single nucleotide variants
[0368] The purpose of designing double-stranded synthetic HBV S gene targets is to test the versatility of the DEG method. For example... Figure 28As shown, a pair of DEP and reporter probes were designed for this synthetic target. Single nucleotide mutations and base insertions / deletions were introduced into the system and tested using DEG. To validate the DEG method for identifying challenging single nucleotide mutations, the inventors deliberately introduced A-to-G mutations, a well-known challenging SNV, because the formation of GT wobble reduces the free energy difference between the true and false targets. The inventors found that the DEG method effectively improves the specificity and concentration robustness for analyzing such challenging SNVs compared to direct analysis using toehold exchange beacons (in [missing information - likely a specific method or specification]). Figures 29-31 (Highlighted in the middle).
[0369] 6.3 Detection of clinically important single nucleotide variants in cancer
[0370] To further demonstrate the versatility and robustness of the DEG method, the inventors designed nine sets of DEG and toehold exchange probes targeting clinically important single nucleotide variants frequently detected in cancer. Sequences and designs are as follows: Figure 32 As shown, DEG was used to analyze the performance of 9 target groups. Figure 33 and 34 As shown.
[0371] Example 7: Evaluation of DEG's detection of rare mutations
[0372] Evaluation of DEG's results in detecting rare mutations, such as Figure 35 As shown in the figure. The results indicate that DEG can effectively detect mutant targets as low as 0.5% against a background of high concentrations of unmutated sequences.
[0373] Example 8: Multiplicity of DEG
[0374] Two sets of DEPs were used simultaneously on TT and HBV targets in the same test tube. The characteristic detection curves for each target were observed, with the detection window controlled by its corresponding DEP ([DEP] = 50 nM for TT, [DEP] = 100 nM for HBV). Results are as follows: Figure 36 As shown in the figure. This experiment demonstrates that multiple DEGs can be performed in the same test tube to independently control multiple chain displacement reactions.
[0375] Example 9: Length effect of target and DEP
[0376] like Figure 37 As shown, the target / DEP length effect was verified using sequences with different TT targets and corresponding DEP lengths. Using the corresponding DEP at a concentration of 200 nM, the yield, DF, and RF of dsDNA target lengths (from 87 bp to 32 bp) were experimentally measured. The results are shown below. Figure 38As shown in the figure. These results indicate that the DEG method is applicable to targets of different lengths with minimal impact on analytical performance. Using DEP at concentrations of 50, 100, and 200 nM, the yield, DF, and RF of target TT-32 were experimentally measured, and the results are shown in the figure. Figure 39 As shown.
[0377] Example 10: Integration of DEG and PCR
[0378] In practical applications, DNA hybridization probes should be compatible with commonly used nucleic acid amplification techniques such as PCR. Since DEG acts directly on dsDNA, it is an ideal probe for analyzing dsDNA amplicons. Therefore, the inventors then demonstrated the compatibility of DEG with PCR. As proof of principle, a set of four DEPs was designed for a representative 87bp dsDNA amplicons (…). Figure 40 a), which shows complete compatibility with DEG. To avoid potential cross-reactions, two external DEP primers were specifically designed to be identical to the PCR primers ( Figure 40 c).
[0379] Figure 40 The results in d demonstrate that DEG-PCR is both highly sensitive and specific. It can detect synthetic DNA templates as low as 1 aM. More importantly, using DEG, the fluorescence signal of 1 pM spurious template containing a single nucleotide mutation was significantly suppressed, which is much lower than the fluorescence signal of 10 aM true template. Figure 40 d). Conversely, when asymmetric PCR is used to generate detectable ssDNA amplicons, followed by readout using the same Toehold-exchange reporter molecule, a much narrower detection window is observed (above 1 fM). Figure 40 e, 40f).
[0380] Example 11: DEG PCR
[0381] A schematic diagram of a sequence design of four DEPs is shown below. Figure 41 As shown. These DEPs target the 87 bp amplicon (T) to detect drug resistance hotspots in TT worms.
[0382] The detection of ssDNA A output by DEG was validated using a 4-DEP design. Figure 42 As shown. Real-time fluorescence monitoring of reporter molecule dynamics was used to measure A generated by the 4-DEP equalizer gate. All DEP concentrations were fixed at 200 nM to detect target A (mutant) with a resistance mutation at 20 nM, producing 80% fluorescence yield. The DEG method allows for the identification of single nucleotide mutations with high sequence specificity.
[0383] PCR amplicon analysis was performed using DEG with DEP concentrations ranging from 50 nM to 500 nM. Figure 43 As shown. DEG allows for the detection of double-stranded PCR amplicon while also identifying single nucleotide mutations over a wide concentration range.
[0384] Asymmetric PCR was optimized using different ratios of forward and reverse primer concentrations, such as... Figure 2 As shown. The kinetic curves show the measurement of ssDNA output generated by asymmetric PCR using a reporter probe, which employs a toehold exchange operation.
[0385] Example 12: Clinical validation of DEG-PCR
[0386] Infections caused by viruses, bacteria, and parasites pose a major threat to humanity worldwide. The widespread use of antibiotics to treat various infectious diseases (often due to underdiagnosis) has also led to drug resistance problems. Therefore, an ideal test for diagnosing infectious diseases must not only accurately detect specific pathogens but also screen for or identify drug resistance to guide treatment. To this end, the inventors designed DEG-PCR by introducing a dual reporter system that allows for the simultaneous detection of infection caused by Trichodina flavescens (TT) and screening for drug resistance. The first reporter molecule (FAM-reporter molecule), operating on the toehold exchange principle, was designed to target a specific A-to-T mutation at codon 200 of β-tubulin, a recognized hotspot for TT resistance to benzimidazole (BZ, the drug). Therefore, the fluorescence of this reporter molecule (FAM) will only turn on when drug resistance is present in TT infection (DR + TT infection). A second reporter molecule (Cys-reporter molecule), operating on a toehold-mediated strand substitution, was designed to detect TT infection. The reporter molecule has a reverse toehold of 0, making it insensitive to single nucleotide mutations, which ensures that infection can be detected regardless of the presence of SNPs. Simultaneous detection of two fluorescent channels (FAM and Cys) allows for infection detection and screening for drug resistance in a single assay.
[0387] The inventors used clinical samples collected from school-aged children living in rural areas of Honduras, where the disease is highly prevalent, to diagnose soil-borne worm (STH) infection using DEG-PCR. The inventors also used DEG-PCR to detect STH infection while simultaneously screening for drug resistance in the same assay. Figure 44 a). Design two fluorescent reporter molecules to test codons 196-203 and 206-213 of the β-tubulin gene from *Nematoda*. Figure 44 b). The single nucleotide A-to-T mutation at codon 200 of β-tubulin is a mature genetic variant used for drug resistance screening. Figure 45By including a 5-nt reverse toehold, toehold-exchange reporter molecules testing this domain (codons 196 to 203) were designed to be highly sensitive to this SNV, while reporter molecules targeting codons 206 to 213 were not designed with a reverse toehold. Both reporter molecules were labeled with spectrally different fluorescent dyes (FAM and Cy5), thus allowing for simultaneous operation in solution. Figure 46 and 47 First, dual-channel DEG-PCR was used to test different concentrations of synthetic DNA standards and 13 drug-resistant negative clinical TT samples. Figures 48-51 ) and drawn on Figure 45 In c, three regions can be defined (with 99% confidence false overlap) to represent positive infection and positive drug resistance (DR+), positive infection but negative drug resistance (DR-), and no detectable infection (NC). Six clinical parasite samples expelled from Hondrams patients treated with albendazole were tested and found to be TT positive but without drug resistance. Figure 45 d). Two clinical Ascaris samples were also tested as negative controls and were found to be TT negative. All results were compared with those obtained using microscopy (Kato-Katz) and post-PCR gel analysis (…). Figure 52 ) and DNA sequencing ( Figure 53 The diagnostic tests are consistent with those for ).
[0388] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
[0389] The foregoing embodiments and methods described in this invention may vary based on the capabilities, experience, and preferences of those skilled in the art.
[0390] Listing the steps of the method in a certain order in this invention does not constitute any restriction on the order of the method steps. SEQUENCE LISTING <110> Li Feng <120> A method, probe, and kit for detecting single nucleotide variants in DNA and their applications. <130> 1 <160> 73 <170> PatentIn version 3.5 <210> 1 <211> 42 <212> DNA <213> Artificial Sequence <400> 1 gcttcattat ctatgcagta tgtttcgtcc gtgttctcta cc 42 <210> 2 <211> 42 <212> DNA <213> Artificial Sequence <400> 2 gcttcattat ctatgcagaa tgtttcgtcc gtgttctcta cc 42 <210> 3 <211> twenty three <212> DNA <213> Artificial Sequence <400> 3 gcttcattat ctatgcagta tgt 23 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <400> 4 ttcgtccgtg ttctctacc 19 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <400> 5 ggacgaaaca tactgcatag acatgt 26 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <400> 6 acatgtctat gcagtatgt 19 <210> 7 <211> 44 <212> DNA <213> Artificial Sequence <400> 7 aaattcgcag tccccaacct ccaatcactc accaacctcc tgtc 44 <210> 8 <211> twenty two <212> DNA <213> Artificial Sequence <400> 8 aaattcgcag tccccaacct cc 22 <210> 9 <211> twenty two <212> DNA <213> Artificial Sequence <400> 9 aatcactcac caacctcctg tc 22 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <400> 10 cgcttaggtt ggtgagtgat tggaggtt 28 <210> 11 <211> twenty one <212> DNA <213> Artificial Sequence <400> 11 aatcactcac caacctaagc g 21 <210> 12 <211> 87 <212> DNA <213> Artificial Sequence <400> 12 agttcggaaa caaatatcgt aaagcgcttc attatctatg cagaatgttt cgtccgtgtt 60 ctctaccaac tggtggactgacagagt 87 <210> 13 <211> 87 <212> DNA <213> Artificial Sequence <400> 13 agttcggaaa caaatatcgt aaagcgcttc attatctatg cagtatgttt cgtccgtgtt 60 ctctaccaac tggtggactgacagagt 87 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <400> 14 agttcggaaa caaatatcgt aaagc 25 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <400> 15 actctgtcag tccaccagtt 20 <210> 16 <211> 29 <212> DNA <213> Artificial Sequence <400> 16 atgaagcgct ttacgatatt tgtttccga 29 <210> 17 <211> twenty two <212> DNA <213> Artificial Sequence <400> 17 tcggaaacaa atatcgtaaa gc 22 <210> 18 <211> 26 <212> DNA <213> Artificial Sequence <400> 18 ggacgaaaca tactgcatag acatgt 26 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <400> 19 acatgtctat gcagtatgt 19 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <400> 20 cacagtaaaa ataggtggtt ttggtctagc tacagtgaaa 40 <210> twenty one <211> 40 <212> DNA <213> Artificial Sequence <400> twenty one cacagtaaaa ataggtgatt ttggtctagc tacagtgaaa 40 <210> twenty two <211> 20 <212> DNA <213> Artificial Sequence <400> twenty two cacagtaaaa ataggtggtt 20 <210> twenty three <211> 20 <212> DNA <213> Artificial Sequence <400> twenty three ttggtctagc tacagtgaaa 20 <210> twenty four <211> 26 <212> DNA <213> Artificial Sequence <400> twenty four agaccaaaaccacctatttttcatgt 26 <210> 25 <211> 19 <212> DNA <213> Artificial Sequence <400> 25 acatgaaaaa taggtggtt 19 <210> 26 <211> 40 <212> DNA <213> Artificial Sequence <400> 26 ttggtctagc tacagagaaa tctcgatgga gtgggtccca 40 <210> 27 <211> 40 <212> DNA <213> Artificial Sequence <400> 27 ttggtctagc tacagtgaaa tctcgatgga gtgggtccca 40 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <400> 28 ttggtctagc tacagagaaa 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <400> 29 tctcgatgga gtgggtccca 20 <210> 30 <211> 26 <212> DNA <213> Artificial Sequence <400> 30 atcgagattt ctctgtagct acatgt 26 <210> 31 <211> 19 <212> DNA <213> Artificial Sequence <400> 31 acatgtagct acagagaaa 19 <210> 32 <211> 40 <212> DNA <213> Artificial Sequence <400> 32 attcaaaaag atcaaagtgc tggcctccgg tgcgttcggc 40 <210> 33 <211> 40 <212> DNA <213> Artificial Sequence <400> 33 attcaaaaag atcaaagtgc tgggctccgg tgcgttcggc 40 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <400> 34 attcaaaaag atcaaagtgc 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <400> 35 tggcctccgg tgcgttcggc 20 <210> 36 <211> 26 <212> DNA <213> Artificial Sequence <400> 36 tgtaccgcac cggaggccag cacttt 26 <210> 37 <211> 19 <212> DNA <213> Artificial Sequence <400> 37 tggcctccgg tgcggtaca 19 <210> 38 <211> 32 <212> DNA <213> Artificial Sequence <400> 38 agtttggccc gcccaaaatc tgtgatcttg ac 32 <210> 39 <211> 32 <212> DNA <213> Artificial Sequence <400> 39 agtttggcca gcccaaaatc tgtgatcttg ac 32 <210> 40 <211> 16 <212> DNA <213> Artificial Sequence <400> 40 agtttggccc gcccaa 16 <210> 41 <211> 16 <212> DNA <213> Artificial Sequence <400> 41 aatctgtgat cttgac 16 <210> 42 <211> 27 <212> DNA <213> Artificial Sequence <400> 42 acagattttg ggcgggccaa acatgta 27 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <400> 43 tacatgtttg gcccgcccaa 20 <210> 44 <211> 36 <212> DNA <213> Artificial Sequence <400> 44 attctttctc ttccgcaccc agctgtttgg ccagcc 36 <210> 45 <211> 36 <212> DNA <213> Artificial Sequence <400> 45 attctttctc ttccgcaccc agcagtttgg ccagcc 36 <210> 46 <211> 18 <212> DNA <213> Artificial Sequence <400> 46 attctttctc ttccgcac 18 <210> 47 <211> 18 <212> DNA <213> Artificial Sequence <400> 47 ccagctgttt ggccagcc 18 <210> 48 <211> twenty four <212> DNA <213> Artificial Sequence <400> 48 tgtacggcca aacagctggg tgcg 24 <210> 49 <211> 19 <212> DNA <213> Artificial Sequence <400> 49 ccagctgttt ggccgtaca 19 <210> 50 <211> 38 <212> DNA <213> Artificial Sequence <400> 50 acttgtggta gttggagctg ctggcgtagg caagagtg 38 <210> 51 <211> 38 <212> DNA <213> Artificial Sequence <400> 51 acttgtggta gttggagctg gtggcgtagg caagagtg 38 <210> 52 <211> 19 <212> DNA <213> Artificial Sequence <400> 52 acttgtggta gttggagct 19 <210> 53 <211> 19 <212> DNA <213> Artificial Sequence <400> 53 gctggcgtag gcaagagtg 19 <210> 54 <211> twenty four <212> DNA <213> Artificial Sequence <400> 54 tgtacttgcc tacgccagca gctc 24 <210> 55 <211> 19 <212> DNA <213> Artificial Sequence <400> 55 gctggcgtag gcaagtaca 19 <210> 56 <211> 38 <212> DNA <213> Artificial Sequence <400> 56 acttgtggta gttggagctg gtgtcgtagg caagagtg 38 <210> 57 <211> 38 <212> DNA <213> Artificial Sequence <400> 57 acttgtggta gttggagctg gtggcgtagg caagagtg 38 <210> 58 <211> 19 <212> DNA <213> Artificial Sequence <400> 58 acttgtggta gttggagct 19 <210> 59 <211> 19 <212> DNA <213> Artificial Sequence <400> 59 ggtgtcgtag gcaagagtg 19 <210> 60 <211> twenty four <212> DNA <213> Artificial Sequence <400> 60 tgtacttgcc tacgacacca gctc 24 <210> 61 <211> 19 <212> DNA <213> Artificial Sequence <400> 61 ggtgtcgtag gcaagtaca 19 <210> 62 <211> 40 <212> DNA <213> Artificial Sequence <400> 62 atgaatgatg cacgtcatgg tggctggaca acaaaaatgg 40 <210> 63 <211> 40 <212> DNA <213> Artificial Sequence <400> 63 atgaatgatg cacatcatgg tggctggaca acaaaaatgg 40 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <400> 64 atgaatgatg cacgtcatgg 20 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <400> 65 tggctggaca acaaaaatgg 20 <210> 66 <211> 25 <212> DNA <213> Artificial Sequence <400> 66 cagccaccat gacgtgcatc catgt 25 <210> 67 <211> 19 <212> DNA <213> Artificial Sequence <400> 67 acatggatgc acgtcatgg 19 <210> 68 <211> 34 <212> DNA <213> Artificial Sequence <400> 68 gatgatgtca tcctcgatgt ccaagaggtc ctcg 34 <210> 69 <211> 34 <212> DNA <213> Artificial Sequence <400> 69 gatgatgtca tcctcgatgt cgaagaggtc ctcg 34 <210> 70 <211> 17 <212> DNA <213> Artificial Sequence <400> 70 gatgatgtca tcctcga 17 <210> 71 <211> 17 <212> DNA <213> Artificial Sequence <400> 71 tgtccaagag gtcctcg 17 <210> 72 <211> 26 <212> DNA <213> Artificial Sequence <400> 72 ttggacatcg aggatgacat ccatgt 26 <210> 73 <211> 19 <212> DNA <213> Artificial Sequence <400> 73 gtacagatgt catcctcga 19
Claims
1. A method for detecting single nucleotide variants in DNA, comprising: Mix the DNA to be tested with the reaction system, heat to unwind, then rapidly cool. Heat the rapidly cooled mixture at 35-40°C for 1-10 minutes, and add a molecular probe for detecting single-stranded DNA to trigger the detection reaction. The reaction system contains: n DNA balancing probes: DEP-1, ..., DEP-n; Where n is an integer greater than 1; The nucleotide sequences of DEP-1, ..., DEP-n are identical to a portion of the sequence of the single-stranded DNA to be tested, and they do not overlap. Furthermore, the sequence combination of DEP-1, ..., DEP-n forms the complete sequence of the single-stranded DNA to be tested. The rapid cooling refers to cooling to 0-4°C within 1-5 minutes; The molecular probe for detecting single-stranded DNA comprises: 2m reporter probes: reporter-F1, reporter-Q1, …… reporter-F m , reporter-Q m ; Where m is an integer greater than or equal to 1; Each reporter-F consists of sequences F-S1 and F-S2, where the nucleotide sequence of F-S1 is complementary to a portion of the single-stranded DNA to be tested, and F-S2 is an arbitrary sequence unrelated to the single-stranded DNA to be tested. The nucleotide sequence of each reporter-Q is complementary to the nucleotide sequence of the corresponding reporter-F, and the length of the nucleotide sequence of reporter-Q is shorter than the length of the nucleotide sequence of the corresponding reporter-F. Furthermore, each F-S1 sequence is different and does not overlap. The methods described are not diagnostic or treatment methods for diseases.
2. The method as described in claim 1, characterized in that, The heating and unwinding temperature is 80-99℃, and the time is 1-10 minutes.
3. The method as described in claim 1, characterized in that, The n=2 sequence combination of DEP-1 and DEP-2 is the complete sequence of the single-stranded DNA to be tested.
4. The method as described in claim 1, characterized in that, The molar ratio of DEP to the DNA to be tested is 1-500:
1.
5. The method as described in claim 1, characterized in that, At least one of the F-S1 sequences is complementary to the detection site in the single-stranded DNA to be tested.
6. The method as described in claim 1, characterized in that, Each F-S1 sequence is independently 15-30 nucleotides in length; Each F-S2 sequence is independently 1-10 nucleotides in length; Each reporter-Q sequence is independently 15-25 nucleotides long; The sequence length of each reporter-Q differs from that of the reporter-Q sequence by 5-10 nucleotides.
7. The method as described in claim 1, characterized in that, Each reporter-F is labeled with a fluorescent reporter group, and each reporter-Q is labeled with a fluorescent quencher group. The fluorescent reporter groups labeled on each reporter-F are different.
8. The method as described in claim 1, characterized in that, The single nucleotide variation is a substitution, insertion, or deletion.
9. A kit for detecting single nucleotide variants in DNA, comprising probes for detecting single nucleotide variants in DNA, the probes for detecting single nucleotide variants in DNA comprising: 2m reporter probes: reporter-F1, reporter-Q1, …… reporter-F m , reporter-Q m ; in, m is an integer greater than or equal to 1; Each reporter-F consists of sequences F-S1 and F-S2, where the nucleotide sequence of F-S1 is complementary to a portion of the single-stranded DNA to be tested, and F-S2 is an arbitrary sequence unrelated to the single-stranded DNA to be tested. The nucleotide sequence of each reporter-Q is complementary to the nucleotide sequence of the corresponding reporter-F, and the length of the nucleotide sequence of reporter-Q is shorter than the length of the nucleotide sequence of the corresponding reporter-F. Furthermore, each F-S1 sequence is different and does not overlap; The kit also includes: n DNA balancing probes: DEP-1, ..., DEP-n; Where n is an integer greater than 1; The nucleotide sequences of DEP-1, ..., DEP-n are identical to partial sequences of the single-stranded DNA to be tested, and they do not overlap. Furthermore, the sequence combination of DEP-1, ..., DEP-n constitutes the complete sequence of the single-stranded DNA to be tested.
10. The kit of claim 9, wherein at least one of the F-S1 sequences is complementary to the detection site in the single-stranded DNA to be tested.
11. The kit as described in claim 9, characterized in that, Each F-S1 sequence is independently 15-30 nucleotides in length; Each F-S2 sequence is independently 1-10 nucleotides in length; Each reporter-Q sequence is independently 15-25 nucleotides long; The sequence length of each reporter-Q differs from that of the reporter-Q sequence by 5-10 nucleotides.
12. The kit as described in claim 9, characterized in that, The n=2 sequence combination of DEP-1 and DEP-2 is the complete sequence of the single-stranded DNA to be tested.
13. The kit as described in claim 9, characterized in that, The kit may also contain ingredients selected from: Mg 2+ Nucleotide protectants, one or more components in a buffer system.
14. The kit according to any one of claims 9-13, characterized in that, The reporter-F is labeled with a fluorescent reporter group, and the reporter-Q is labeled with a fluorescent quencher group.
15. A kit for detecting single nucleotide variants in *Trichoderma flavescens*, comprising probes for detecting single nucleotide variants in *Trichoderma flavescens*, wherein the probes for detecting single nucleotide variants in *Trichoderma flavescens* comprise: reporter-F and reporter-Q; wherein, Reporter-F has the nucleotide sequence shown in SEQ ID NO: 5, and reporter-Q has the nucleotide sequence shown in SEQ ID NO: 6; The kit also includes DNA balancing probes: DEP-1 and DEP-2, wherein DEP-1 has the nucleotide sequence shown in SEQ ID NO:3 and DEP-2 has the nucleotide sequence shown in SEQ ID NO:
4.
16. A kit for detecting HBV single nucleotide variants, comprising probes for detecting HBV single nucleotide variants, wherein the probes for detecting HBV single nucleotide variants comprise: reporter-F and reporter-Q, wherein, Reporter-F has the nucleotide sequence shown in SEQ ID NO: 10, and reporter-Q has the nucleotide sequence shown in SEQ ID NO: 11; The kit also includes DNA balancing probes: DEP-1 and DEP-2, wherein DEP-1 has the nucleotide sequence shown in SEQ ID NO:8 and DEP-2 has the nucleotide sequence shown in SEQ ID NO:
9.
17. A kit for detecting single nucleotide variants in *Trichoderma flavescens*, comprising probes for detecting single nucleotide variants in *Trichoderma flavescens*, wherein the probes for detecting single nucleotide variants in *Trichoderma flavescens* include: reporter-F1, reporter-Q1, reporter-F2, and reporter-Q2, wherein, reporter-F1 has the nucleotide sequence shown in SEQ ID NO: 16, reporter-Q1 has the nucleotide sequence shown in SEQ ID NO: 17, reporter-F2 has the nucleotide sequence shown in SEQ ID NO: 18, and reporter-Q2 has the nucleotide sequence shown in SEQ ID NO:
19. The kit also includes DNA balancing probes: DEP-1, DEP-2, DEP-3 and DEP-4, wherein DEP-1 has the nucleotide sequence shown in SEQ ID NO: 3, DEP-2 has the nucleotide sequence shown in SEQ ID NO: 4, DEP-3 has the nucleotide sequence shown in SEQ ID NO: 14, and DEP-4 has the nucleotide sequence shown in SEQ ID NO:
15.
18. A kit for detecting the cancer-related gene mutation BRAF-D594G, comprising probes for detecting the cancer-related gene mutation BRAF-D594G, wherein the probes for detecting the cancer-related gene mutation BRAF-D594G comprise: reporter-F and reporter-Q, wherein, Reporter-F has the nucleotide sequence shown in SEQ ID NO: 24, and reporter-Q has the nucleotide sequence shown in SEQ ID NO: 25; The kit also includes DNA balancing probes: DEP-1 and DEP-2, wherein DEP-1 has the nucleotide sequence shown in SEQ ID NO:22 and DEP-2 has the nucleotide sequence shown in SEQ ID NO:
23.
19. A kit for detecting the cancer-related gene mutation BRAF-V600E, comprising probes for detecting the cancer-related gene mutation BRAF-V600E, wherein the probes for detecting the cancer-related gene mutation BRAF-V600E comprise: reporter-F and reporter-Q, wherein, Reporter-F has the nucleotide sequence shown in SEQ ID NO: 30, and reporter-Q has the nucleotide sequence shown in SEQ ID NO: 31; The kit also includes DNA balancing probes: DEP-1 and DEP-2, wherein DEP-1 has the nucleotide sequence shown in SEQ ID NO:28 and DEP-2 has the nucleotide sequence shown in SEQ ID NO:
29.
20. A kit for detecting the cancer-related gene mutation EGFR-G719A, comprising probes for detecting the cancer-related gene mutation EGFR-G719A, wherein the probes for detecting the cancer-related gene mutation EGFR-G719A comprise: reporter-F and reporter-Q, wherein, reporter-F has the nucleotide sequence shown in SEQ ID NO:36, and reporter-Q has the nucleotide sequence shown in SEQ ID NO:37; The kit also includes DNA balancing probes: DEP-1 and DEP-2, wherein DEP-1 has the nucleotide sequence shown in SEQ ID NO:34 and DEP-2 has the nucleotide sequence shown in SEQ ID NO:
35.
21. A kit for detecting the cancer-related gene mutation EGFR-L858R, comprising probes for detecting the cancer-related gene mutation EGFR-L858R, wherein the probes for detecting the cancer-related gene mutation EGFR-L858R include: reporter-F and reporter-Q, wherein, Reporter-F has the nucleotide sequence shown in SEQ ID NO: 42, and reporter-Q has the nucleotide sequence shown in SEQ ID NO: 43; The kit also includes DNA balancing probes: DEP-1 and DEP-2, wherein DEP-1 has the nucleotide sequence shown in SEQ ID NO:40 and DEP-2 has the nucleotide sequence shown in SEQ ID NO:
41.
22. A kit for detecting the cancer-related gene mutation EGFR-L861Q, comprising a probe for detecting the cancer-related gene mutation EGFR-L861Q, wherein the probe for detecting the cancer-related gene mutation EGFR-L861Q comprises: reporter-F and reporter-Q, wherein, Reporter-F has the nucleotide sequence shown in SEQ ID NO: 48, and reporter-Q has the nucleotide sequence shown in SEQ ID NO: 49; The kit also includes DNA balancing probes: DEP-1 and DEP-2, wherein DEP-1 has the nucleotide sequence shown in SEQ ID NO:46 and DEP-2 has the nucleotide sequence shown in SEQ ID NO:
47.
23. A kit for detecting cancer-related gene mutation KRAS-G12A, comprising probes for detecting cancer-related gene mutation KRAS-G12A, wherein the probes for detecting cancer-related gene mutation KRAS-G12A include: reporter-F and reporter-Q, wherein, Reporter-F has the nucleotide sequence shown in SEQ ID NO: 54, and reporter-Q has the nucleotide sequence shown in SEQ ID NO: 55; The kit also includes DNA balancing probes: DEP-1 and DEP-2, wherein DEP-1 has the nucleotide sequence shown in SEQ ID NO:52 and DEP-2 has the nucleotide sequence shown in SEQ ID NO:
53.
24. A kit for detecting cancer-related gene mutation KRAS-G13V, comprising probes for detecting cancer-related gene mutation KRAS-G13V, wherein the probes for detecting cancer-related gene mutation KRAS-G13V comprise: reporter-F and reporter-Q, wherein, Reporter-F has the nucleotide sequence shown in SEQ ID NO: 60, and reporter-Q has the nucleotide sequence shown in SEQ ID NO: 61; The kit also includes DNA balancing probes: DEP-1 and DEP-2, wherein DEP-1 has the nucleotide sequence shown in SEQ ID NO:58 and DEP-2 has the nucleotide sequence shown in SEQ ID NO:
59.
25. A kit for detecting the cancer-related gene mutation PIK3CA-H1047R, comprising a probe for detecting the cancer-related gene mutation PIK3CA-H1047R, wherein the probe for detecting the cancer-related gene mutation PIK3CA-H1047R comprises: reporter-F and reporter-Q, wherein, Reporter-F has the nucleotide sequence shown in SEQ ID NO: 66, and reporter-Q has the nucleotide sequence shown in SEQ ID NO: 67; The kit also includes DNA balancing probes: DEP-1 and DEP-2, wherein DEP-1 has the nucleotide sequence shown in SEQ ID NO:64 and DEP-2 has the nucleotide sequence shown in SEQ ID NO:
65.
26. A kit for detecting the cancer-related gene mutation STK11-F354L, comprising a probe for detecting the cancer-related gene mutation STK11-F354L, wherein the probe for detecting the cancer-related gene mutation STK11-F354L comprises: reporter-F and reporter-Q, wherein, Reporter-F has the nucleotide sequence shown in SEQ ID NO: 72, and reporter-Q has the nucleotide sequence shown in SEQ ID NO: 73; The kit also includes DNA balancing probes: DEP-1 and DEP-2, wherein DEP-1 has the nucleotide sequence shown in SEQ ID NO:70 and DEP-2 has the nucleotide sequence shown in SEQ ID NO:
71.
27. The kit according to any one of claims 15-26, characterized in that, The reporter-F is labeled with a fluorescent reporter group, and the reporter-Q is labeled with a fluorescent quencher group.
28. The kit according to any one of claims 15-26, further comprising: Mg 2+ Nucleotide protectants, one or more components in a buffer system.
29. The use of the kit according to any one of claims 9-14 in the preparation of a product for the detection of single nucleotide variants in DNA.
30. The use of the kit according to any one of claims 9-14 in the preparation of products for the diagnosis of disease and the assessment of disease risk or the detection of pathogen infection.
31. The use of the kit according to any one of claims 9-14 in the preparation of products for screening or identifying parasite resistance.
32. The use of the kit as described in any one of claims 15, 17, 27 or 28 in the preparation of a product for the detection of single nucleotide variants in the DNA of Trichodina flavescens.
33. The use of the kit as described in any one of claims 15, 17, 27 or 28 in the preparation of products for detecting Trichodina flagellate infection.
34. The use of the kit as described in any one of claims 15, 17, 27 or 28 in the preparation of products for screening or identifying drug resistance in Trichodina flavescens.
35. The use of the kit as described in any one of claims 16, 27 or 28 in the preparation of products for the detection of HBV DNA single nucleotide variants.
36. The use of the kit as described in any one of claims 16, 27 or 28 in the preparation of products for detecting HBV infection.
37. The use of the kit as described in any one of claims 18, 27 or 28 in the preparation of a product for the detection of cancer-related gene mutations BRAF-D594G.
38. The use of the kit according to any one of claims 19, 27 or 28 in the preparation of a product for the detection of cancer-related gene mutations BRAF-V600E.
39. The use of the kit according to any one of claims 20, 27 or 28 in the preparation of a product for the detection of cancer-related gene mutation EGFR-G719A.
40. The use of the kit according to any one of claims 21, 27 or 28 in the preparation of a product for the detection of cancer-related gene mutations EGFR-L858R.
41. The use of the kit according to any one of claims 22, 27 or 28 in the preparation of a product for the detection of cancer-related gene mutations EGFR-L861Q.
42. The use of the kit as described in any one of claims 23, 27 or 28 in the preparation of a product for the detection of cancer-related gene mutations KRAS-G12A.
43. The use of the kit according to any one of claims 24, 27 or 28 in the preparation of products for the detection of cancer-related gene mutations KRAS-G13V.
44. The use of the kit according to any one of claims 25, 27 or 28 in the preparation of a product for the detection of the cancer-related gene mutation PIK3CA-H1047R.
45. The use of the kit according to any one of claims 26-28 in the preparation of a product for the detection of cancer-related gene mutation STK11-F354L.