Application of specific primer in identification of euphausia superba oil and other oils and fats

Abstract

The invention relates to application of specific primers in identification of euphausia superba oil and other oils and fats, and belongs to the technical field of food chemistry and analysis, the primers are F: 5 '-GTATTTTGACCGTGCAAAGG-3' and R: 5 '-ATAGGGTCTTATCGTCACCT-3', and the other oils and fats are salmon, tuna, cod and soybean oils and fats. According to the method, the enrichment of biological information substances in the euphausia superba oil and the separation of interference terms are realized by utilizing ionic liquid and a phase separation technology, so that the rapid identification of the euphausia superba oil is realized.

Description

Technical Field

[0001] The invention relates to the field of food chemistry and analytical technology, and in particular to the application of specific primers in identifying Antarctic krill oil and other oils and fats. Background Art

[0002] Antarctic krill oil is a marine biological oil extracted from Antarctic krill or Antarctic krill powder. It is rich in active substances such as polyunsaturated fatty acids, phospholipids and astaxanthin, and has anti-inflammatory, antioxidant and cardiovascular function improvement effects. Compared with other edible oils, Antarctic krill oil is rich in phosphatidylcholine, and the esterification method is mainly unsaturated fatty acid esterification, such as eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), which has significant advantages in transmembrane transport and active release. At the same time, the astaxanthin configuration in Antarctic krill oil is mainly left-handed, with strong antioxidant activity and anti-inflammatory effects. Therefore, Antarctic krill oil is highly recognized by consumers and is widely used in food, health products and cosmetics.

[0003] In recent years, with the rapid development of the Antarctic krill oil market, some unscrupulous vendors have imitated Antarctic krill oil by dyeing it with other cheap animal / plant oils to make huge profits, which has greatly infringed the legitimate rights and health of consumers. At present, there are few reports on the detection and identification methods of Antarctic krill oil at home and abroad, and the detection and identification methods for fish oil or plant oils are not applicable to Antarctic krill oil. The main reasons include: (1) Antarctic krill oil has unique polyunsaturated fatty acid esterified phospholipids, so it has not been degummed and other treatments, but the phospholipid components are retained. Conventional separation or enrichment methods will cause phospholipid hydration and subsequent work cannot be carried out; (2) The presence of astaxanthin in Antarctic krill oil makes the oil appear bright red or dark red, which interferes with some detection methods that rely on wavelength absorption or colorimetry, making it difficult to achieve rapid identification of Antarctic krill oil. Therefore, it is urgent to establish a processing method and detection method based on the physical and chemical characteristics of Antarctic krill oil. Summary of the invention

[0004] In view of the above technical problems, the present invention provides an application of specific primers in identifying Antarctic krill oil and other oils. The application method first designs a pair of specific primers according to the biological information of Antarctic krill, and then uses ionic liquid and phase separation technology to achieve the enrichment of biological information substances in Antarctic krill oil and the separation of interference items, thereby realizing the rapid identification of Antarctic krill oil.

[0005] The present invention is achieved through the following technical solutions:

[0006] The invention discloses an application of specific primers in distinguishing Antarctic krill oil from other oils and fats. The primers are F: 5'-GTATTTTGACCGTGCAAAGG-3', R: 5'-ATAGGGTCTTATCGTCACTT-3', and the other oils and fats are salmon, tuna, cod and soybean oils and fats.

[0007] Further, the application method is:

[0008] Step 1, preparation of solution system: stirring the oil sample to be tested and the non-polar solvent at room temperature until completely dissolved;

[0009] Step 2, enrichment and phase separation of bioinformatic substances: adding the ionic liquid to the solution system prepared in step 1, vortex mixing at room temperature, and then standing to separate the layers;

[0010] Step 3, separation and purification of bioinformatic substances: remove the non-polar layer in the above step 1, repeatedly wash the ionic liquid layer with a polar solvent, and centrifuge to retain the precipitate;

[0011] Step 4: Information recognition and identification: Use the specific primers to complete the detection and identification of the precipitated material in step 3.

[0012] Furthermore, in step 1, the non-polar solvent includes but is not limited to n-hexane, chloroform, dichloromethane, cyclohexane and petroleum ether, etc., which can be used as a solvent for oil dissolution and subsequent phase separation;

[0013] Furthermore, in step 1, the ratio of the sample to the non-polar solvent is 1:(0.5-100), the mixing temperature is 4-100° C., and the mixing method includes but is not limited to stirring, vortexing, ultrasound, etc.;

[0014] Furthermore, in step 2, the types of ionic liquids include, but are not limited to, quaternary ammonium salts (such as [TBA][Cl]), imidazoles (such as [BMIM][BF4]) and pyridines (such as [BuPy][Cl]) and the like, and their anions may be formate, acetate, tetrafluoroborate and halogen ions, etc.;

[0015] Furthermore, in step 2, the liquid mixing method includes but is not limited to stirring, vortexing, ultrasound, etc., the mixing temperature is 4 to 100° C., and the stratification method includes but is not limited to standing, centrifuging, and cooling induction, etc.;

[0016] Furthermore, in step 3, the polar solvent includes but is not limited to ethanol, isopropanol, methanol and other solvents that can effectively dissolve the ionic liquid and precipitate DNA;

[0017] Furthermore, in step four, the detection includes but is not limited to PCR, qPCR, dPCR and LAMP reactions.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] (1) Antarctic krill oil is similar to other oils (such as fish oil and vegetable oil), and contains trace amounts of bioinformatic substances (such as DNA fragments). These substances are usually present in very low concentrations in oils, and the complexity of the oil matrix hinders their separation and detection. The present invention is based on the fact that the bioinformatic substances in Antarctic krill oil are mainly negatively charged. The van der Waals surface electrostatic potential (ESP) of different ionic liquids is calculated and analyzed to complete the preliminary screening of the ionic liquids. The present invention uses the affinity of ionic liquids for bioinformatic substances and the phase separation characteristics between ionic liquids and non-polar solvents to achieve effective enrichment and separation of target substances. Choline-based ionic liquids can form hydrogen bonds with specific base pairs in DNA, thereby enhancing the stability of double-stranded DNA and improving the enrichment effect.

[0020] (2) The present invention uses a non-polar solvent to achieve phase separation. Not only does it take into account that substances such as DNA are insoluble in non-polar solvents, but also coloring substances such as astaxanthin in Antarctic krill oil can be effectively dissolved in the non-polar solvent layer to avoid interference with subsequent experiments. The ionic liquid is then repeatedly washed with a polar solvent (such as ethanol). Since the ionic liquid dissolves in the polar solvent, the insoluble precipitate is collected after centrifugation, which is mainly DNA.

[0021] (3) The present invention is based on the conservative sequence of Antarctic krill genes, and achieves specific recognition and amplification of the target sequence through primer design, which has the characteristics of high sensitivity and strong operability. In addition, combined with certain rapid color development reactions, such as LAMP, the detection of batch samples can be completed within 40 minutes. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a physical picture of phospholipid hydration caused by conventional method of treating Antarctic krill oil;

[0023] Figure 2 Schematic diagram of the calculation results of surface electrostatic potential (ESP) of different ionic liquids;

[0024] Figure 3 This is a diagram showing the effect of Antarctic krill oil being dissolved in a non-polar solvent and separated into phases using an ionic liquid;

[0025] Figure 4 This is the electrophoresis diagram of the primers specifically identifying the conserved sequence of the Antarctic krill gene, where 1 is Antarctic krill, 2 is tuna, 3 is cod, 4 is salmon, and 5 is soybean;

[0026] Figure 5 This is a result diagram of a specific implementation case, where 1 is Antarctic krill oil, 2 is tuna oil, 3 is cod oil, 4 is salmon oil, and 5 is soybean oil. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further explained below by way of embodiments, but the protection scope of the present invention is not limited in any form by the embodiments.

[0028] Example 1: Different methods of treating Antarctic krill oil lead to phospholipid hydration

[0029] This example is to demonstrate the difference between fish oil and Antarctic krill oil, and the prior art uses a simple aqueous solution to enrich the bioinformatics in oils. This method is applicable to fish oil and other vegetable oils, but not to Antarctic krill oil.

[0030] Take an appropriate amount of fish oil and Antarctic krill oil (5g) and place them in a transparent glass bottle, add an appropriate amount of water (5mL), stir well and let stand. Fish oil is rich in glycerides and can be quickly separated from the aqueous solution. Compared with fish oil, Antarctic krill oil is gelatinous at room temperature due to its high phospholipid content. After adding water, the phospholipids are easily hydrated and cannot be effectively separated. At the same time, the astaxanthin in Antarctic krill oil is red. After the phospholipids are hydrated, the astaxanthin will be unevenly dispersed in the system, which will interfere with subsequent colorimetric and other detection methods.

[0031] Example 2, specific primer design and optimization: For the 16S rRNA in the Antarctic krill gene, DNAMAN and other software were used to compare the 16S rRNA between different species, screen the conserved sequence of the Antarctic krill gene, and design relevant primers. The primer sequences here are: GTATTTTGACCGTGCAAAGG, ATAGGGTCTTATCGTCACTT. The optimized PCR conditions are: pre-denaturation at 98°C for 2 minutes, followed by denaturation at 98°C for 10 seconds, then annealing at 56°C for 15 seconds, and extension at 72°C for 4 seconds, for a total of 30 cycles. The electrophoresis diagram of the primers specifically recognizing the conserved sequence of the Antarctic krill gene is shown in Figure 4 , the target band length should be 157bp.

[0032] Example 3

[0033] The samples were Antarctic krill oil, tuna oil, cod oil, salmon oil and soybean oil.

[0034] Step 1, preparation of solution system: take 5 g of the oil sample to be tested, add 25 mL of n-hexane, and stir magnetically at 25 °C until completely dissolved;

[0035] Step 2, enrichment and phase separation of bioinformatics substances: 5 mL of ionic liquid was added to the reaction system, vortexed at 25 °C, and then allowed to stand for stratification; the surface electrostatic potential (ESP) of various ionic liquids was calculated according to quantum chemical theory, and the results are shown in Figure 2The ionic liquid [Ch][For] formed by choline cations and formate anions showed an obvious positive charge distribution, with the cationic portion accounting for 56.0%, and was preferred as the extraction solvent, which was consistent with the experimental results.

[0036] Step 3, separation and purification of bioinformatic substances: Due to the difference in polarity and density, the choline ionic liquid [Ch][For] and the n-hexane solution are separated into layers, and the coloring substances such as astaxanthin are enriched in the upper n-hexane solution, such as Figure 3 As shown, bioinformatics substances such as DNA are adsorbed in the lower layer by the choline ionic liquid [Ch][For]. After removing the n-hexane solution, the ionic liquid is repeatedly rinsed with a pre-cooled anhydrous ethanol solution, centrifuged at 12,000 rpm for 3 minutes, and the precipitate is retained;

[0037] Step 4, information identification and verification: The precipitate in step 3 was dissolved in 20 μl of TE buffer, and then 1 μl was taken for amplification using the primers and PCR reaction procedure of Example 2, and the experimental results were detected by agarose electrophoresis. Figure 5 shown.

[0038] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. The application of specific primers in distinguishing Antarctic krill oil from other oils and fats, characterized in that: The primer is F: 5'-GTATTTTGACCGTGCAAAGG-3', R: 5'-ATAGGGTCTTATCGTCACTT-3', and the other oils are salmon, tuna, cod and soybean oils.

2. The use according to claim 1, characterized in that: The application method is: Step 1, preparation of solution system: stirring the oil sample to be tested and the non-polar solvent at room temperature until completely dissolved; Step 2, enrichment and phase separation of bioinformatic substances: adding the ionic liquid to the solution system prepared in step 1, vortex mixing at room temperature, and then standing to separate the layers; Step 3, separation and purification of bioinformatic substances: remove the non-polar layer in the above step 1, repeatedly wash the ionic liquid layer with a polar solvent, and centrifuge to retain the precipitate; Step 4: Information recognition and identification: Use the specific primers to complete the detection and identification of the precipitated material in step 3.

3. The use according to claim 2, characterized in that: The non-polar solvent in step 1 includes, but is not limited to, n-hexane, chloroform, dichloromethane, cyclohexane and petroleum ether, and is a solvent used for oil dissolution and subsequent phase separation.

4. The use according to claim 2, characterized in that: In the step 1, the volume ratio of the sample to the non-polar solvent is 1:(0.5-100), the mixing temperature is 4-100° C., and the mixing method includes but is not limited to stirring, vortexing and ultrasound.

5. The use according to claim 2, characterized in that: In the step 2, the types of ionic liquids include but are not limited to quaternary ammonium salts, imidazoles and pyridines, and their anions include but are not limited to formate, acetate, tetrafluoroborate and halogen ions.

6. The use according to claim 2, characterized in that: In the step 2, the liquid mixing method includes but is not limited to stirring, vortexing and ultrasound, the mixing temperature is 4 to 100° C., and the stratification method includes but is not limited to standing, centrifuging and cooling induction.

7. The use according to claim 2, characterized in that: In step 3, the polar solvent includes but is not limited to ethanol, isopropanol and methanol.

8. The use according to claim 2, characterized in that: The detection in step 4 includes but is not limited to PCR, qPCR, dPCR and LAMP reactions.

Images