A SNP molecular marker associated with buffalo lactation traits and its application

Abstract

This invention discloses a SNP molecular marker associated with buffalo lactation traits and its application. The SNP molecular marker is located at the 51st base site of Chr2_42975096, Chr6_116041914, Chr6_116041915, Chr9_103233736, and Chr23_26490196, respectively. The nucleotide sequences of these five chromosomes are shown in SEQ ID NO. 1-5. Compared with existing technologies, this invention effectively shortens breeding time and reduces breeding costs by screening and extracting the above five SNP molecular markers associated with buffalo lactation traits and using them to breed buffalo individuals with high daily milk production.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a SNP molecular marker associated with buffalo lactation traits and its application. Background Technology

[0002] As an important source of milk, buffalo dairy products have significant economic and nutritional value worldwide.

[0003] Milk production capacity is a crucial indicator for evaluating dairy cow performance, typically including daily milk yield, milk fat percentage, milk protein percentage, lactose content, and somatic cell count. Daily milk yield is the most fundamental indicator of lactation, directly reflecting a dairy cow's production performance. Milk fat percentage and milk protein percentage affect the quality and economic benefits of dairy products, while somatic cell count is an important indicator for assessing the health of the cow's udder. Improving lactation indicators not only increases the economic benefits of dairy farms but also enhances the quality and market competitiveness of dairy products. Daily milk yield refers to the average daily milk production of a dairy cow during its lactation period. It is a vital basis for evaluating dairy cow performance and selecting superior breeds. Factors affecting daily milk yield include genetic background, feeding management, nutritional levels, and environmental conditions. Significant differences exist between different breeds and individuals in terms of genetic background; therefore, improving daily milk yield through genetic improvement has become a key objective in dairy cow breeding. Summary of the Invention

[0004] The purpose of this invention is to provide a SNP molecular marker related to the lactation trait of buffalo and its application, aiming to overcome the shortcomings of long time required to select buffalo individuals with good lactation function and high daily milk output, and low efficiency of traditional breeding.

[0005] To achieve the above objectives, the present invention provides an SNP molecular marker associated with the lactation trait of buffalo. The SNP molecular marker is located at the 51st base site of Chr2_42975096, Chr6_116041914, Chr6_116041915, Chr9_103233736, and Chr23_26490196, respectively. The nucleotide sequences of the above five chromosomes are shown in SEQ ID NO.1-5.

[0006] Chr2_42975096, as shown in EQ ID NO.1, has the following nucleotide sequence: CACCCATTTGGCAGGACCTGGAATTCTTGTTTGAAGGGAAAGAATTCTCTTCCCTGGCTTCTGTGGGGGCCTCCCACCTGGCTCCCTTCTCTCCGTTCAG(C / T)CCAGAGCACATCCCAGAGTCTAGCCATCTGGGGCTCTGCAGCTCCCTGGACCCTGAGAAAGCCCTGGACGTGCAGTTCTGAGGCTGAAGTGGGCCGGGGG;

[0007] Chr6_116041914, as shown in EQ ID NO.2, has the following nucleotide sequence: AAAGAATCCGCCTGCAATGCGGGAGACCTGGGTTCAGTCCCTGGGTTGGGAAGATCCCCTGGAGAAGGGAATGGCTACCCACTCCAGTATTCTGGCCTGG(A / G)GAATTCCATGGACTATATGGTCCATGGGTCGCAGAGTCGGACACGACTGAGTGACTCTCACTTTAGCTCTATCAGACTCTATCGTCCCCAGCCTCCAAGA;

[0008] Chr6_116041915, as shown in EQ ID NO.3, has the following nucleotide sequence: AAGAATCCGCCTGCAATGCGGGAGACCTGGGTTCAGTCCCTGGGTTGGGAAGATCCCCTGGAGAAGGGAATGGCTACCCACTCCAGTATTCTGGCCTGGA(G / A)AATTCCATGGACTATATGGTCCATGGGTCGCAGAGTCGGACACGACTGAGTGACTCTCACTTTAGCTCTATCAGACTCTATCGTCCCCAGCCTCCAAGAT;

[0009] Chr9_103233736, as shown in EQ ID NO.4, has the following nucleotide sequence: TTTTTAATGTGTTGTTGGATTCTGATTGCTAGAATTTTGTTAAGGATTTTTGCATCTATGTTCATCAGTGATATTGGCCTGTAGTTTTCTTTTTTTGTGG(C / G)ATCTTTGTCAGGTTTTGCCACTAGGGTGATGATGGCCTCATAGAATGAGTTTGGAAGTTTACCTTCCTCTGCAATTGTCTGGAAGAGTTTGAGTAGGATA;

[0010] Chr23_26490196, as shown in EQ ID NO.5, has the following nucleotide sequence: TCAACCCTTCCAATGAATATTCAGCACTGAATTCCTTTAGAATAGACCGGTTGGATCTCCTTGCAGTCCAAGGGACTCTCAAGAGTCTTCTCCAACACCA(C / G)GGTTCAAAAGCATCAATTCTCAGGCACTCAGCTTTCTTTATAATCCAACTTTCTTTTATAATCCGACAACAGGAAAAAATATAGCTTTGACTGGACGGAA.

[0011] Preferably, in the above technical solution, the SNP molecular marker is specifically located at the 51st base site of Chr2_42975096, and the 51st base site is C or T;

[0012] The SNP molecular marker is specifically located at the 51st base site of Chr6_116041914, and the 51st base site is either A or G;

[0013] The SNP molecular marker is specifically located at the 51st base site of Chr6_116041915, and the 51st base site is either G or A;

[0014] The SNP molecular marker is specifically located at the 51st base site of Chr9_103233736, and the 51st base site is C or G;

[0015] The SNP molecular marker is specifically located at the 51st base site of Chr23_26490196, and the 51st base site is C or G.

[0016] Preferably, in the above technical solution, the dominant allele at the 51st base site of Chr2_42975096 is T, and the dominant genotype is TT.

[0017] The dominant allele at the 51st base site of Chr6_116041914 is G, and the dominant genotypes are GG and AG.

[0018] The dominant allele at the 51st base site of Chr6_116041915 is G, and the dominant genotype is GA.

[0019] The dominant allele at the 51st base site of Chr9_103233736 is G, and the dominant genotypes are CG and GG.

[0020] The dominant allele at the 51st base site of Chr23_26490196 is G, and the dominant genotypes are GG and CG.

[0021] A primer set for SNP molecular markers associated with buffalo lactation traits as described above.

[0022] Preferably, in the above technical solution, the primer set includes a first primer pair, a second primer pair, a third primer pair, a fourth primer pair, and a fifth primer pair, as follows:

[0023] The first primer pair was used to amplify Chr2_42975096. The first primer pair included the forward primer SEQ ID NO.6 and the reverse primer SEQ ID NO.7.

[0024] The second primer pair is used to amplify Chr6_116041914. The second primer pair includes the forward primer SEQ ID NO.8 and the reverse primer SEQ ID NO.9.

[0025] The third primer pair was used to amplify Chr6_116041915. The third primer pair included the forward primer SEQ ID NO.10 and the reverse primer SEQ ID NO.11.

[0026] The fourth primer pair was used to amplify Chr9_103233736. The fourth primer pair included the forward primer SEQ ID NO.12 and the reverse primer SEQ ID NO.13.

[0027] The fifth primer pair was used to amplify Chr23_26490196. The fifth primer pair includes the forward primer SEQ ID NO.14 and the reverse primer SEQ ID NO.15.

[0028] The nucleotide sequence of SEQ ID NO. 6 is CCTTCCCTGGCTTCTGTGG, the nucleotide sequence of SEQ ID NO. 7 is CCATCCCACTTCCTGTTCCC, the nucleotide sequence of SEQ ID NO. 8 is GAGTCGGACACGACTGAGTG, the nucleotide sequence of SEQ ID NO. 9 is GAAGGGTCAGTGGGAACGAG, the nucleotide sequence of SEQ ID NO. 10 is AGTCCCTGGGTTGGGAAGAT, the nucleotide sequence of SEQ ID NO. 11 is GAGTCACTCAGTCGTGTCCG, the nucleotide sequence of SEQ ID NO. 12 is CCCACTTGGCCATGGTGTAT, the nucleotide sequence of SEQ ID NO. 13 is ACCCATCACAAGCACGGAAA, the nucleotide sequence of SEQ ID NO. 14 is CATCTCATCCTCTGCCGTCG, and the nucleotide sequence of SEQ ID NO. 15 is CCGTGGTGTTGGAGAAGAC.

[0029] A kit for preparing SNP molecular markers associated with buffalo lactation traits using the amplification primer set described above.

[0030] Application of an amplification primer set as described above in molecular marker-assisted breeding of buffalo.

[0031] Application of an amplification primer set as described above in the identification of milk production traits in buffalo.

[0032] A method for detecting buffalo genotypes using molecular biology techniques, the method comprising the following steps:

[0033] Amplification primers were designed based on the nucleotide sequences flanking the five SNP molecular marker sites mentioned above. Amplification was performed using individual buffalo DNA as a template. The amplification products were then subjected to first-generation sequencing. Based on the sequencing results, the individual buffalo was genotyped to identify the genotype of the individual buffalo to be tested.

[0034] A method for marker-assisted breeding of buffalo involves extracting genomic DNA from buffalo, detecting the deoxyribonucleotide at position 42975096 on chromosome 2, and determining whether the deoxyribonucleotide at position 42975096 is C or T. This determines whether the genotype of the buffalo to be tested is CC, CT, or TT. Based on the breeding goal of producing individuals with high daily milk production, buffalo with the TT gene are selected for further selection and / or breeding.

[0035] Genomic DNA was extracted from buffaloes, and the deoxynucleotide at position 116041914 on chromosome 6 was detected. The result showed that the deoxynucleotide at position 116041914 was A or G, thus determining whether the genotype of the buffalo to be tested was AA, AG, or GG. Based on the breeding goal of high daily milk production, buffaloes with the GG or AG genotype were selected for further selection and / or breeding.

[0036] Genomic DNA was extracted from buffaloes, and the deoxynucleotide at position 116041915 on chromosome 6 was detected. The deoxynucleotide at position 116041915 was determined to be G or A, thus determining the genotype of the buffaloes to be tested as GG, GA, or AA. Based on the breeding goal of high daily milk production, buffaloes with the GG, GA, or AA gene types were selected for further selection and / or breeding. The daily milk production of candidate GA type Chr6_116041915 was significantly higher than that of GG type.

[0037] Genomic DNA was extracted from buffaloes, and the deoxynucleotide at position 103233736 on chromosome 9 was detected. The result showed that the deoxynucleotide at position 103233736 was C or G, thus determining whether the genotype of the buffalo to be tested was CC, CG, or GG. Based on the breeding goal of high daily milk production, buffaloes with CG and GG genes were selected for further selection and / or breeding.

[0038] Genomic DNA was extracted from buffaloes, and the deoxynucleotide at position 26490196 on chromosome 23 was detected. The deoxynucleotide at position 26490196 was determined to be C or G, thus determining whether the genotype of the buffalo to be tested was CC, CG, or GG. Based on the breeding goal of high daily milk production, buffaloes with the GG or CG genotype were selected for further selection and / or breeding.

[0039] Compared with the prior art, the present invention has the following beneficial effects.

[0040] This invention provides five SNPs (Chr2_42975096, Chr6_116041914, Chr6_116041915, Chr9_103233736, Chr23_26490196) associated with the milk production trait in buffalo. These five SNPs are significantly correlated with the average daily milk yield of buffalo (P<0.05). Applying these five SNP molecular markers to genotypic analysis of genes associated with the milk production trait in buffalo provides a new molecular marker resource for marker-assisted selection of average daily milk yield, thereby accelerating the breeding of superior buffalo breeds. By detecting the dominant alleles or dominant genotypes at the five SNP molecular marker loci in the buffalo genomic DNA, individuals can be selected directly at the genomic level without relying on phenotypic information. This significantly improves selection efficiency, accelerates the breeding process, saves intermediate feeding costs, increases breeding efficiency, and reduces breeding costs, demonstrating broad application prospects. Attached Figure Description

[0041] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings.

[0042] Figure 1 This is a Manhattan plot of daily milk yield from the genome-wide association analysis of buffalo lactation traits in this invention;

[0043] Figure 2 This is a QQ graph of the genome-wide association analysis of buffalo lactation traits in this invention. Detailed Implementation

[0044] Although not otherwise defined, all terms used herein (including technical and scientific terms) have the same meaning as commonly understood by one of ordinary skill in the art. Terms defined in dictionaries should be interpreted as having the same meaning as disclosed in relevant technical literature and herein, and should not be interpreted in an idealized or overly formal sense.

[0045] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention. Example 1

[0046] A SNP molecular marker associated with buffalo lactation traits, wherein the phenotype of the SNP molecular marker combination reflects the average daily milk yield trait of buffalo, and the screening and development method is as follows:

[0047] (1) Data were obtained from pedigrees, production records and lactation trait records of 120 buffalo (1 local buffalo, 46 ​​crossbred buffalo, 31 buffalo, and 42 Mora buffalo) raised at the Guangxi Buffalo Research Institute in China from 2000 to 2021. Characteristic daily milk yield was defined as the highest daily milk yield in the current parity of the lactating buffalo, in kilograms.

[0048] (2) Sample collection and sequencing

[0049] Genomic DNA was extracted from blood using the phenol / chloroform method. The integrity and yield of the genomic DNA were assessed and validated using agarose gel electrophoresis.

[0050] Genomic DNA was digested with restriction endonucleases, then a sequencing adapter with a barcode was added, the samples were mixed, a small fragment library (300-400 bp) was constructed, and sequencing was performed using an Illumina HiSeq™ 2000 system (Illumina, San Diego, CA).

[0051] (3) Phenotypic data processing and analysis: The phenotypic data collected in step (1) were statistically analyzed using R software, including minimum value, maximum value, mean, and standard deviation. The results are shown in Table 1.

[0052] Table 1 Statistical Analysis of Buffalo Phenotypic Data

[0053] Number of records mean Standard deviation Minimum value Maximum value Average daily milk production / kg 65 7.16 3.39 2.60 17.70

[0054] (4) DNA extraction and sequencing: Blood samples were collected from the jugular vein of buffalo using a vacuum blood collection device. Genomic DNA was extracted using the phenol / chloroform method as described in Molecular Cloning: A Laboratory Manual IV. The purity of the DNA was tested using a UV spectrophotometer. After passing the test, the DNA was sent to Guangzhou Kiddio Biotechnology Co., Ltd. for simplified genome resequencing. The sequencing platform was Illumina HiSeq™ 2000. The sequencing data was filtered to obtain valid information. The filtering criteria were: 1) filtering out reads containing adapter sequences; 2) removing reads containing more than 10% N; 3) removing low-quality reads (the number of bases with a quality value of Q ≤ 10 accounted for more than 50% of the entire read). After obtaining valid data, further sequencing quality assessment was performed to check the error rate distribution. The sequencing error rate and accuracy are shown in Table 2.

[0055] Table 2. Statistics of buffalo genomic DNA resequencing results

[0056] numerical values Clean Data (bp) HQ Clean Data (bp) Q20（%） Q30（%） GC (%) MIN 676186676 664759766 97.56 92.61 42.11 MAX 2965862268 2892808249 98.58 95.09 43.65 MEAN 1288934542 1261925441 98.07 93.83 43.01

[0057] (5) Genome data alignment: The genome data obtained from sequencing were aligned and analyzed using bioinformatics analysis software BWA, SAMtools, and GATK. The reference genome was the fourth edition of the buffalo reference genome (GCA_003121395.1) (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_003121395.1 / ). The alignment software BWA (0.7.12) was used with the mem algorithm to align the filtered reads to the reference genome, with alignment parameters of -k32-M. After alignment, the results were marked using picard (1.129) software (MarkDuplicates, etc.), but were not filtered out. The average alignment rate of the population sample was 99.54%. See Table 3 for details.

[0058] Table 3. Statistics of buffalo genome data alignment results

[0059] Sample All Reads Single Mapped Reads Paired Mapped Reads Unmapped Reads Mapping Ratio (%) MIN 4733340 563573 3117618 18945 98.98 MAX 20758964 5963456 16107506 88660 99.61 MEAN 9023692 2755223 6227138 41331 99.54

[0060] (6) SNP Quality Control and Filtering: Variant variations refer to DNA sequence polymorphisms caused by the insertion or deletion of a single or several nucleotides at the genomic level. We used the UnifiedGenotyper module of the software GATK (3.4-46) to perform Variant detection on multiple samples of the processed alignment file. The detected variations were filtered using VariantFiltration with the following parameters: -Window 4, -filter "QD < 4.0 || FS >60.0 || MQ < 40.0", -G_filter "GQ < 20". After the above steps, a preliminary 2,012,270 SNPs were obtained.

[0061] Because rare alleles (alleles with very low frequency in the population), high deletion rates, and high heterozygosity can cause anomalies in population analysis and genome-wide association analysis (linear models are very weak at handling extreme cases), potentially leading to incorrect results from the software, a self-written Perl script was used to filter the original marker loci according to the following conditions:

[0062] 1) Removal of non-diallomorphic sites.

[0063] 2) Sites with a minor allele frequency (MAF) of less than 0.05 were removed.

[0064] 3) Remove sites with a missing rate greater than 0.5.

[0065] 4) Removal of sites with a heterozygosity ratio greater than 0.8.

[0066] Finally, 691,729 SNPs on autosomes were obtained for subsequent association analysis;

[0067] (7) Genome-wide association analysis (GWAS): Principal component analysis was performed using GCTA software, followed by association analysis using GEMMA software in combination with phenotypic and genomic SNP information. Within a certain trait, individuals whose phenotypic values ​​were discrete outside the mean ± 3 standard deviations were removed. The first three values ​​of the principal components and sex were added as covariates to the mixed linear model, as follows:

[0068] y = Xα + Qβ + Kµ + e

[0069] Where y is the phenotypic vector, X is the genotype matrix, α is the genotype effect vector, Q is the fixed effects matrix (PCA score matrix in this study), β is the fixed effects vector, K is the random effects matrix, mainly referring to the kinship matrix, µ is the random effects vector, and e is the residual vector. For each SNP locus, α is tested to see if it is 0. The probability p of α being 0 is used to measure the association between the marker genotype and the phenotype. The smaller the p value, the smaller the probability of α being 0, and the more likely the marker is to be associated with the trait.

[0070] (7) Screening and extracting SNP molecular markers associated with the daily milk yield trait of buffalo: Loci that reached a significant association level were extracted using R software, and the significance threshold was set to the Bonferroni-adjusted genome-wide significance (0.05 / 745, 490 = 6.71 × 10⁻⁶). −8 ( ), to detect meaningful correlations. Information on these sites can be found in Figure 1-2 As shown in Table 4, these traits are associated with the average daily milk yield of buffalo and can be used for the breeding of buffalo average daily milk yield traits.

[0071] In buffalo breeding, primers can be designed on the nucleotide sequences flanking the aforementioned SNP molecular markers. Blood can be collected at birth and genomic DNA can be extracted. The primers can then be used to genotype the buffalo material to be tested. Individuals with the genotype of the target trait can be retained, which can accelerate the breeding process.

[0072] Table 4 Information on 5 molecular markers

[0073] Serial ID number chromosome physical location Reference genotype variant genotype Association phenotypes Effect type Significance SNP molecular labeling before and after base fragment sequence Gene name SEQ ID NO.1 Chr2_42975096 42975096 C T Daily milk consumption Positive effect 3.59E-08 CACCCATTTGGCAGGACCTGGAATTCTTGTTTGAAGGGAAAGAATTCTCTTCCCTGGCTTCTGTGGGGGCCTCCCACCTGGCTCCCTTCTCTCCGTTCAG(C / T)CCAGAGCACATCCCAGAGTCTAGCCATCTGGGGCTCTGCAGCTCCCTGGACCCTGAGAAAGCCCTGGACGTGCAGTTCTGAGGCTGAAGTGGGCCGGGGG TULP1; TEAD3; RPL10A; FANCE; MKRN1 SEQ ID NO.2 Chr6_116041914 116041914 A G Daily milk consumption Positive effect 2.35E-08 AAAGAATCCGCCTGCAATGCGGGAGACCTGGGTTCAGTCCCTGGGTTGGGAAGATCCCCTGGAGAAGGGAATGGCTACCCACTCCAGTATTCTGGCCTGG(A / G)GAATTCCATGGACTATATGGTCCATGGGTCGCAGAGTCGGACACGACTGAGTGACTCTCACTTTAGCTCTATCAGACTCTATCGTCCCCAGCCTCCAAGA COPS8 SEQ ID NO.3 Chr6_116041915 116041915 G A Daily milk consumption Positive effect 2.35E-08 AAAGAATCCGCCTGCAATGCGGGAGACCTGGGTTCAGTCCCTGGGTTGGGAAGATCCCCTGGAGAAGGGAATGGCTACCCACTCCAGTATTCTGGCCTGGA(G / A)AATTCCATGGACTATATGGTCCATGGGTCGCAGAGTCGGACACGACTGAGTGACTCTCACTTTAGCTCTATCAGACTCTATCGTCCCCAGCCTCCAAGAT COPS8 SEQ ID NO.4 Chr9_103233736 103233736 C G Daily milk consumption Positive effect 5.27E-08 TTTTTAATGTGTTGTTGGATTCTGATTGCTAGAATTTTGTTAAGGATTTTTGCATCTATGTTCATCAGTGATATTGGCCTGTAGTTTTCTTTTTTTGTGG(C / G)ATCTTTGTCAGGTTTTGCCACTAGGGTGATGATGGCCTCATAGAATGAGTTTGGAAGTTTACCTTCCTCTGCAATTGTCTGGAAGAGTTTGAGTAGGATA OR10H4 SEQ IDNO.5 Chr23_26490196 26490196 C G Average daily milk yield Positive effect 2.10E-08 TCAACCCTTCCAATGAATATTCAGCACTGAATTCCTTTAGAATAGACCGGTTGGATCTCCTTGCAGTCCAAGGGACTCTCAAGAGTCTTCTCCAACACCA(C / G)GGTTCAAAAGCATCAATTCTCAGGCACTCAGCTTTCTTTATAATCCAACTTTCTTTTATAATCCGACAACAGGAAAAAATATAGCTTTGACTGGACGGAA None

[0074] Example 2: Application of primer sets with 5 SNP marker sites in detecting daily milk yield in buffalo

[0075] Blood was collected from the jugular vein of selected buffaloes, and genomic DNA was extracted using a blood genomic DNA extraction kit. DNA concentration was measured using a nucleic acid concentration analyzer, and DNA sample quality was determined by 1% agarose gel electrophoresis. Amplification primers were designed for the five selected candidate SNP sites (as shown in Table 5). The primer sequences are as follows:

[0076] Table 5 Primer design for 5 candidate SNP sites

[0077]

[0078] Note: In the table, F stands for forward primer and R stands for reverse primer.

[0079] Using the primers described above, PCR amplification was performed using buffalo blood genomic DNA as a template. The PCR reaction mixture consisted of 50 μL: 19 μL ddH2O, 25 μL Premix Taq™, 2.0 μL DNA template, and 2.0 μL each of primers (both upstream and downstream primers were 10 μmol / L).

[0080] PCR reaction conditions:

[0081] Pre-denaturation at 95℃ for 4 min; denaturation at 94℃ for 10 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, for a total of 35 cycles; extension at 72℃ for 5 min.

[0082] The PCR amplification products were purified using the Gel Extraction Kit from Shanghai Sangon Biotech Co., Ltd. Specific steps are detailed in the kit instructions. The purified PCR products were then sent directly to BGI Genomics (Shenzhen) Co., Ltd. for first-generation sequencing. Individual genotyping was performed based on the sequencing results. Genotyping results are shown in Table 6.

[0083] Table 6. Genotype and allele frequencies of the five candidate SNP loci in buffalo.

[0084]

[0085] As can be seen from Table 6, the C allele frequency at the Chr2_429750967 mutation site is significantly greater than the T allele frequency.

[0086] The frequency of the A allele at the Chr6_116041914 mutation site is significantly greater than that of the G allele.

[0087] The frequency of the G allele at the Chr6_116041915 mutation site is significantly greater than that of the A allele.

[0088] The frequency of the C allele at the Chr9_103233736 mutation site is significantly greater than that of the G allele.

[0089] The frequency of the G allele at the Chr23_26490196 mutation site is significantly higher than that of the G allele.

[0090] Table 7. Significant association between daily milk production from buffalo and SNP validation.

[0091]

[0092] The phenotypic values ​​of daily milk intake are expressed as "least square mean ± standard deviation". Different letters in the same column indicate significant differences (P<0.05); the same letter or no letter in the column indicates no significant differences (P>0.05); the SNP locus genotypes are arranged in the order of reference type, heterozygous type, and mutant type.

[0093] As shown in Table 7, validation revealed significant differences in the average daily milk yield of buffaloes among candidates Chr6_116041914, Chr6_116041915, Chr9_103233736, and Chr23_26490196.

[0094] The average daily milk production of Chr2_42975096 candidate TT-type buffalo individuals was significantly higher than that of CT-type or CC-type buffalo individuals;

[0095] The average daily milk production of candidate GG or AG buffalo individuals (Chr6_116041914) was significantly higher than that of AA buffalo individuals.

[0096] The average daily milk production of candidate GA buffalo individuals (Chr6_116041915) was significantly higher than that of GG buffalo individuals.

[0097] The average daily milk production of Chr9_103233736 candidate CG or GG type buffalo individuals was significantly higher than that of CC type buffalo individuals;

[0098] The average daily milk production of candidate GG or CG buffalo individuals (Chr23_26490196) was significantly higher than that of CC buffalo individuals.

[0099] It can increase milk production and can be used as a molecular marker to assist breeding for identifying the average daily milk production of buffaloes, and then applied to production.

[0100] Example 3:

[0101] A method for marker-assisted breeding of buffaloes is described, comprising the following steps: During buffalo breeding, amplification primers are designed on the nucleotide sequences flanking the five SNP molecular markers mentioned above. Blood is collected from the jugular vein of buffaloes at 3-6 months of age, and genomic DNA is extracted using a blood genomic DNA extraction kit. PCR amplification is performed using the buffalo individual DNA as a template. The amplified products are then sequenced in the first generation, and genotyping is performed based on the sequencing results. Individuals with the genotype of the target trait are retained, which can shorten the breeding cycle and accelerate the breeding speed.

[0102] The method described in this application for SNP molecular marker-assisted breeding / selective breeding of buffalo breeds or strains related to the trait of average daily milk yield can be applied. The method is as follows:

[0103] Genomic DNA was extracted from buffaloes, and the deoxynucleotide at position 42975096 on chromosome 2 was detected. The deoxynucleotide at position 42975096 was determined to be C or T, thus determining whether the genotype of the buffalo to be tested was CC, CT, or TT. Based on the breeding goal of high daily milk production, buffaloes with the TT gene were selected for the next step of selection and / or breeding.

[0104] Genomic DNA was extracted from buffaloes, and the deoxynucleotide at position 116041914 on chromosome 6 was detected. The result was determined to be either A or G, thus identifying the genotype of the buffaloes to be tested as AA, AG, or GG. Based on the breeding goal of producing individuals with high daily milk production, buffaloes with the GG or AG genotypes were selected for further selection and / or breeding.

[0105] Genomic DNA was extracted from buffaloes, and the deoxynucleotide at position 116041915 on chromosome 6 was detected. The deoxynucleotide at position 116041915 was determined to be G or A, thus determining whether the genotype of the buffalo to be tested was GG, GA, or AA. Based on the breeding goal of high daily milk production, buffaloes with the GA gene were selected for the next step of selection and / or breeding.

[0106] Genomic DNA was extracted from buffaloes, and the deoxynucleotide at position 103233736 on chromosome 9 was detected. The result showed that the deoxynucleotide at position 103233736 was C or G, thus determining the genotype of the buffalo to be tested as CC, CG, or GG. Based on the breeding goal of producing individuals with high daily milk production, buffaloes with CG or GG genes were selected for further selection and / or breeding.

[0107] Genomic DNA was extracted from buffaloes, and the deoxynucleotide at position 26490196 on chromosome 23 was detected. The result showed that the deoxynucleotide at position 26490196 was C or G, thus determining the genotype of the buffalo to be tested as CC, CG, or GG. Based on the breeding goal of producing individuals with high daily milk production, buffaloes with the GG or CG genotypes were selected for further selection and / or breeding.

[0108] This invention can be implemented in various ways and is not limited to the embodiments described. Those skilled in the art will understand that the invention can be implemented in other specific ways without changing the technical concept or essential features. Therefore, it should be understood that the embodiments described above are exemplary and not intended to limit the invention.

Claims

1. The application of an amplification primer set in buffalo-assisted breeding, characterized in that, The amplification primer set is used to amplify SNP sites associated with the milk production trait of buffalo. The SNP sites are located at the 101st base of SEQ ID NO.4, and the base is C or G. The milk production trait is the average daily milk yield, and the breeding trait is the average daily milk yield.

2. The application of an amplification primer set in the identification of buffalo lactation traits, characterized in that, The amplification primer set is used to amplify SNP sites associated with buffalo lactation traits. The SNP sites are located at the 101st base of SEQ ID NO.4, and the base is C or G. The lactation trait is the average daily milk yield.

Images