Internal reference gene of solanum melongena under verticillium wilt stress, primer and application

Abstract

The invention relates to an internal reference gene of solanum muricatum under verticillium wilt stress, a primer and application, and belongs to the technical field of solanum muricatum molecular biology. The nucleotide sequence of the reference gene Ss18SRNA is as shown in SEQ ID NO. 1. The nucleotide sequences of RT-qPCR (real-time quantitative polymerase chain reaction) amplification primers of the reference gene Ss18SRNA are as follows: a forward primer is as shown in SEQ ID NO.8; and the reverse primer is as shown in SEQ ID NO.9. The reference gene is stably and consistently expressed under different time conditions after the solanum melongena is inoculated with verticillium wilt pathogenic bacteria, can be used for analyzing and evaluating the expression condition of related functional genes under the verticillium wilt stress condition, and provides a reference gene for quantitative analysis of gene expression of solanum melongena under the verticillium wilt stress condition.

Description

Technical Field

[0001] The invention belongs to the technical field of wild eggplant molecular biology, and particularly relates to an internal reference gene and primer of wild eggplant under the stress of Verticillium wilt and application thereof. Background Art

[0002] Verticillium wilt is a very harmful plant vascular disease, which is particularly harmful to eggplant, seriously affecting the yield and quality of eggplant. Studies have shown that wild eggplant resources have a variety of disease resistance genes, but they have not been fully explored. In order to more effectively explore the Verticillium wilt resistance genes of wild eggplant, it is necessary to fully understand the mechanism of wild eggplant's resistance to Verticillium wilt, and accurate detection and analysis of the expression levels of related genes are very important for the research of the mechanism.

[0003] Real-time fluorescence quantitative PCR (RT-qPCR) has the advantages of strong specificity, high sensitivity and good repeatability. It has been widely used in many research fields of agronomy. However, the detection results of this technology are often affected by the samples, so internal reference genes are often used to calibrate the errors between samples to ensure the accuracy of the quantitative results. Internal reference genes, also known as housekeeping genes, refer to a class of genes that are always stably expressed in various tissues, organs and developmental stages of organisms. Ideal internal reference genes should be able to express stably in different tissues and cells and not be affected by the environment. If the internal reference genes are not selected properly, it may affect the accuracy of the experimental results or even lead to the opposite conclusion. However, there is currently no internal reference gene that can be stably expressed under all conditions. Therefore, for different plant materials, it is necessary to select appropriate internal reference genes according to specific experimental requirements to ensure reliable experimental results.

[0004] At present, the reference genes of wild eggplant are mainly based on reports in eggplant or Solanaceae plants, but the screening and evaluation of wild eggplant reference gene systems have not been reported, especially the lack of suitable reference genes for wild eggplant under Verticillium wilt stress. Therefore, selecting reference genes that can be stably expressed under Verticillium wilt stress is of great significance for conducting wild eggplant gene function research.

[0005] Therefore, how to overcome the shortcomings of the existing technology is an urgent problem to be solved in the field of Solanum lycopersicum molecular biology technology. Summary of the invention

[0006] The purpose of the present invention is to solve the deficiencies of the prior art and provide an internal reference gene and primer of Solanum lycopersicum under Verticillium wilt stress and application thereof.

[0007] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0008] In a first aspect, the present invention provides an internal reference gene of Solanum lycopersicum under Verticillium wilt stress, wherein the nucleotide sequence of the internal reference gene Ss18SR NA is shown in SEQ ID NO.1.

[0009] Furthermore, preferably, the nucleotide sequences of the RT-qPCR amplification primers of the internal reference gene Ss18S RNA are: the forward primer is shown in SEQ ID NO.8; and the reverse primer is shown in SEQ ID NO.9.

[0010] The second aspect of the present invention provides a method for screening the internal reference gene of Solanum lycopersicum under Verticillium wilt stress, comprising the following steps:

[0011] S1. Select 7 gene sequences that are stably expressed in transcriptome sequencing from candidate internal reference genes;

[0012] S2, designing primers for the 7 genes screened in step S1, and using the primers and Solanum oleraceum cDNA to draw a real-time fluorescence quantitative PCR standard curve to verify the specificity of the primers;

[0013] S3, extracting total RNA from the roots of wild eggplant inoculated with Verticillium wilt pathogen, reverse transcribing to synthesize first-strand cDNA, performing real-time fluorescence quantitative PCR analysis using primers designed in S2, calculating Ct values, and analyzing the expression stability of the 7 genes selected in step S1;

[0014] S4. Comprehensively determine the most stably expressed reference gene of Solanum avium under Verticillium wilt stress.

[0015] Furthermore, preferably, in step S1, the seven genes are SsCYP, SsACTIN, SsEF1, SsTUA, SsGAPDH, SsEF2, and Ss18SRNA.

[0016] Further, preferably, in step S2, the cDNA of Solanum ovata is diluted by 1, 2, 4, 8 and 16 times, and the real-time fluorescence quantitative PCR is performed using the diluted cDNA as a template;

[0017] The real-time fluorescence quantitative PCR amplification reaction system was 20 μL: including 10 μL SYBR Green super mix (2×), 2 μL diluted cDNA, 1 μL each of forward and reverse primers (10 μmol / L), and 6 μL ddHO 2 O;

[0018] Reaction procedure: pre-denaturation: 95°C for 5 min; denaturation: 95°C for 5 s, annealing: 60°C for 30 s, extension: 72°C for 30 s, 40 cycles, signal detection between 65 and 95°C, and melting curve detection after the cycle.

[0019] Further, preferably, in step S3, the real-time fluorescence quantitative PCR (RT-qPCR) amplification reaction system is 20 μL: including 10 μL SYBR Green supermix (2×), 2 μL cDNA diluted twice, 1 μL each of forward and reverse primers (10 μmol / L), and 6 μL of ddHO. 2 O;

[0020] Reaction procedure: pre-denaturation: 95°C for 5 min; denaturation: 95°C for 5 s, annealing: 60°C for 30 s, extension: 72°C for 30 s, 40 cycles, signal detection between 65 and 95°C, and melting curve detection after the cycle.

[0021] Furthermore, preferably, in step S4, the expression stability of each candidate internal reference gene is analyzed using GeNorm, NormFinder, or ReFinder methods.

[0022] The second aspect of the present invention provides the use of the internal reference gene of Solanum lycopersicum under Verticillium wilt stress in the expression analysis of functional genes related to Verticillium wilt resistance of Solanum lycopersicum under Verticillium wilt stress conditions.

[0023] The present invention also discloses the application of an internal reference gene of wild eggplant under Verticillium wilt stress, wherein the internal reference gene is Ss18SRNA, and the expression of the gene is stable and consistent under different time conditions after the wild eggplant is inoculated with the Verticillium wilt pathogen, and can be used to analyze and evaluate the expression of relevant functional genes of wild eggplant under the condition of Verticillium wilt stress, and provide a reference gene for quantitative analysis of gene expression of wild eggplant under Verticillium wilt stress.

[0024] The present invention also discloses a primer sequence of an internal reference gene of Solanum avium under Verticillium wilt stress, wherein the primer is designed based on a coding region sequence (CDS region) of the Ss18SRNA gene. Based on the coding region sequence of the Ss18SRNA and in accordance with the design principle of RT-qPCR, the parameters of the primer are as follows: a primer length of 20 to 24 bp, an annealing temperature of 55 to 65°C, a GC content of 45 to 60%, and a product size of 150 to 250 bp.

[0025] The internal reference gene screened by the present invention has extremely high expression stability, and under the stress of Verticillium wilt, the internal reference gene will not be affected by exogenous or endogenous factors and can still maintain stable expression.

[0026] Based on the transcriptome sequencing results of wild garlic mustard eggplant (the original transcriptome sequencing data has been stored in the SRA database of NCBI, data set number: PRJNA495025, website: https: / / www.ncbi.nlm.nih.gov / sra / PRJNA495025), the present invention selects 7 commonly used candidate internal reference genes, and uses three softwares such as GeNorm, NormFinder and ReFinder to analyze and verify the expression stability of the candidate genes at different times after inoculation of the Verticillium wilt pathogen from different statistical perspectives. The present invention successfully excavates the stable internal reference genes of wild eggplant under the stress of Verticillium wilt, laying a solid foundation for the large-scale study of the characteristics and functions of wild eggplant Verticillium wilt resistance-related genes in the future.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] (1) The present invention constructs primer sequences, screens out the Ss18S RNA gene as an internal reference gene, and constructs an RT-qPCR technical system for the expression of wild eggplant genes under Verticillium wilt stress, laying a foundation for the expression analysis of functional genes under Verticillium wilt stress and the study of stress mechanisms, and provides reference genes for accurate quantitative analysis of wild eggplant gene expression under Verticillium wilt stress;

[0029] (2) The present invention screened out the Ss18S RNA gene as an internal reference gene for Solanum lycopersicum under Verticillium wilt stress, which is beneficial to improving the stability and accuracy of gene expression analysis research under Verticillium wilt stress conditions, and has good practical value and scientific research application significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 is the standard curve of the internal reference gene Ss18S RNA;

[0031] Figure 2 is the melting curve of the internal reference gene Ss18sRNA;

[0032] Figure 3 is the amplification curve of the internal reference gene Ss18sRNA;

[0033] Figure 4 This is a ranking diagram of the expression stability values ​​(M) of 7 candidate internal reference genes by GeNorm software; Figure A is the highly susceptible material of Verticillium wilt, Solanum '239', and Figure B is the highly resistant material of Verticillium wilt, Solanum '197';

[0034] Figure 5 This is a graph showing the ranking of the expression stability of seven candidate internal reference genes by NormFinder software; Figure A shows the highly susceptible material to Verticillium wilt, Solanum '239', and Figure B shows the highly resistant material to Verticillium wilt, Solanum '197'.

[0035] Figure 6This is the expression analysis and verification result of SsVe 1 gene at different time points after garlic mustard eggplant was infected with pathogens; the X-axis represents different internal reference genes; the Y-axis represents the relative expression level;

[0036] Figure 7 This is the expression analysis and verification result of SsVe2 gene at different time points after garlic mustard eggplant was infected with pathogens; wherein, the X-axis represents different internal reference genes; and the Y-axis represents the relative expression level. DETAILED DESCRIPTION

[0037] The present invention is further described in detail below in conjunction with embodiments.

[0038] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product specifications are used. If the manufacturer of the materials or equipment used is not specified, they are all conventional products that can be purchased.

[0039] PDA culture medium formula: 200g potato, 20g glucose, 15-20g agar, 1000mL water, natural pH.

[0040] Formula of Cha's liquid medium: 3g sodium nitrate, 1g dipotassium hydrogen phosphate, 0.5g magnesium sulfate, 0.5g potassium chloride, 0.01g ferrous sulfate, 30g sucrose, 1000mL water, natural pH.

[0041] 1. Experimental material processing

[0042] The highly resistant material to Verticillium wilt, Solanum edulis (resource number 197 of the research group) and the highly susceptible material, Solanum daliense (resource number 239 of the research group), are existing materials. See Wu Liyan, Guo Zhixiang, Zeng Li, et al. Identification and analysis of resistance to Verticillium wilt in Yunnan wild eggplant resources at the seedling stage by artificial inoculation [J]. Journal of Plant Genetic Resources, 2017, 18(06): 1046-1054. DOI: 10.13430 / j.cnki.jpgr.2017.06.007. Identification and analysis of resistance to artificial inoculation. Solanum edulis seeds were placed in a 40-mesh nylon seed bag, first soaked in sterile water at 50-60℃ for 2h, and then treated with 500mg / L GA 3 Soak the seeds in a solution of gibberellin for 36 hours, and finally disinfect them with a 2% (m / v) NaClO solution for 10-15 minutes, and rinse them with sterile water for 3 times. Place the soaked seeds in an incubator at a temperature of 25-30°C and a humidity of 70%-75% for cultivation, and sow them in a plastic seedling pot filled with sterilized Danish peat soil matrix after germination until the seedlings grow to 3-4 true leaves.

[0043] The pathogen of Verticillium wilt is the highly pathogenic strain QZ-S of Verticillium dahliae isolated in the laboratory. This strain is an existing strain. See Wu Liyan, Guo Zhixiang, Zeng Li, et al. Identification and analysis of resistance to Verticillium wilt in Yunnan wild eggplant resources at the seedling stage by artificial inoculation [J]. Journal of Plant Genetic Resources, 2017, 18(06): 1046-1054. DOI: 10.13430 / j.cnki.jpgr.2017.06.007. The preserved Verticillium dahliae strain was placed on a PDA plate and cultured in a dark incubator at 25°C for 15 to 20 days, then transferred to Czaper liquid medium and cultured at 110 r / min and 25°C for 5 to 7 days. The cultured liquid medium was filtered through a sterile double-layer gauze with a pore size of 25 μm. The filtrate was centrifuged at 5500 r / min for 30 min. Sterile water was added to the precipitate and counted using a 16×25 hemacytometer. The concentration of the spore suspension was adjusted to 1×10 7 CFU / mL (CFU, Colony Forming Unit; CFU / mL refers to the total number of bacterial colonies contained in each milliliter of sample).

[0044] Remove the old, diseased and broken leaves of the plants, lift the seedling pot to allow the roots to be naturally injured; select seedlings of uniform size and good growth condition, and randomly divide them into 3 replicates, with 10 plants in each replicate, and use ungrafted plants as the control; put 2L of bacterial solution in a 40cm×50cm stainless steel tray, and soak the bottom of the seedling pot in the bacterial solution for 30 minutes; after soaking, filter the remaining bacterial solution through a double-layer gauze with a pore size of 25μm and collect it, and pour 50ml of the bacterial solution into each seedling pot.

[0045] Take the roots of 5 to 10 plants with the same growth conditions from the plants at 0h, 12h, and 48h after inoculation, rinse them with running water, absorb excess water with sterile filter paper, and immediately treat them with liquid nitrogen and store them at -80℃.

[0046] 2. Screening of reference genes of wild eggplant under Verticillium wilt stress:

[0047] (1) Extraction of total RNA from Solanum lycopersicum and reverse transcription to synthesize cDNA

[0048] According to the instructions of the plant RNA extraction OMEGA kit (Omega Plant RNA Kit: R6827), the total RNA of the roots of Solanum lycopersicum at different time points (0, 12, 48h) was extracted respectively. After the total RNA at each time point was tested by 1% agarose gel electrophoresis and ultra-micro spectrophotometer to determine the quality of the RNA, the reverse transcription kit TransScript All-in-one First-Strand cDNA Synthesis Super Mix: AT321 was used to reverse transcribe the RNA and synthesize cDNA, which was then stored in a refrigerator for later use.

[0049] (2) Selection of candidate internal reference genes and primer design

[0050] Commonly used reference genes were found in existing literature, and SsCYP, SsACTIN, Ss EF1, SsTUA, SsGAPDH, SsEF2 and Ss18SRNA were screened from the transcriptome data of garlic mustard eggplant (the original transcriptome sequencing data has been stored in the SRA database of NCBI, the data set number is PRJNA495025, the website is: https: / / www.ncbi.nlm.nih.gov / sra / PRJNA495025). The seven reference genes and the forward and reverse primer sequences are shown in Table 1. The primer synthesis was entrusted to Kunming Qingke Biotechnology Co., Ltd.

[0051] Table 1 Candidate internal reference genes and primer sequences

[0052]

[0053]

[0054] (3) RT-qPCR amplification reaction and primer analysis of internal reference genes

[0055] Using the cDNA obtained in (1) as a template, the cDNA of Solanum ovata was diluted 1, 2, 4, 8, and 16 times, and the diluted cDNA was used as a template for RT-qPCR analysis.

[0056] The RT-qPCR system was as follows: 10 μL 2×SYBR Green supermix, 1 μL forward primer (10 μmol / L), 1 μL reverse primer (10 μmol / L), 2 μL diluted cDNA and 6 μL ddHO 2 O, total 20 μL;

[0057] Reaction procedure: pre-denaturation: 95℃5min; denaturation: 95℃5s, annealing: 60℃30s, extension: 72℃30s, 40 cycles, signal detection between 65 and 95℃, melting curve detection after the cycle.

[0058] Three technical replicates were performed for each sample.

[0059] Then the linear relationship between the mass concentration (logarithmic value) of cDNA as template and Ct value was analyzed to obtain the correlation coefficient. The amplification efficiency (E) and correlation coefficient (R) of the primers were calculated based on the results. 2 ) and draw a standard curve. The results of RT-qPCR were analyzed by 2 －△△CT The results are shown in Table 2:

[0060] Table 2 Primer analysis of internal reference genes

[0061] Primer name <![CDATA[R 2 ]]> Amplification efficiency (%) SsCYP 0.993 105.6 SsACTIN 0.997 122.5 SsE 0.993 110.2 Ss18sRNA 0.997 97.8 STU 0.996 102.0 SsGAPDH 0.996 97.3 SsE 0.997 95.5

[0062] According to Table 2 and Figure 1-Figure 3 The results show that the correlation coefficients of the seven internal reference genes are R 2 The correlation coefficients of Ss18sRNA and Ss18sRNA were all above 0.99. Except for SsCYP, SsACTIN and SsEF1, the amplification efficiencies of the other four genes were between 90% and 105%. 2 is 0.997, and the amplification efficiency (E) is 97.8 ( Figure 1 ), the dissolution peak is between 80 and 90°C ( Figure 2 ), the expansion was good ( Figure 3 The above results show that the qRT-PCR primers designed based on the Ss18sRNA gene sequence have good specificity and high amplification efficiency, and can be used for gene expression stability analysis.

[0063] (4) Analysis of expression stability of candidate reference genes

[0064] Total RNA was extracted from the roots of wild eggplant inoculated with Verticillium wilt pathogen, and the first-strand cDNA was synthesized by reverse transcription. Real-time fluorescence quantitative PCR analysis was performed using the primers designed above, and the Ct value was calculated to analyze the expression stability of the selected 7 genes.

[0065] The real-time fluorescence quantitative PCR amplification reaction system was 20 μL: including 10 μL SYBR Green super mix (2×), 2 μL cDNA diluted twice, 1 μL each of forward and reverse primers (10 μmol / L), and 6 μL ddHO. 2 O;

[0066] Reaction program: pre-denaturation: 95°C for 5 min; denaturation: 95°C for 5 s, annealing: 60°C for 30 s, extension: 72°C for 30 s, 40 cycles.

[0067] As shown in Table 3, the Ct values ​​of the candidate internal reference genes in the RT-qPCR reaction at different times (0, 12, and 48 h) after inoculation of the Verticillium wilt pathogen (Verticillium dahliae) in two wild eggplant materials with different Verticillium wilt resistance. Based on this Ct value, GeNorm and NormFinder software were used to analyze the expression stability of the candidate internal reference genes.

[0068] Table 3 Ct values ​​of candidate reference genes in roots of wild eggplant inoculated with Verticillium wilt pathogen

[0069]

[0070] Note: hai stands for hours after inoculation.

[0071] GeNorm software analysis: In the present invention, the expression stability M value of each candidate internal reference gene was first calculated by GeNorm software. The judgment standard is that the smaller the M value, the higher the stability of the internal reference gene, and vice versa; M = 1.5 is the upper limit. Thus, the ranking of the expression stability of the seven candidate internal reference genes was obtained. Among them, the two most stable internal reference genes in Solanum oleraceum 239 are SsACTIN and SsTUA, followed by Ss18sRNA ( Figure 4 A); in Solanum lycopersicum 197, it is Ss18sRNA and SsEF2 ( Figure 4 B).

[0072] NormFinder software analysis: NormFinder software ranks the stability of 7 candidate internal reference genes based on variance analysis and introduces expression differences between different sample groups. Similar to GeNorm, the smaller the stability value M, the more stable the expression of the candidate internal reference gene. The results show that ( Figure 5 ), the 7 candidate internal reference genes in Solanum lycopersicum 239 were ranked from high to low according to the M value: SsEF2>SsGAPDH>SsEF1>SsACTIN>SsTUA>Ss18sRNA>CYP( Figure 5 A), indicating that SsCYP is the most stable, followed by Ss18sRNA. The 7 candidate internal reference genes in Solanum edulis 197 are arranged in descending order according to M value: SsTUA>SsEF1>SsACTIN>SsCYP>SsGAPDH>Ss18sRNA=SsEF2( Figure 5 B), indicating that Ss18sRNA and SsEF2 are the most stable.

[0073] ReFinder software analysis: ReFinder software is to calculate the geometric mean of the stability rankings obtained by the above two software analyses to obtain a comprehensive ranking index. The smaller the index, the higher the stability. As shown in Table 4, the most stable reference gene of Solanum 239 under Verticillium wilt stress is SsACTIN, followed by SsTUA and Ss18sRNA; while the most stable reference gene of Solanum 197 under Verticillium wilt stress is Ss18sRNA, followed by SsEF2 and SsCYP.

[0074] Table 4 RefFinder comprehensive analysis of the expression stability of candidate reference genes

[0075]

[0076]

[0077] Comprehensive analysis showed that Ss18sRNA had the highest stability among the candidate reference genes. Under Verticillium wilt stress, this reference gene would not be affected by exogenous or endogenous factors and could still maintain stable expression.

[0078] Application Example 1

[0079] The most stable Ss18sRNA and the most unstable SsEF1 of wild eggplant under the stress of Verticillium wilt pathogen were used as internal reference genes, and the transcriptome sequencing data (RNA sequencing, abbreviated as RNA-seq) of garlic mustard eggplant was used as the control. The expression of SsVe1 gene in the roots of garlic mustard eggplant before and after inoculation with Verticillium wilt pathogen (0h, 12h and 48h) was analyzed by RT-qPCR technology (RT-qPCR forward primer: tccctctcaacaacagttgcg (SEQ ID NO.16), reverse primer: tatcaaaccatttcttcactggctc (SEQ ID NO.17)). The results are shown in Tables 5 and 6. Figure 6 shown.

[0080] Table 5 Expression analysis of SsVe1 gene at different time points after garlic mustard eggplant was infected with pathogens

[0081]

[0082] from Figure 6It can be seen that after normalizing the data after the RT-qPCR experiment with Ss18sRNA as an internal reference, the expression of the SsVe1 gene in the root of the wild eggplant garlic mustard eggplant under the stress of the Verticillium wilt pathogen shows a trend of first slowly decreasing and then gradually increasing as the time after inoculation increases. This result is consistent with the transcriptome data (control); however, when the most unstable gene SsEF1 is used to normalize the data, the expression of the SsVe1 gene has been decreasing and has changed greatly during the period of 0-12hai, showing a trend of change different from the transcriptome data (control). This shows that the results of the analysis of the present invention are reliable, and Ss18sRNA is more stable as an internal reference gene under the stress of wild eggplant Verticillium wilt.

[0083] Application Example 2

[0084] The most stable Ss18sRNA and the most unstable SsEF1 of wild eggplant under the stress of Verticillium wilt pathogen were used as internal reference genes, and the transcriptome sequencing data (RNA sequencing, abbreviated as RNA-seq) of garlic mustard eggplant was used as a reference. The expression of SsVe2 gene in the roots of garlic mustard eggplant before and after inoculation with Verticillium wilt pathogen (0h, 12h and 48h) was analyzed by RT-qPCR technology (RT-qPCR forward primer: ttgaccctgggaaggttgtg (SEQ ID NO.18), reverse primer: aaaggtgaagaagaggatggtgt (SEQ ID NO.19)). The results are shown in Tables 6 and 7. Figure 7 shown.

[0085] Table 6 Expression analysis and verification of SsVe2 gene at different time points after garlic mustard eggplant was infected with pathogens

[0086]

[0087] from Figure 7 It can be seen that after normalizing the data after the RT-qPCR experiment with Ss18sRNA as the internal reference, the expression of the SsVe2 gene in the root of the wild eggplant garlic mustard eggplant under the stress of the Verticillium wilt pathogen shows a trend of first significantly decreasing and then slowly increasing as the time after inoculation increases. This result is consistent with the transcriptome data (control); when the most unstable internal reference gene SsEF1 is used to normalize the data, the expression of the SsVe2 gene changes slightly and keeps rising, showing a trend different from the transcriptome data (control). This shows that the results of the analysis of the present invention are reliable, and Ss18sRNA is more stable as an internal reference gene under the stress of wild eggplant Verticillium wilt.

[0088] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. The reference gene of Solanum avium under Verticillium wilt stress, characterized in that: The internal reference gene Ss18SRNA The nucleotide sequence is shown in SEQ ID NO.

1.

2. The reference gene of Solanum avium under Verticillium wilt stress according to claim 1, characterized in that: The internal reference gene Ss18SRNA The nucleotide sequences of the RT-qPCR amplification primers are as follows: the forward primer is shown in SEQ ID NO.8; the reverse primer is shown in SEQ ID NO.

9.

3. The method for screening the internal reference gene of Solanum lycopersicum under Verticillium wilt stress according to claim 1, characterized in that: The following steps are involved: S1. Select 7 gene sequences that are stably expressed in transcriptome sequencing from candidate internal reference genes; S2, designing primers for the 7 genes screened in step S1, and using the primers and Solanum oleraceum cDNA to draw a real-time fluorescence quantitative PCR standard curve to verify the specificity of the primers; S3, extracting total RNA from the roots of wild eggplant inoculated with Verticillium wilt pathogen, reverse transcribing to synthesize first-strand cDNA, performing real-time fluorescence quantitative PCR analysis using primers designed in S2, calculating Ct values, and analyzing the expression stability of the 7 genes selected in step S1; S4. Comprehensively determine the most stably expressed reference gene of Solanum avium under Verticillium wilt stress.

4. The method for screening internal reference genes of Solanum lycopersicum under Verticillium wilt stress according to claim 3, characterized in that: In step S1, the 7 genes are SsCYP , SsACTIN , SsE , STU , SsGAPDH , SsE , Ss18SRNA .

5. The method for screening internal reference genes of Solanum lycopersicum under Verticillium wilt stress according to claim 3, characterized in that: In step S2, the cDNA of Solanum ovata is diluted by 1, 2, 4, 8 and 16 times, and real-time fluorescence quantitative PCR is performed using the diluted cDNA as a template; The real-time fluorescence quantitative PCR amplification reaction system was 20 μL: including 10 μL SYBR Green supermix (2×), 2 μL diluted cDNA, 1 μL each of forward and reverse primers (10 μmol / L), and 6 μL ddH2O; Reaction program: pre-denaturation: 95°C 5 min; denaturation: 95°C 5 s, annealing: 60°C 30 s, extension: 72°C 30 s, 40 cycles.

6. The method for screening internal reference genes of Solanum lycopersicum under Verticillium wilt stress according to claim 3, characterized in that: In step S3, the real-time fluorescence quantitative PCR amplification reaction system is 20 μL: including 10 μL SYBR Green supermix (2×), 2 μL cDNA diluted twice, 1 μL each of forward and reverse primers (10 μmol / L), and 6 μL ddH2O; Reaction program: pre-denaturation: 95°C 5 min; denaturation: 95°C 5 s, annealing: 60°C 30 s, extension: 72°C 30 s, 40 cycles.

7. The method for screening internal reference genes of Solanum lycopersicum under Verticillium wilt stress according to claim 3, characterized in that: In step S4, the expression stability of each candidate internal reference gene is analyzed using the GeNorm, NormFinder, and ReFinder methods.

8. Use of the internal reference gene of Solanum lycopersicum under Verticillium wilt stress according to claim 1 in the expression analysis of functional genes related to Verticillium wilt resistance of Solanum lycopersicum under Verticillium wilt stress conditions.

Images