Primer and method for detecting gene editing soybean based on real-time fluorescent PCR (Polymerase Chain Reaction)

Abstract

The invention provides a primer and a method for detecting gene editing soybean based on a real-time fluorescent PCR (Polymerase Chain Reaction) technology. The soybean genotype can be rapidly and efficiently detected, the editing type can be identified, the specificity is high, the sensitivity is high, the cost is low, the detection period is short, and the application prospect is good.

Description

[0001] This application claims the priority of Chinese patent application CN202410150263.4, filed on February 2, 2024. This application cites the full text of the above Chinese patent application. Technical Field

[0002] The present invention relates to the field of molecular biology, and in particular to a primer and method for detecting gene-edited soybeans based on real-time fluorescence PCR. Background Art

[0003] Soybean is the main source of oil and protein for humans, one of the most important economic crops in the world, and the main source of vegetable oil and vegetable protein for humans. With the improvement of living standards and dietary structure, people's demand for high-quality soybean oil is growing, and cultivating high-quality soybeans has become one of the important goals of soybean breeding. Gene-edited soybeans are non-GMO crops with complex traits. Compared with traditional soybeans, this type of soybean is rich in monounsaturated fatty acids, the saturated fatty acid content is reduced by 60%, and the squeezed soybean oil does not contain trans fatty acids.

[0004] Gene editing technologies include ZFN, TANLEN, CRISPR and other technologies. CRISPR technology has become increasingly mainstream due to its simple method and low cost, and has been successfully applied to different species of animals, plants and microorganisms. Gene editing technology can not only break through genetic barriers that are difficult to solve in traditional breeding, but also achieve precise changes in specific traits, subverting the existing technical paths and breeding efficiency of genetic improvement of animals and plants. With the continuous improvement of gene editing technology and its wide application in animals and plants, researchers around the world have made a large number of edits to the genomes of plants and animals of different species, created new mutations, and promoted the progress of animal and plant breeding.

[0005] Real-time fluorescence PCR detection method is a detection method developed in 1996 based on qualitative PCR. Because this method adds a TaqMan probe at the same time as PCR, it can more effectively avoid nonspecific amplification and false positive phenomena that cannot be avoided in qualitative PCR. This method has been widely used in medicine. In recent years, this method has also been applied to the quantitative detection of genetically modified products.

[0006] The present invention provides a primer and method for detecting gene-edited soybeans based on real-time fluorescence PCR detection technology, which can identify and screen the gene-edited soybeans after gene editing, transfer and aggregate specific beneficial genes, save costs, and increase the accuracy and efficiency of selection. Summary of the invention

[0007] The present invention aims to provide a quick and convenient primer and method for detecting soybean genotypes based on real-time fluorescence PCR technology, which has the characteristics of high specificity and high sensitivity, low cost, short detection cycle and good application prospects.

[0008] In one aspect, the present invention provides a real-time fluorescent PCR primer set for detecting gene-edited soybeans, wherein the primer set is selected from any one or more of the following (i)-(ii):

[0009] (i) a first primer set, comprising a first specific primer, a second specific primer and a first probe, wherein the nucleotide sequence of the first specific primer is shown in SEQ ID No.1, the nucleotide sequence of the second specific primer is shown in SEQ ID No.2; and the nucleotide sequence of the first probe is shown in SEQ ID No.3;

[0010] (ii) a second primer set, comprising a third specific primer, a fourth specific primer and a second probe, wherein the nucleotide sequence of the third specific primer is shown in SEQ ID No.4, the nucleotide sequence of the fourth specific primer is shown in SEQ ID No.5; and the nucleotide sequence of the second probe is shown in SEQ ID No.6.

[0011] In a preferred embodiment, the nucleotide sequence of the first specific primer is such as SEQ ID No.1, the nucleotide sequence of the second specific primer is such as SEQ ID No.2, and the nucleotide sequence of the first probe is such as SEQ ID No.3.

[0012] In a preferred embodiment, the nucleotide sequence of the first specific primer is such as SEQ ID No.17, the nucleotide sequence of the second specific primer is such as SEQ ID No.18, and the nucleotide sequence of the first probe is such as SEQ ID No.15.

[0013] In a preferred embodiment, the nucleotide sequence of the first specific primer is such as SEQ ID No.17, the nucleotide sequence of the second specific primer is such as SEQ ID No.18, and the nucleotide sequence of the first probe is such as SEQ ID No.16.

[0014] In a preferred embodiment, the probe is modified, and the modification is locked nucleic acid modification.

[0015] In one embodiment, the gene-edited soybean is a gene-edited soybean obtained after gene editing of the GmFAD2 gene; the GmFAD2 gene includes GmFAD2-1A and GmFAD2-1B; the nucleotide sequence of GmFAD2-1A of the gene-edited soybean is shown in SEQ ID No.8, and the nucleotide sequence of GmFAD2-1B of the gene-edited soybean is shown in SEQ ID No.10.

[0016] In one embodiment, the first primer set is used to detect the GmFAD2-1A gene, and the second primer set is used to detect the GmFAD2-1B gene.

[0017] In one embodiment, the primer set further comprises an internal reference gene primer set, which comprises a fifth specific primer, a sixth specific primer and a third probe, the nucleotide sequence of the fifth specific primer is shown in SEQ ID No.11, the nucleotide sequence of the sixth specific primer is shown in SEQ ID No.12, the nucleotide sequence of the third probe is shown in SEQ ID No.13, and the nucleotide sequence of the internal reference gene is shown in SEQ ID No.14.

[0018] In one embodiment, the nucleotide sequence of the wild-type GmFAD2-1A gene is shown as SEQ ID No.7; the nucleotide sequence of the wild-type GmFAD2-1B gene is shown as SEQ ID No.9.

[0019] In one embodiment, the 5' end of the specific primer is also connected to a fluorescent tag, and the fluorescent tag is FAM, HEX, etc.; preferably, the fluorescent tag is FAM or HEX, the base sequence of the FAM fluorescent tag is GAAGGTGACCAAGTTCATGCT, and the base sequence of the HEX fluorescent tag is GAAGGTCGGAGTCAACGGATT.

[0020] On the other hand, the present invention provides a method for detecting gene-edited soybeans, comprising the step of detecting a sample to be tested using the above-mentioned real-time fluorescent PCR primer set.

[0021] In one embodiment, the method further comprises the step of obtaining nucleic acid from the sample.

[0022] In one embodiment, the gene-edited soybeans are gene-edited soybeans obtained by gene editing the GmFAD2 gene.

[0023] The GmFAD2 genes include GmFAD2-1A and GmFAD2-1B.

[0024] In one embodiment, the method for detecting gene-edited soybeans includes detecting the difference in fluorescence signals of PCR products, thereby identifying the genotype of each gene-edited soybean to be tested.

[0025] In one embodiment, the genotype of the gene-edited soybeans detected is the genotype of the GmFAD2-1A gene detected, the homozygous genotype after editing is "TT", and the wild-type homozygous gene is "AA".

[0026] In one embodiment, the genotype of the gene-edited soybean to be detected is the genotype of the GmFAD2-1B gene to be detected, the edited homozygous genotype is "7bp missing", and the wild-type homozygous genotype is "7bp not missing".

[0027] In one embodiment, the primers of the first primer set are amplified and detected under the same amplification system, or the primers of the second primer set are amplified and detected under the same amplification system. In other embodiments, the first primer set and the second primer set are amplified and detected under the same amplification system.

[0028] In one embodiment, the first primer set and the internal reference gene primer set are amplified and detected in the same amplification system, or the second primer set and the internal reference gene primer set are amplified in the same amplification system; or the first primer set, the second primer set and the internal reference gene genome are amplified in the same amplification system.

[0029] In one embodiment, the sample to be tested is derived from a plant part of soybean, for example, leaves, pods, seeds or rhizomes.

[0030] In another aspect, the present invention provides a kit for detecting soybean genotypes, the kit comprising the above-mentioned real-time fluorescent PCR primer set.

[0031] On the other hand, the present invention provides the use of the above-mentioned real-time fluorescent PCR primer set in detecting gene-edited soybean genotypes.

[0032] On the other hand, the present invention also provides the use of the above-mentioned real-time fluorescent PCR primer set in the preparation of a reagent or a kit for detecting the genotype of gene-edited soybean.

[0033] In one embodiment, the soybean is the gene-edited soybean mentioned above.

[0034] Advantageous Effects of the Invention

[0035] The present invention provides a primer and method for detecting gene-edited soybeans based on real-time fluorescence PCR technology, which can perform quantitative and qualitative analysis on the test samples, greatly improving the detection efficiency and accuracy, achieving the purpose of high-throughput, low-cost rapid detection of functional genes, providing convenience for breeders to screen soybean varieties with excellent alleles, and accelerating the breeding process.

[0036] The following drawings and examples are only used to illustrate the present invention, rather than to limit the scope of the present invention. According to the drawings and the following detailed description of the preferred embodiments, various objects and advantages of the present invention will become apparent to those skilled in the art.

[0037] The sequence information involved in this application is as follows:

[0038]

[0039]

[0040]

[0041] BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 .The detection results of the designed real-time fluorescence PCR primer set and the internal reference gene primer set for soybean GmFAD2-1A gene on high oleic soybean and wild soybean, Figure 1 A represents the results of the primer set 1A-qPCR-F, 1A-qPCR-R and 1A-Probe-HEX-1 designed for the GmFAD2-1A gene and the internal reference genome in the same system to detect gene-edited high-oleic soybean; Figure 1 B represents the results of the primer set 1A-qPCR-F, 1A-qPCR-R and 1A-Probe-HEX-1 designed for the GmFAD2-1A gene and the internal reference genome in the same system to detect wild-type soybean; Figure 1 C represents the test results of the primer sets 1A-qPCR-F2, 1A-qPCR-R2 and 1A-Probe-HEX-2 designed for the GmFAD2-1A gene and the internal reference genome in a system for gene-edited high oleic soybean and wild-type samples; Figure 1 D represents the detection results of the primer sets 1A-qPCR-F2, 1A-qPCR-R2 and 1A-Probe-HEX-3 designed for the GmFAD2-1A gene and the internal reference genome in the same system for gene-edited high oleic soybean and wild-type samples.

[0043] Figure 2.The detection results of the designed real-time fluorescence PCR primer set and the internal reference gene primer set for soybean GmFAD2-1B gene on high oleic soybean and wild soybean, Figure 2 A represents the results of the primer set 1B-qPCR-F, 1B-qPCR-R and 1B-Probe-HEX-1 designed for the GmFAD2-1B gene and the internal reference genome in the same system to detect gene-edited high-oleic soybean; Figure 2 B represents the results of detecting wild-type soybean in a system using primer sets 1B-qPCR-F, 1B-qPCR-R and 1B-Probe-HEX-1 designed for the GmFAD2-1B gene and the internal reference genome.

[0044] Figure 3 .The relative quantitative test results of the real-time fluorescent PCR primers designed for the soybean GmFAD2-1B gene; the test samples were mixed samples of high oleic soybean and wild soybean; Figure 3 A represents the copy number ratio of high oleic acid soybean to wild type soybean in the test sample is 10%, Figure 3 B represents the copy number ratio of high oleic acid soybean to wild type soybean in the test sample is 1%, Figure 3 B represents the copy number ratio of high oleic acid soybean to wild type soybean in the test sample is 0.8%, Figure 3 C represents the copy number ratio of high oleic acid soybean to wild type soybean in the test sample is 0.1%, Figure 3 D represents the copy number ratio of high oleic acid soybean to wild type soybean in the test sample is 0.8%, Figure 3 E represents the copy number ratio of high oleic acid soybean to wild type soybean in the test sample is 0.6%, Figure 3 F represents the copy number ratio of high oleic acid soybean to wild type soybean in the test sample is 0.4%, Figure 3 G represents that the copy number ratio of high oleic acid soybean to wild-type soybean in the test sample is 0.2%.

[0045] Figure 4 . Absolute quantitative test results of the real-time fluorescent PCR primer set designed for soybean GmFAD2-1B gene; the test sample is high oleic acid soybean, the initial concentration is 100ng / ul, Figure 4 A is the test result after the sample is diluted 10 times with water. Figure 4 B is the test result after the sample was diluted 100 times with water. Figure 4 C is the test result of diluting the sample 1000 times with water. Figure 4 D is the test result of diluting the sample 10,000 times with water. Figure 4 E is the test result of diluting the sample 8000 times with water. Figure 4 F is the test result of diluting the sample 6000 times with water. Figure 4 G is the test result of diluting the sample 4000 times with water. Figure 4 H is the test result when the sample is diluted 2000 times with water. DETAILED DESCRIPTION

[0046] The present invention is further described below in conjunction with the embodiments. The following description is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change it into an equivalent embodiment with equivalent changes. Any simple modification or equivalent change made to the following embodiments based on the technical essence of the present invention without departing from the content of the present invention falls within the protection scope of the present invention.

[0047] Example 1. Obtaining Gene-Edited Soybean Materials

[0048] The GmFAD2-1A and GmFAD2-1B genes of soybeans are edited using conventional gene editing techniques in the art. For example, reference can be made to the method described in Chinese patent application CN116218896A to obtain gene-edited soybeans in which GmFAD2-1A and GmFAD2-1B have been edited. Compared with wild-type soybeans, the oleic acid content of the gene-edited soybeans is significantly increased.

[0049] The nucleic acid sequences of GmFAD2-1A and GmFAD2-1B of wild-type soybeans are shown as SEQ ID No.7 and SEQ ID No.9; after editing, the nucleic acid sequences of GmFAD2-1A and GmFAD2-1B of gene-edited soybeans are shown as SEQ ID No.8 and SEQ ID No.10.

[0050] The GmFAD2-1A and GmFAD2-1B genes of gene-edited soybeans were compared with those of wild-type soybeans. The nucleic acid sequences of GmFAD2-1A of wild-type soybeans and gene-edited soybeans showed that the edited soybeans had an extra "T" base compared with GmFAD2-1A of wild-type soybeans. The nucleic acid sequences of GmFAD2-1B of wild-type soybeans and gene-edited soybeans showed that the edited soybeans lacked 7bp compared with GmFAD2-1B of wild-type soybeans.

[0051] Among them, the GmFAD2-1A gene is located on chromosome 10 of the soybean genome; the GmFAD2-1B gene is located on chromosome 20 of the soybean genome.

[0052] Example 2: Screening of real-time fluorescence PCR primer sets designed for the GmFAD2-1A gene

[0053] In order to identify the GmFAD2-1A mutation type of the gene-edited soybean obtained in Example 1 of the gene-edited soybean, that is, the AT mutant strain, the edited strain and the wild-type strain were screened, and three probes and two sets of fluorescent PCR primers were designed for the base mutation site of the gene-edited soybean GmFAD2-1A gene for identifying the soybean gene and the reference gene primer set. In order to distinguish the high oleic soybean homologous chromosome 1A and 1B genes, a CG point spike was designed at the third base at the 3' end of the 1A-qPCR-F primer, and the point spike base was represented by uppercase. The 1A-Probe-HEX-3 probe added a locked nucleic acid modification at the SNP site to improve the probe specificity, and the modified site (+A) was represented. The primer set information is shown in Table 1, and 5 replicates were set for each test sample.

[0054] Table 1. GmFAD2-1A gene fluorescence PCR primers and probe sequences

[0055]

[0056]

[0057] The PCR reaction system is:

[0058]

[0059] The PCR program is:

[0060]

[0061] The results of GmFAD2-1A testing on gene-edited soybeans are as follows Figure 1 As shown, the internal reference gene Actin is the positive control, WT is the wild-type soybean template, and high oleic acid soybean is the AT mutant soybean sample after gene editing. Figure 1 A. The results of using primer sets 1A-qPCR-F, 1A-qPCR-R and 1A-Probe-HEX-1 and the internal reference genome in a system to detect gene-edited high-oleic soybean. Figure 1 B is the result of wild-type soybean detection using primer sets 1A-qPCR-F, 1A-qPCR-R and 1A-Probe-HEX-1 and the internal reference genome. Figure 1 C is the test result of the primer set 1A-qPCR-F2, 1A-qPCR-R2 and 1A-Probe-HEX-2 and the internal reference genome in a system for gene-edited high oleic soybean and wild-type samples. Figure 1D is the detection result of the primer set 1A-qPCR-F2, 1A-qPCR-R2 and 1A-Probe-HEX-3 and the internal reference genome in the same system for the gene-edited high oleic soybean and wild-type samples; According to the above results, it was found that the primer set 1A-qPCR-F, 1A-qPCR-R and 1A-Probe-HEX-1 had better detection efficiency for the high oleic soybean with GmFAD2-1A gene mutation, and the primer set 1A-qPCR-F2, 1A-qPCR-R2 and 1A-Probe-HEX-2 and the primer set 1A-qPCR-F2, 1A-qPCR-R2 and 1A-Probe-HEX-3 could not distinguish the high oleic soybean and wild-type samples well. The primer set 1A-qPCR-F, 1A-qPCR-R and 1A-Probe-HEX-1 was used for subsequent experiments.

[0062] Example 3: Screening of real-time fluorescence PCR primer sets designed for the GmFAD2-1B gene

[0063] In order to identify the GmFAD2-1B mutation type of the gene-edited soybean obtained in Example 1 of gene-edited soybean, that is, the 7bp deletion mutant strain, the edited strain and the wild-type strain were screened, and probe fluorescent PCR primers were designed for the base deletion position of the GmFAD2-1B gene of the gene-edited soybean to identify the soybean gene and the reference gene primer set. The primer and probe information are shown in Table 2, and the amplification system and procedure refer to Example 2.

[0064] Table 2. GmFAD2-1B gene fluorescence PCR primers and probe sequences

[0065]

[0066]

[0067] The results of GmFAD2-1B test of gene-edited soybean are as follows Figure 2 As shown in Figure 2, the primer set designed for the edited GmFAD2-1B gene detected the edited high oleic acid. Figure 2 As shown in A, the primer set designed for the edited GmFAD2-1B gene detected the edited high oleic acid. Figure 2 As shown in B, the internal reference gene Actin is the positive control, WT is the wild-type soybean template, and high oleic acid soybean is a mutant soybean sample with a 7bp base deletion after gene editing.

[0068] Depend on Figure 2The results shown in the figure show that the primer sets 1B-qPCR-F, 1B-qPCR-R and 1B-Probe-HEX designed for the mutation type of gene-edited soybean GmFAD2-1B can well distinguish the genotyping of gene-edited soybeans, and can achieve good identification of edited soybeans and wild-type soybean samples, and the above primer sets will be used in subsequent experiments.

[0069] Example 4: Relative quantification of real-time fluorescence PCR primer set for GmFAD2-1B gene

[0070] In this embodiment, based on the soybean haploid genome size of 1115Mbp, it is calculated that 1ng of homozygous soybean genomic DNA contains approximately 832 copies of the target PCR product fragment. The high oleic soybean GmFAD2-1B gene mutant and wild-type soybean samples were diluted with water to a concentration of 50ng / μl, and then 50ng / μL of WT soybean genomic DNA was used to gradient dilute 50ng / μL of high oleic soybean genomic DNA. The high oleic soybean GmFAD2-1B gene mutant sample copy number ratio gradient dilution was 10%, 1%, 0.1% and other three test samples for detection, each gradient was repeated 6 times, and the GmFAD2-1B primer set was used for amplification. The amplification procedure and system refer to Example 2. The detection results are shown in FIG. Figure 3 As shown in A-3C, typical amplification curves can be obtained when the copy number ratio of the high oleic soybean sample in the mixed sample is 10% and 1%. When the copy number ratio of the high oleic soybean sample in the mixed sample is 0.1%, only part of the reactions can obtain a typical amplification curve.

[0071] The gradient was further increased in the 1%-0.1% range of the copy number ratio of the GmFAD2-1B gene mutant sample of high oleic soybean. The high oleic soybean DNA group was diluted with 50 ng / μL of the high oleic soybean genome in sequence, and the high oleic soybean copy number ratio gradient was increased to 0.8%, 0.6%, 0.4% and 0.2% for testing. Each gradient was repeated 6 times. The results are as follows Figure 3 As shown in D-3G, when the copy number ratio of the high oleic soybean sample in the mixed sample is 0.8%, 0.6%, 0.4% and 0.2%, typical amplification curves can be obtained, and the gene-edited high oleic soybean in the mixed sample can be detected.

[0072] The results are as follows Figure 3 As shown, in the mixed sample, when the copy number ratio of the high oleic soybean with a 7bp deletion in the gene-edited GmFAD2-1B gene was as low as 0.2%, the primer set could also stably detect the high oleic soybean samples with the GmFAD2-1B gene deletion 7bp mutation type, that is, the content of high oleic soybean samples in the mixed sample was 0.1ng and the copy number was 81.83.

[0073] Example 5: Absolute Quantification Experiment of Real-time Fluorescence PCR Primer Set for GmFAD2-1B Gene

[0074] In this example, the sample was high oleic soybean with a 7 bp deletion in the GmFAD2-1B gene. The initial concentration was 100 ng / ul, and the sample was diluted 10 times, 100 times, 1000 times, and 10000 times with water for testing. Six replicates were set for each concentration. The amplification system and procedure were referred to Example 2. The results are shown in FIG. Figure 4 As shown in A-4C, typical amplification curves were obtained when the high oleic soybean sample was diluted 10 times, 100 times, and 1000 times, and the high oleic soybean sample edited with the GmFAD2-1B gene was detected. When the high oleic soybean was diluted 1000 times, the results were shown in 4D, and only some of the high oleic soybean samples edited with the GmFAD2-1B gene could be detected.

[0075] The dilution gradient of high oleic soybean samples was further increased. The high oleic soybean samples edited with GmFAD2-1B gene with a concentration of 100 ng / ul were diluted 2000 times, 4000 times, 6000 times, and 8000 times with water. The results were as follows: Figure 4 As shown in E-4H, the gene-edited high oleic soybean samples can be detected when the sample is diluted to 2000 times, 4000 times, and 6000 times. When it is diluted to 8000 times, only some of the gene-edited soybean samples can be detected repeatedly. Figure 4 The results show that when the high oleic acid sample is diluted 6000 times, that is, the DNA concentration is 0.0167ng / ul, the copy number of the detection template is 13.63, and the GmFAD2-1B real-time fluorescence PCR primer set can stably detect the GmFAD2-1B gene-edited high oleic acid soybean samples.

[0076] In summary, the real-time fluorescence PCR primers designed for high-oleic soybeans edited with GmFAD2-1A and GmFAD2-1B genes can distinguish edited samples from wild-type samples. Among them, the primer sets 1B-qPCR-F, 1B-qPCR-R and 1B-Probe-HEX designed for the GmFAD2-1B gene can detect high-oleic soybeans with a DNA concentration of 0.0167 ng / ul.

[0077] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes may be made to the details according to all the teachings that have been published, and these changes are within the scope of protection of the present invention. The entire invention is given by the attached claims and any equivalents thereof.

Claims

1. A real-time fluorescent PCR primer set for detecting gene-edited soybeans, characterized in that: The primer set is selected from any one or more of the following (i)-(ii): (i) a first primer set, comprising a first specific primer, a second specific primer and a first probe, wherein the nucleotide sequence of the first specific primer is shown in SEQ ID No.1, the nucleotide sequence of the second specific primer is shown in SEQ ID No.2; and the nucleotide sequence of the first probe is shown in SEQ ID No.3; (ii) The second primer set includes a third specific primer, a fourth specific primer and a second probe, wherein the nucleotide sequence of the third specific primer is shown in SEQ ID No.4, the nucleotide sequence of the fourth specific primer is shown in SEQ ID No.5; and the nucleotide sequence of the second probe is shown in SEQ ID No.

6.

2. The primer set according to claim 1, characterized in that The gene-edited soybeans are gene-edited soybeans obtained after gene editing of the GmFAD2 gene; the GmFAD2 gene includes GmFAD2-1A and GmFAD2-1B; the nucleotide sequence of GmFAD2-1A of the gene-edited soybeans is shown in SEQ ID No.8, and the nucleotide sequence of GmFAD2-1B of the gene-edited soybeans is shown in SEQ ID No.

10.

3. The primer set according to claim 2, characterized in that The first primer set is used to detect the GmFAD2-1A gene, and the second primer set is used to detect the GmFAD2-1B gene.

4. The primer set according to claim 1, characterized in that The primer set also includes an internal reference gene primer set, which includes a fifth specific primer, a sixth specific primer and a third probe, the nucleotide sequence of the fifth specific primer is shown in SEQ ID No.11, the nucleotide sequence of the sixth specific primer is shown in SEQ ID No.12, the nucleotide sequence of the third probe is shown in SEQ ID No.13, and the nucleotide sequence of the internal reference gene is shown in SEQ ID No.

14.

5. The primer set according to any one of claims 1 to 4, characterized in that: The nucleotide sequence of the wild-type GmFAD2-1A gene is shown in SEQ ID No.7; the nucleotide sequence of the wild-type GmFAD2-1B gene is shown in SEQ ID No.

9.

6. The primer set according to claim 5, characterized in that: The 5' end of the specific primer is also connected to a fluorescent label, for example, FAM, HEX, etc.

7. A method for detecting gene-edited soybeans, the method comprising the step of detecting a sample using the real-time fluorescent PCR primer set described in any one of claims 1-6.

8. The method according to claim 7, characterized in that The sample to be tested is derived from a plant part of soybean, for example, leaves, pods, seeds or rhizomes.

9. A kit for detecting soybean genotypes, comprising the real-time fluorescent PCR primer set according to any one of claims 1 to 6.

10. Use of the real-time fluorescent PCR primer set according to any one of claims 1 to 6 in detecting gene-edited soybean genotypes, or in preparing a reagent or kit for detecting gene-edited soybean genotypes.

Images