Application of double-stranded probe in detection of TTV

Abstract

The invention provides an application of a double-stranded probe in detection of TTV, and particularly relates to an application of the double-stranded probe and a primer in detection of TTV. One chain of the double-chain probe comprises SEQ ID NO: 1 with a 5'end modified fluorophore, the other chain of the double-chain probe comprises SEQ ID NO: 2 with a 3 'end modified quenching group, and the primer sequences comprise SEQ ID NO: 3 and SEQ ID NO.4. When the double-chain probe and the primer are used for detecting TTV, 12 subtypes of TTV can be detected at the same time, the omission ratio is low, and the sensitivity is high.

Description

Technical Field

[0001] The present invention relates to the field of nucleic acid detection, and in particular to the application of a double-stranded probe in detecting TTV, and in particular to the application of a double-stranded probe and a primer in detecting TTV. Background Art

[0002] Solid organ transplantation (SOT) is currently the treatment of choice for many terminal diseases by replacing or substituting diseased organs, restoring normal physiological functions, and improving patients' survival rate and quality of life. SOT patients need to use immunosuppressants throughout their lives to avoid organ rejection; however, immunosuppressants are drugs with a narrow therapeutic window, and improper use may lead to excessive or insufficient immunosuppression, both of which will lead to adverse effects. When immunosuppression is excessive, the risk of infection will be significantly increased; when immunosuppression is insufficient, organ rejection will occur. Therefore, it is of great significance to find biomarkers that can accurately reflect the immune function status of SOT recipients and develop reliable detection methods.

[0003] Torque Teno virus (TTV) is a small, non-enveloped, single-stranded DNA virus with a circular, negative-sense genome. They are widely distributed, carried by >90% of adults, show significant genetic variability, and account for the largest proportion of the blood virome of healthy subjects (about 70%). According to the 2011 report of the International Committee on Taxonomy of Viruses, the genus contains at least 29 different genotypes. TTV is not obviously pathogenic and is not affected by conventional antiviral drug treatment; its viral load is closely related to the host immune status and is regarded as a potential tool for assessing the host immune status. Previous studies on kidney transplantation, liver transplantation, lung transplantation, and stem cell transplantation have shown that TTV DNA load is closely related to rejection and infection risk. The hypothesis proposed by DeVlaminck et al. in 2013 and adopted by the scientific community is that excessive immunosuppression is characterized by high TTV viral load, leading to an increased risk of infection. Conversely, insufficient immunosuppression is characterized by low TTV viral load, accompanied by an increased risk of organ rejection.

[0004] The most widely used method for detecting TTV is TaqMan probe technology, which is based on the principle of activating the 5' exonuclease activity of Taq enzyme after the probe binds to the target nucleic acid, cutting the probe into single nucleotides, freeing the fluorescent group labeled on the probe, and emitting fluorescence. However, there are the following major disadvantages: first, the length of the linear probe limits the efficiency of energy transfer, and quenching is difficult to be complete, resulting in a high background; second, the hydrolysis of the probe depends on the exonuclease activity of Taq enzyme, which is greatly affected by the enzyme performance and quality during quantification, and the difference in enzyme activity brings greater uncertainty to the given amount; third, TaqMan probe only labels one fluorescent molecule, and the sensitivity needs to be improved.

[0005] The prior art CN109652516A improves the TaqMan probe and discloses a double-stranded probe for detecting HBV, HCV, HAV and CMV. The 5' end of the double-stranded probe is connected to a fluorescent group, and the 3' end is connected to a quenching group. When the double-stranded probe is used for PCR amplification, the double-stranded probes are mutually fluorescent and quenched, so that the quenching is more thorough, which greatly reduces the fluorescence background. In addition, when the target nucleic acid is present, the double-stranded probes respectively bind to the double strands of the target, thereby improving the sensitivity. Summary of the invention

[0006] Based on the low sensitivity of TTV detection in the prior art and the fact that TTV has multiple subtypes, this application designs a double-stranded probe with a specific structure, which can simultaneously detect 12 subtypes with high specificity and sensitivity. The specific scheme is as follows:

[0007] In a first aspect of the present invention, a double-stranded probe is provided for use in preparing a kit for detecting TTV, wherein the nucleotide sequence of one strand of the double-stranded probe is 5'-TTCCCGAGCCCGAATTGCCCCTTG-3' (SEQ ID NO: 1), and the 5' end thereof is modified with a fluorescent group, and the nucleotide sequence of the other strand is 5'-GGCAATTCGGGCTCGGGTT-3' (SEQ ID NO: 2), and the 3' end thereof is modified with a quenching group.

[0008] The fluorescent group is selected from 5(6)-carboxyfluorescein (FAM), Texas Red, ROX, TET, SIMA, AlexaFluor488, Quasar 670, VIC, JOE, HEX, Cy3, Cy3.5, Cy5, Cy5.5, LC RED640 or LC RED705, preferably FAM.

[0009] The quenching group is selected from Iowa Black, TAMRA, DABCYL, ECLIPSE, MGB, BHQ1, BHQ2 or BHQ3, preferably BHQ1.

[0010] The TTV includes TTV1, TTV3, TTV6, TTV7, TTV8, TTV10, TTV12, TTV15, TTV16, TTV19, TTV27 or TTV28.

[0011] The detecting of TTV includes detecting the presence or amount of TTV; for example, the presence or amount of TTV in a sample.

[0012] Preferably, the sample is selected from body fluids, cells, tissues, organs or the environment.

[0013] In a specific embodiment of the present invention, the sample is a body fluid, such as blood, urine, aqueous humor, saliva, lymph, tears or cerebrospinal fluid, or a fraction or a processed body fluid thereof.

[0014] The second aspect of the present invention provides a use of a double-stranded probe and a primer in preparing a kit for detecting TTV, wherein:

[0015] The nucleotide sequence of one strand of the double-stranded probe is 5'-TTCCCGAGCCCGAATTGCCCCTTG-3' (SEQ ID NO: 1), and the 5' end thereof is modified with a fluorescent group, and the nucleotide sequence of the other strand is 5'-GGCAATTCGGGCTCGGGTT-3' (SEQ ID NO: 2), and the 3' end thereof is modified with a quenching group;

[0016] The primers include:

[0017] Upstream primer: 5′-GGTGCCGAAGGTGAGTTTAC-3′ (SEQ ID NO: 3);

[0018] Downstream primer: 5'-GAGCCTTGCCCATAGCC-3' (SEQ ID NO: 4).

[0019] The fluorescent group is selected from 5(6)-carboxyfluorescein (FAM), Texas Red, ROX, TET, SIMA, AlexaFluor488, Quasar 670, VIC, JOE, HEX, Cy3, Cy3.5, Cy5, Cy5.5, LC RED640 or LC RED705, preferably FAM.

[0020] The quenching group is selected from Iowa Black, TAMRA, DABCYL, ECLIPSE, MGB, BHQ1, BHQ2 or BHQ3, preferably BHQ1.

[0021] The TTV includes TTV1, TTV3, TTV6, TTV7, TTV8, TTV10, TTV12, TTV15, TTV16, TTV19, TTV27 or TTV28.

[0022] The detecting of TTV includes detecting the presence or amount of TTV; for example, the presence or amount of TTV in a sample.

[0023] Preferably, the sample is selected from body fluids, cells, tissues, organs or the environment.

[0024] In a specific embodiment of the present invention, the sample is a body fluid, such as blood, urine, aqueous humor, saliva, lymph, tears or cerebrospinal fluid, or a fraction or a processed body fluid thereof.

[0025] In the third aspect of the present invention, a double-stranded probe is provided, wherein the nucleotide sequence of one chain of the double-stranded probe is 5'-TTCCCGAGCCCGAATTGCCCCTTG-3' (SEQ ID NO: 1), and the 5' end thereof is modified with a fluorescent group, and the nucleotide sequence of the other chain is 5'-GGCAATTCGGGCTCGGGTT-3' (SEQ ID NO: 2), and the 3' end thereof is modified with a quenching group.

[0026] The fluorescent group is selected from 5(6)-carboxyfluorescein (FAM), Texas Red, ROX, TET, SIMA, AlexaFluor488, Quasar 670, VIC, JOE, HEX, Cy3, Cy3.5, Cy5, Cy5.5, LC RED640 or LC RED705, preferably FAM.

[0027] The quenching group is selected from Iowa Black, TAMRA, DABCYL, ECLIPSE, MGB, BHQ1, BHQ2 or BHQ3, preferably BHQ1.

[0028] The fourth aspect of the present invention provides a double-stranded probe and a primer, wherein the double-stranded probe is the double-stranded probe described in the third aspect, and the primer comprises:

[0029] Upstream primer: 5′-GGTGCCGAAGGTGAGTTTAC-3′ (SEQ ID NO: 3);

[0030] Downstream primer: 5'-GAGCCTTGCCCATAGCC-3' (SEQ ID NO: 4).

[0031] A fifth aspect of the present invention provides a kit, characterized in that the kit comprises the double-stranded probe described in the third aspect;

[0032] Preferably, it includes the double-stranded probe and primer described in the fourth aspect.

[0033] Preferably, the kit also includes reagents required for PCR amplification.

[0034] Preferably, the kit also includes a buffer, an enzyme, water, etc.

[0035] Further preferably, the kit also includes reagents required for nucleic acid extraction.

[0036] Further preferably, the kit also includes a negative control, a positive control, a standard, etc.

[0037] The sixth aspect of the present invention provides a method for detecting TTV, characterized in that the method comprises using the double-stranded probe and primers described in the fourth aspect to perform an amplification reaction.

[0038] Preferably, the method further comprises detecting fluorescence intensity.

[0039] The detection can be a qualitative detection or a quantitative detection.

[0040] The amplification includes RPA, PCR, LCR, real-time fluorescence PCR, SDA, multiplex PCR, loop-mediated isothermal amplification or TMA, preferably PCR or real-time fluorescence PCR.

[0041] The method further comprises monitoring fluorescence changes in real time during the annealing stage of the reaction, thereby monitoring the presence and content of the TTV target.

[0042] The seventh aspect of the present invention provides the use of the double-stranded probe, the double-stranded probe and the primer in preparing a kit for post-transplant prognosis assessment or monitoring.

[0043] The transplant may be a solid organ transplant (SOT) or a stem cell transplant.

[0044] The organs include, but are not limited to, kidney, heart, liver, stomach, lung, spleen, intestine, pancreas, gallbladder, adrenal gland, thymus, thyroid gland, pancreatic islet, brain, etc., preferably kidney.

[0045] The stem cells include but are not limited to hematopoietic stem cells.

[0046] The stem cells may be autologous or allogeneic.

[0047] Preferably, the double-stranded probe, the double-stranded probe and the primer are used for prognosis assessment or monitoring by detecting TTV load.

[0048] Preferably, immunosuppressants are administered after transplantation.

[0049] Further preferably, the prognostic assessment is an assessment of the subject's immune function.

[0050] Further preferably, the monitoring is monitoring the immune function of the subject.

[0051] In a specific embodiment of the present invention, the prognostic evaluation or monitoring is to evaluate whether rejection occurs. The lower the load, the greater the risk of rejection.

[0052] The eighth aspect of the present invention provides the double-stranded probe, and the use of the double-stranded probe and primers in preparing a kit for evaluating rejection after transplantation by detecting TTV load.

[0053] The ninth aspect of the present invention provides a method for administering the type or dosage of immunosuppressants after transplantation, the method comprising using the double-stranded probe, the double-stranded probe and primers or the kit to detect the load of the subject's TTV. Preferably, if the load is too high, the dosage of the immunosuppressant needs to be increased.

[0054] The tenth aspect of the present invention provides a method for evaluating the prognosis after transplantation or evaluating whether a transplantation is rejected, the method comprising using the double-stranded probe, the double-stranded probe and primers or a kit to detect the load of the subject's TTV. Preferably, the lower the load, the greater the risk of rejection.

[0055] The method described in the present invention can be for diagnostic purposes or non-diagnostic purposes.

[0056] The "subject" described in the present invention can be a human or non-human mammal, or a cell, tissue or organ of a human or non-human mammal, and the non-human mammal can be a wild animal, a zoo animal, an economic animal, a pet, an experimental animal, etc. Preferably, the non-human mammal includes but is not limited to pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (such as rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc.

[0057] The "prognosis assessment" mentioned in the present invention refers to the assessment of a patient's response to treatment and the risk of future illness.

[0058] Beneficial effects of the present invention:

[0059] 1. The detection limit of the double-stranded probe designed in this application is 0.024 copies / μL, which has good detection effect for low-abundance samples.

[0060] 2. Compared with TaqMan probes and primers and Sanger sequencing, the double-stranded probes designed in this application have higher sensitivity and lower missed detection rate.

[0061] 3. It can detect 12 subtypes of TTV simultaneously and has a wide range of applications.

[0062] 4. The double-stranded probe designed in this application can inhibit nonspecific amplification and does not generate background signals.

[0063] 5. The double-stranded probes and primers designed in this application can amplify small double-stranded products (PEA amplicons), and the double-stranded products are continuously enriched to achieve multiple amplification and signal amplification. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:

[0065] Figure 1 : Primer screening gel electrophoresis results, wherein lanes 1, 3, 5, and 7 are experimental groups of primer sets 1-4, respectively; lanes 2, 4, 6, and 8 are control groups of primer sets 1-4, respectively, and M is Marker.

[0066] Figure 2 : Probe screening gel electrophoresis results, wherein lanes 1 and 2 are the test group and control group of the double-stranded probe TTV-CP1-EP1, lanes 3 and 4 are the test group and control group of the double-stranded probe TTV-CP-EP, lanes 5 and 6 are the test group and control group of the double-stranded probe TTV-CP2-EP2, lanes 7 and 8 are the test group and control group of the double-stranded probe TTV-CP3-EP3, and M is Marker.

[0067] Figure 3 : Real-time quantitative PCR verification of background signal, where the double-stranded probe in the left figure is TTV-CP-EP, and the double-stranded probe in the right figure is TTV-CP1-EP1.

[0068] Figure 4 :Schematic diagram of double-stranded probe detection. a. Schematic diagram of the recognition principle of double-stranded probe; the double-stranded probe is composed of two partially complementary oligonucleotide chains of unequal lengths. Overall, it is divided into three parts, the non-complementary region near the fluorescent label, the double-stranded region and the single-stranded region. The quenching group is labeled at the 3' end of the short chain, and the fluorescent group is labeled at the 5' end of the long chain. The double-stranded probe monitors the PCR process in real time. First, PCR annealing and denaturation are performed, and the probe binds to the two single strands of the target respectively to generate a fluorescent signal. Then, PCR extension is performed. Since the quenching group is labeled at the 3' end of the probe short chain, the probe long chain and the primer are extended to obtain the target amplification product and the extended probe long chain product (EP). Then, EP combines with the rear primer for PCR amplification to obtain a fluorescently labeled double-stranded product (PEA amplicon), which enhances the fluorescence. Next, this double-stranded product (PEA amplicon) undergoes PCR reaction with the primer and the initial double-stranded probe, and the fluorescence signal is enhanced. When the target does not exist, the double-stranded probe restores the double-stranded structure and the fluorescence is quenched. b. TTV detection flow chart.

[0069] Figure 5 : Schematic representation of the positions of double-stranded probes and primers on the TTV loop and the sequence alignment of 12 human TTVs.

[0070] Figure 6 : Detection sensitivity of double-stranded probes and primers.

[0071] Figure 7: Polyacrylamide gel electrophoresis of double-stranded probes and primers detecting 12 types of human TTV, where Target is the target.

[0072] Figure 8 : qPCR amplification bar graph of double-stranded probes and primers for detecting 12 human TTVs.

[0073] Fig. 9 : Standard curve of double-stranded probe and primer qPCR detection concentration and Ct value.

[0074] Fig.10 : The heat map results of TTV load in 66 healthy people detected by double-stranded probe and primer (PEA), TaqMan probe and primer and Sanger sequencing in this application.

[0075] Fig.11 : The positive and negative Venn diagrams of TTV load in 66 healthy people detected by double-stranded probes and primers (PEA), TaqMan probes and primers and Sanger sequencing in this application.

[0076] Fig.12 : Using 66 healthy subjects as samples, the correlation between the detection results of the double-stranded probes and primers screened in this application and the TaqMan probes and primers was compared.

[0077] Fig.13 : Positive and negative Venn diagrams of three test results in 33 renal dialysis patients.

[0078] Fig.14 : Comparison of the correlation between the detection results of the double-stranded probes and primers screened in this application and the TaqMan probes and primers in renal dialysis patients.

[0079] Fig.15 : Positive and negative Venn diagrams of the three test results in 33 patients after renal transplantation.

[0080] Fig.16 : Comparison of the correlation between the detection results of the double-stranded probes and primers screened in this application and the TaqMan probe in patients after renal transplantation.

[0081] Fig.17 : Schematic diagram of the workflow for sequential monitoring and follow-up of patients after renal transplantation using double-stranded probes.

[0082] Fig.18 : Distribution of TTV load in 223 blood samples from 27 patients from 0 to 90 days after renal transplantation.

[0083] Fig.19 : Changes in TTV load in patient 11 from 0 to 90 days after renal transplantation. DETAILED DESCRIPTION

[0084] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0085] Oligonucleotides and samples used in the examples

[0086] The 1×Taq PCR Master Mix used was purchased from Sangon Biotech (Shanghai) Co., Ltd. All DNA dry powders were centrifuged at 4000rpm for 2min, dissolved in double distilled water, and stored at -20°C for later use. DNA template dilution used a double distilled water solution containing 0.1% Tween-20 (ddH2O+0.1% Tween-20). The fluorescent or quenched modified oligonucleotide sequences of the double-stranded probe and TaqMan probe were synthesized by the synthesis department of Sangon Biotech (Shanghai) Co., Ltd. and purified by HPLC. The remaining oligonucleotide sequences were synthesized by the synthesis department of Sangon Biotech (Chengdu) Co., Ltd. and purified by PAGE.

[0087] Preparation of samples for fluorescence experiments in the examples

[0088] Preparation of 100 μM DNA stock solution: centrifuge the DNA freeze-dried powder at 4000 rpm for 2 min, then add an appropriate amount of ultrapure water to dissolve, shake well and place in a 4°C refrigerator overnight. The next day, use a UV spectrophotometer to measure the absorbance at 260 nm, calculate its actual concentration based on the theoretical molar extinction coefficient and dilute to 50 μM, dispense 20 μL into multiple EP tubes, and store at -20°C in the dark for later use.

[0089] The extraction of genomic DNA from blood samples of healthy subjects, renal dialysis patients and patients after renal transplantation used in the examples was completed by Sangon Biotech (Shanghai) Co., Ltd. The clinical samples involved in the experiment were approved by the Ethics Committee of West China Hospital of Sichuan University.

[0090] In the example, the extraction of genomic DNA from blood samples of patients undergoing sequential monitoring and follow-up after renal transplantation was completed by Sangon Biotech (Shanghai) Co., Ltd. The clinical samples involved in the experiment were approved by the Ethics Committee of West China Hospital, Sichuan University.

[0091] Example 1: Screening of double-stranded probes and primers

[0092] 1. Primer screening

[0093] Take the TTV conserved region (UTR) synthetic DNA sample for analysis, and design the primers in Table 1 for traditional PCR amplification. Design the experimental group and the control group, wherein the control group does not contain the target.

[0094] PCR reaction system and conditions: 20 μL reaction contains 10 μL Taq PCR premix (2×, without dye), 4 μL 2 μM front and back primer mixture, 2 μL gDNA (TTV1), and the balance is RNase-free water. The PCR process is 94°C for 5 min, followed by 40 cycles of amplification at 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s using a three-step method.

[0095] The amplified products were subjected to gel electrophoresis, and the results were as follows Figure 1 As shown, Figure 1 The amplification results of four primer sets are shown.

[0096] Bands 1, 2, 7, and 8 contained non-specific amplification products, which were not TTV-related fragments. Bands 5 and 6 did not undergo a successful process and had no product bands. Only band 3 (primer set 2) was the correct UTR amplification target fragment size of 77 bp.

[0097] Table 1

[0098]

[0099] 2. Probe screening

[0100] Based on the screened TTV conserved region (UTR) primer set 2, conventional PCR amplification was performed using the four double-stranded probes designed in Table 2, and an experimental group and a control group were designed, wherein the control group did not contain the target.

[0101] PCR reaction system and conditions: 20 μL reaction contains 10 μL Taq PCR premix (2×, without dye), 4 μL 2 μM front and back primer mixture, 2 μL 2 μM double-stranded probe, 2 μL gDNA (TTV1) and 2 μL RNase-free water. The PCR process is 94°C for 5 min, followed by 40 cycles of amplification at 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s.

[0102] The amplified products were subjected to gel electrophoresis, and the results were as follows Figure 2 As shown, Figure 2The screening results of 4 probe groups are shown. Among them, TTV-CP2-EP2 (5, 6) and TTV-CP3-EP3 (7, 8) did not produce probe amplification product bands below 77 bp, indicating that the probes did not produce the expected double amplification effect. TTV-CP1-EP1 (1, 2) and TTV-CP-EP (3, 4) produced probe amplification product bands below 77 bp, indicating that the double-stranded probe design was successful.

[0103] Table 2

[0104]

[0105]

[0106] 3. Verify background signal

[0107] The double-stranded probe was further fluorescently labeled (Table 3) to verify the detection effect in the real-time quantitative PCR process. The primers used were primer set 2 (SEQ ID NO: 3 and SEQ ID NO: 4).

[0108] The reaction system and conditions of real-time quantitative PCR: 20 μL reaction contains 10 μL Taq PCR premix (2×, without dye), 4 μL front and rear primer mixture at a concentration of 2 μM, 2 μL double-stranded probe at a concentration of 2 μM, 2 μL gDNA (TTV1) and 2 μL RNase-free water. The PCR process is 94°C for 5 min, followed by 40 cycles of amplification at 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s using a three-step method. The fluorescence signal is then collected at 55°C by the built-in FAM channel of the qPCR. The Ct value is obtained using the above software.

[0109] Table 3

[0110] sequence name DNA sequence (5' to 3') Modification TTV-EP TTCCCGAGCCCGAATTGCCCTTG (SEQ ID NO: 1) 5' end labeled with 6-FAM TTV-CP GGCAATTCGGGCTCGGGTT (SEQ ID NO: 2) 3' end labeled with BHQ1 TTV-EP1 TTCCCGAGCCCGAATTGCC (SEQ ID NO: 30) 5' end labeled with 6-FAM TTV-CP1 TTCGGGCTCGGGTT (SEQ ID NO: 31) 3' end labeled with BHQ1

[0111] The results are as follows Figure 3 As shown, the double-stranded probe TTV-EP-CP was able to detect the TTV target without generating background signal ( Figure 3 , left). However, TTV-CP1-EP1 produced background signals in the absence of TTV targets, which would result in false positives ( Figure 3 ,right).

[0112] Therefore, the best double-stranded probes and primers were screened for subsequent experimental verification, specifically: SEQ ID NO: 1 labeled with 6-FAM at the 5' end, SEQ ID NO: 2 labeled with BHQ1 at the 3' end, and SEQ ID NO: 3-4.

[0113] Example 2: Detection of multiple TTV subtypes and sensitivity verification

[0114] 1. Sensitivity and specificity

[0115] Preparation of synthetic DNA templates of different concentrations: The synthetic DNA template (sequence see Table 4) was gradiently diluted into a series of concentrations, including 40fM, 4fM, 400aM, 40aM, 4aM, 0.4aM, and 0.04aM.

[0116] Table 4

[0117]

[0118]

[0119] 2 μL of the above synthetic DNA templates of different concentrations, 10 μL of Taq PCR premix (2×, without dye), 4 μL of 2 μM PCR primers (TTV-FP2 and TTV-RP2 obtained by screening in Example 1), 2 μL of 2 μM double-stranded probes screened in Example 1, and 2 μL of sterilized water were added to a 200 μL PCR tube, with a total volume of 20 μL. The prepared PCR solution was placed on the qTOWER3G real-time fluorescence thermal cycler in Jena for amplification. The temperature conditions and the fluorescence channel for signal collection were set. The amplification conditions were 94°C for 5 minutes for enzyme activation, and then 40 cycles of amplification at 94°C for 30s, 55°C for 30s, and 72°C for 30s.

[0120] The results are as follows Figure 6 As shown, the double-stranded probe and primers obtained by screening in Example 1 can achieve a detection limit of 0.024 copies / μL, which is extremely sensitive.

[0121] 2. TTV multi-subtype detection

[0122] When the double-stranded probes and primers obtained by screening in Example 1 are used to detect different TTV targets, the total volume of one reaction is 20 μL, including 10 μL of 1×Taq PCR Master Mix, 4 μL of primers screened in Example 1 with a concentration of 200 nM, 2 μL of double-stranded probes screened in Example 1 with a concentration of 200 nM, 2 μL of targets with a concentration of 1 fM, and the remainder is double distilled water. The above mixture is quickly transferred to an eight-tube connection, and then qPCR amplification data is collected.

[0123] The conditions for qPCR amplification were 94°C for 5 min for enzyme activation, followed by 40 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s.

[0124] Figure 5 Shows the position of the double-stranded probe and primer on the TTV loop. Fig. 9 For the standard curve. Figure 7-8 The results showed that the double-stranded probe and primers could detect 12 TTV subtypes simultaneously.

[0125] Example 3: Clinical validation experiment

[0126] 1. Sample

[0127] This example analyzes 132 samples from three types of people, namely 66 healthy samples, 33 samples from renal dialysis patients, and 33 samples from patients after renal transplantation. After extracting genomic DNA from blood samples, the double-stranded probes and primers screened in Example 1 were used to detect TTV in the above 132 samples.

[0128] As a comparison, the same genomic DNA was tested using TaqMan probes and PCR-based Sanger sequencing.

[0129] 2. Sequence

[0130] The TaqMan probes and primers used in this example are shown in Table 5, wherein / ideoxyI / represents deoxyinosine. The primers used for Sanger sequencing are shown in Table 6.

[0131] Table 5

[0132]

[0133] Table 6

[0134]

[0135]

[0136] 3. Experimental steps

[0137] Sanger sequencing steps: First, gDNA extracted from blood samples was PCR amplified in an Eppendorf Mastercyclernexus gradient thermal cycler. 2μL gDNA, 10μL Taq PCR premix (2×, without dye), 4μL of 2μM front and back primer mixture, and the final volume was adjusted to 20μL with sterile water. PCR amplification used a three-step method, that is, incubation at 94°C for 5min, followed by 40 cycles of denaturation at 94°C for 30s, annealing at 55°C for 30s, and extension at 72°C for 30s, and finally extension at 72°C for 10min. After PCR amplification was completed, the PCR amplicon was purified using the SanPrep column PCR product purification kit, and Sanger sequencing was performed using the Applied Biosystems model 3730xL genetic analyzer.

[0138] qPCR reaction: The double-stranded probes and primers and TaqMan probes and primers screened in Example 1 were analyzed using the qTOWER3G real-time fluorescence thermal cycler from Jena.

[0139] In the qPCR test of TaqMan probe, the 20μL reaction contains 10μL 2×TaqMan Fast qPCR premix, 4μL of a mixture of forward primers and reverse primers at a concentration of 1μM, 2μL of TaqMan probes labeled with FAM and TAMRA-N at a concentration of 2μM, 2μL of gDNA, and 2μL of RNase-free water. The PCR process is 94℃ for 3min, followed by 40 cycles of amplification at 95℃ for 5s, 55℃ for 15s, and 72℃ for 30s using a three-step method. The fluorescence signal is then collected at 55℃ by the built-in FAM channel of the qPCR. The Ct value is obtained using the above software.

[0140] Similarly, in the qPCR detection of double-stranded probes and primers screened in Example 1, 20 μL of the reaction contained 10 μL of TaqPCR premix (2×, without dye), 4 μL of a mixture of front and rear primers at a concentration of 1 μM, 2 μL of a double-stranded probe at a concentration of 2 μM, 2 μL of gDNA, and 2 μL of RNase-free water. The PCR process was 94°C for 5 min, followed by a three-step method at 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s for 40 cycles of amplification. The fluorescence signal was then collected at 55°C by the built-in FAM channel of the qPCR. The Ct value was obtained by the above software.

[0141] 4. Results

[0142] The results showed that the double-stranded probes and primers screened in Example 1 were highly consistent with the results of TaqMan probes and primers, and had higher sensitivity, demonstrating excellent TTV detection capabilities.

[0143] For the test results of healthy people, please see Figure 10-12 ,in, Figure 10-11 It shows that the double-stranded probe and primer (PEA) screened in this application has a higher detection rate compared with TaqMan probe and primer and Sanger sequencing. Among 66 healthy people, the double-stranded probe and primer (PEA) of this application detected 61 positive cases and 5 negative cases, TaqMan probe and primer detected 60 positive cases and 6 negative cases, while Sanger sequencing detected only 3 positive cases. Fig.12 It is shown that the double-stranded probe and primer (PEA) screened by the present application are linearly correlated with the TaqMan probe and primer. And compared with the double-stranded probe (PEA) probe, the TaqMan probe method has lower specificity and higher missed detection rate. The PEA double-stranded probe of the present application detects more comprehensively and has better detection effect.

[0144] The results of the test for patients undergoing renal dialysis are shown in Figure 13-14 The results showed that among 33 renal dialysis patients, the double-stranded probe and primers (PEA) of this application detected 32 positive cases and 1 negative case, which was consistent with the detection results of TaqMan probe and primers, and the correlation analysis also showed a linear correlation, while Sanger sequencing detected only 1 positive case.

[0145] The test results of patients after kidney transplantation are shown in Figure 15-16 The results showed that among 33 patients after renal transplantation, the double-stranded probe and primers (PEA) of this application detected 32 positive cases and 1 negative case, which was one more positive case than the TaqMan probe and primers, proving that the double-stranded probe and primers screened by this application had a lower missed detection rate, and the correlation analysis also showed a linear correlation, while Sanger sequencing only detected 15 positive cases.

[0146] In summary, compared with TaqMan probes and primers or Sanger sequencing, the double-stranded probes and primers designed in the present application have higher detection sensitivity and lower missed detection rate.

[0147] Example 4: Clinical Trial

[0148] In patients after transplantation, sequential monitoring can evaluate the immune status in real time, detect insufficient or excessive immunosuppression at an early stage, and intervene in advance to prevent the occurrence of rejection or infection. In addition, continuous monitoring of TTV load during anti-infection or rejection treatment and real-time evaluation of the patient's immune status can also help doctors determine the effectiveness of treatment in advance.

[0149] Clinically, the TTV load in patients undergoing sequential monitoring and follow-up after renal transplantation will increase with time. The detailed trend is: as time goes by, it will tend to increase slowly from 0 to 30 days after surgery, reach a peak on the 90th day, and then decrease as time continues to increase.

[0150] 1. Samples and testing methods

[0151] A total of 223 blood samples were collected from 27 patients after kidney transplantation. The TTV load in the blood samples of patients after kidney transplantation was sequentially monitored and followed up according to the same reaction system and conditions as in Example 3. The experimental process is shown in Fig.17 .

[0152] 2. Results

[0153] The results showed that the detection results of the double-stranded probes and primers screened in Example 1 of the present application were consistent with the clinical trend. Specifically, Fig.18 The distribution of TTV loads in 223 blood samples from 0 to 90 days after surgery is shown. Fig.19 The change in TTV load from day 0 to day 90 for patient No. 11 among the 27 patients is shown.

[0154] Therefore, the double-stranded probes and primers screened in Example 1 of the present application have the potential to provide a more sensitive and accurate analytical technology for clinical diagnosis and medication guidance for patients after renal transplantation.

[0155] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0156] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

Claims

1. Use of a double-stranded probe in preparing a kit for detecting TTV, characterized in that: The nucleotide sequence of one strand of the double-stranded probe is 5'-TTCCCGAGCCCGAATTGCCCCTTG-3' (SEQ ID NO: 1), and its 5' end is modified with a fluorescent group, and the nucleotide sequence of the other strand is 5'-GGCAATTCGGGCTCGGGTT-3' (SEQ ID NO: 2), and its 3' end is modified with a quenching group.

2. Use of a double-stranded probe and primer in preparing a kit for detecting TTV, characterized in that: in: The nucleotide sequence of one strand of the double-stranded probe is 5'-TTCCCGAGCCCGAATTGCCCCTTG-3' (SEQ ID NO: 1), and the 5' end thereof is modified with a fluorescent group, and the nucleotide sequence of the other strand is 5'-GGCAATTCGGGCTCGGGTT-3' (SEQ ID NO: 2), and the 3' end thereof is modified with a quenching group; The primers include: Upstream primer: 5′-GGTGCCGAAGGTGAGTTTAC-3′ (SEQ ID NO: 3); Downstream primer: 5'-GAGCCTTGCCCATAGCC-3' (SEQ ID NO: 4).

3. The use according to claim 1 or 2, characterized in that: The TTV includes TTV1, TTV3, TTV6, TTV7, TTV8, TTV10, TTV12, TTV15, TTV16, TTV19, TTV27 or TTV28.

4. The use according to any one of claims 1 to 3, wherein the detecting of TTV comprises detecting the presence or amount of TTV; for example, detecting the presence or amount of TTV in a sample; Preferably, the sample is selected from body fluids, cells, tissues, organs or the environment.

5. A double-stranded probe, characterized in that The nucleotide sequence of one strand of the double-stranded probe is 5'-TTCCCGAGCCCGAATTGCCCCTTG-3' (SEQ ID NO: 1), and its 5' end is modified with a fluorescent group, and the nucleotide sequence of the other strand is 5'-GGCAATTCGGGCTCGGGTT-3' (SEQ ID NO: 2), and its 3' end is modified with a quenching group.

6. The double-stranded probe according to claim 5, characterized in that The fluorescent group is selected from FAM, Texas Red, ROX, TET, SIMA, Alexa Fluor 488, Quasar 670, VIC, JOE, HEX, Cy3, Cy3.5, Cy5, Cy5.5, LCRED640 or LC RED705; the quenching group is selected from Iowa Black, TAMRA, DABCYL, ECLIPSE, MGB, BHQ1, BHQ2 or BHQ3.

7. A double-stranded probe and primer, characterized in that: The double-stranded probe is the double-stranded probe according to claim 5 or 6, and the primer comprises: Upstream primer: 5′-GGTGCCGAAGGTGAGTTTAC-3′ (SEQ ID NO: 3); Downstream primer: 5'-GAGCCTTGCCCATAGCC-3' (SEQ ID NO: 4).

8. A kit, characterized in that: The kit comprises the double-stranded probe according to claim 5 or 6; Preferably, the double-stranded probe and primer described in claim 7 are included.

9. A method for detecting TTV, characterized in that: The method comprises performing an amplification reaction using the double-stranded probe and primers as described in claim 7; preferably, it also comprises detecting the fluorescence intensity; Preferably, the amplification comprises RPA, PCR, LCR, real-time fluorescence PCR, SDA, multiplex PCR, loop-mediated isothermal amplification or TMA.

10. Use of the double-stranded probe according to claim 5 or 6, or the double-stranded probe and primer according to claim 7 in preparing a kit for post-transplant prognosis assessment or monitoring; Preferably, the double-stranded probe, the double-stranded probe and the primer are used for prognosis assessment or monitoring by detecting TTV load.

Images