Crosslinked multispecific antibodies

Abstract

Provided herein are compositions and methods for cross-linking a multispecific antibody to a target with a conjugate. Further provided herein are conjugates comprising a targeting domain, wherein the targeting domain comprises a non-natural amino acid. Further provided herein are methods of treating disease with cross-linked multispecific antibodies.

Description

[0001] Cross-references

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 346,798, filed on May 27, 2022, which is incorporated herein by reference in its entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing submitted electronically in XML format and hereby incorporated by reference in its entirety. The XML copy was created on May 24, 2023, named 60801-712_601_SL.xml, and is 75 kilobytes in size. Background Art

[0005] Proteins primarily use noncovalent interactions within or between proteins because the amino acid side chains of proteins are generally incapable of forming covalent bonds with each other, with the exception of cysteine, which creates relatively weak, reversible disulfide bonds. Summary of the invention

[0006] In some aspects, a conjugate is provided herein, comprising: a first targeting domain configured to bind to a first target on a first cell, and a second targeting domain configured to bind to a second target on a second cell, wherein the first targeting domain comprises at least one first unnatural amino acid (UAA), whereby the first targeting domain is capable of covalently binding to the first target at the site of the UAA and the first target. In some embodiments, the second cell is an immune cell. In some embodiments, the first cell is a tumor cell. In some embodiments, the first targeting domain comprises an antibody or an antigen-binding fragment thereof. In some embodiments, the first targeting domain comprises a single domain antibody (sdAb). In some embodiments, the first UAA is contained in or near the region of the first targeting domain that is connected to the first target. In some embodiments, the second targeting domain comprises an antibody or an antigen-binding fragment thereof. In some embodiments, the second targeting domain comprises a single domain antibody (sdAb). In some embodiments, the first targeting domain and the second targeting domain are connected by chemical conjugation. In some embodiments, the first targeting domain and the second targeting domain are connected by a connector. In some embodiments, the connector is a polypeptide connector. In some embodiments, the first target is a first cell surface molecule. In some embodiments, the second target is a second cell surface molecule. In some embodiments, at least one UAA comprises an aryl fluorosulfate moiety. In some embodiments, at least one first UAA comprises Formula I: In some embodiments, at least one first UAA has the structure: In some embodiments, at least one first UAA comprises Formula II: In some embodiments, at least one first UAA has the structure: In some embodiments, at least one first UAA comprises Formula III: In some embodiments, at least one first UAA has the structure: In some embodiments, at least one first UAA has the structure of Formula (IA): Wherein each X is independently O or NR'; Y is a bond, -O-, -NR- or -N=; A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4; when present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl or substituted or unsubstituted heterocycloalkyl; R 1 is hydrogen, fluorine or iodine; R 2 is hydrogen or methyl; L is -(CH2) p -or-C(O)NH-(CH2) p -; p is an integer from 1 to 6; and wherein when Y is -O- or -NR-, m is 1; when Y is -N=, m is 2. In some embodiments, at least one first UAA has formula (IA-a): In some embodiments, at least one first UAA has a structure of Formula (IB): In some embodiments, at least one first UAA has a structure of Formula (ID): Wherein: each X is independently O or NR'; Y is a bond, -O-, -NR- or -N=; A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4; when present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl or substituted or unsubstituted heterocycloalkyl; R 1 is hydrogen, fluorine or iodine; R 2 is hydrogen or methyl; and wherein when Y is a bond, -O- or -NR-, m is 1; when Y is -N=, m is 2. In some embodiments, at least one first UAA has a structure of Formula (IIA): wherein: X is independently O or NR'; and when present, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl. In some embodiments, at least one first UAA has a structure of Formula (IIB): Wherein: X is independently O or NR'; and when present, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl or substituted or unsubstituted heterocycloalkyl. In some embodiments, the first cell surface molecule comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Mucl, PSMA, ROR1, SEZ6 or SLAMF7. In some embodiments, the second cell surface molecule is a cell surface molecule present on immune cells. In some embodiments, immune cells comprise T cells or NK cells. In some embodiments, the second cell surface molecule is CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1 or Vγ9Vδ2. In some embodiments, the first targeting domain comprises any one of SEQ ID NO: 1-4, 16-18, 20, 29, 50 or 51. In some embodiments, the first targeting domain comprises a sequence having at least 70% sequence identity to any one of SEQ ID NO: 1-4, 16-18, 20, 29, 50 or 51. In some embodiments, the second targeting domain comprises a sequence having at least 70% sequence identity to SEQ ID NO: 22, 25 or 52-55. In some embodiments, the conjugate comprises a sequence having at least 70% sequence identity to any one of SEQ ID NO: 19, 21, 23, 24, 26-28, 30, 35-49, 57 or 64. In some embodiments, the first targeting domain comprises SEQ ID NO: 16 or 51. In some embodiments, the first targeting domain comprising SEQ ID NO: 16 further comprises an unnatural amino acid at position 109 relative to SEQ ID NO: 16. In some embodiments, the first targeting domain comprising SEQ ID NO: 51 further comprises an unnatural amino acid at position 101 relative to SEQ ID NO: 51.

[0007] In some aspects, a method is provided herein, comprising administering a conjugate according to an embodiment of the present disclosure, wherein the conjugate covalently binds to a first target on the surface of a first cell. In some embodiments, the first cell is a tumor cell. In some embodiments, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CC R4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, Fol Ra, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT. In some embodiments, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7.

[0008] In some aspects, a method is provided herein, comprising administering a conjugate according to an embodiment of the present disclosure, wherein the conjugate binds to a second target on the surface of a second cell. In some embodiments, the first cell is a tumor cell. In some embodiments, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CC R4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, Fol Ra, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT. In some embodiments, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7.

[0009] In some aspects, a method is provided herein, comprising administering a conjugate according to an embodiment of the present disclosure, wherein the conjugate covalently binds to a first target on the surface of a first cell and the conjugate binds to a second target on a second cell. In some embodiments, the first cell is a tumor cell. In some embodiments, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CC R4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, Fol Ra, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT. In some embodiments, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6 or SLAMF7. In some embodiments, the second cell is an immune cell, wherein the immune cell is a T cell or a NK cell. In some embodiments, the second cell comprises a second cell surface molecule. In some embodiments, the second cell surface molecule is CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1 or Vγ9Vδ2. In some embodiments, the first targeting domain comprises any one of SEQ ID NOs: 1-4, 16-18, 20, 29, 50, or 51. In some embodiments, the first targeting domain comprises a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1-4, 16-18, 20, 29, 50, or 51.In some embodiments, the second targeting domain comprises a sequence having at least 70% sequence identity to SEQ ID NO: 22, 25, or 52-55. In some embodiments, the conjugate comprises a sequence having at least 70% sequence identity to any one of SEQ ID NO: 19, 21, 23, 24, 26-28, 30, 35-49, 57, or 64. In some embodiments, the first targeting domain comprises SEQ ID NO: 16 or 51. In some embodiments, the first targeting domain comprising SEQ ID NO: 16 further comprises an unnatural amino acid at position 109 relative to SEQ ID NO: 16. In some embodiments, the first targeting domain comprising SEQ ID NO: 51 further comprises an unnatural amino acid at position 101 relative to SEQ ID NO: 51.

[0010] In some aspects, provided herein is a method of treating a proliferative disease or condition in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a conjugate according to an embodiment of the present disclosure. In some embodiments, the proliferative disease or condition is cancer.

[0011] In some aspects, provided herein is a method of making a conjugate according to an embodiment of the present disclosure, comprising synthesizing in vivo a first targeting domain comprising at least one unnatural amino acid. In some embodiments, the method further comprises synthesizing in vivo a second domain. In some embodiments, the synthesis comprises using an orthogonal tRNA synthetase / suppressor tRNA pair. In some embodiments, the synthesis comprises an orthogonal tRNA synthetase / suppressor tRNA pair derived from a pyrrolysine tRNA synthetase / tRNA Pyl .

[0012] Incorporation by reference

[0013] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The novel features of the present disclosure are particularly set forth in the appended claims. The features and advantages of the present disclosure will be better understood by reference to the following detailed description and accompanying drawings, in which illustrative embodiments utilizing the principles of the present disclosure are set forth, wherein:

[0015] Figure 1ADepicted is an SDS-PAGE analysis of the cross-linking kinetics between EGFR and the monoparatopic construct C4-109FSY. The half-maximal cross-linking time (t half-max crosslinking) is approximately 120 minutes. The bands corresponding to the cross-linked product, EGFR, and sdAb monomers are labeled.

[0016] Figure 1B Depicted is an SDS-PAGE analysis of the cross-linking kinetics between EGFR and the biparatopic construct C9 (C4-109FSY-L1-C5). Bands corresponding to the cross-linked product, EGFR, and uncross-linked C9 compound are labeled.

[0017] Figure 2 Depicted are graphs of EGFR cross-linking kinetics for the monoparatopic construct C4-109FSY (circles) or the biparatopic construct C9 (C4-109FSY-L1-C5) (squares). The y-axis is labeled EGFR cross-linking % from 0 to 100%. The x-axis is labeled time (minutes) from 0 to 400 at 20 minute intervals.

[0018] Figure 3 Depicted are exemplary arrangements of constructs provided herein. From top to bottom: C1 (wild-type sequence comprising two cysteine ​​disulfide bonds); C10 (C1-101A / 104A) (one cysteine ​​disulfide bond is replaced by two alanines, thereby removing the disulfide bond); C1-102FSY (construct C1, histidine 102 is replaced by the unnatural amino acid FSY) and C10-102FSY (C1-101A / 104A / 102FSY) (both C101 and C104 cysteines are replaced by alanines, and histidine 102 is replaced by FSY).

[0019] Figure 4A Depicted is an SDS-PAGE analysis of constructs C10-102FSY (C1-101A / 104A / 102FSY) monomers and C11-102FSY (C1-101A / 104A / 102FSY-L1-C10) dimers cross-linked with PSMA. Bands corresponding to uncross-linked C10-102FSY and C11-102FSY, PSMA, and cross-linked species are labeled. The constructs depicted below show the C10 monomer sequence (ovals) and FSY (triangles).

[0020] Figure 4B Depicted are images of constructs C10-102FSY (circles) and C11-102FSY (squares) cross-linked to PSMA.

[0021] Figure 5ADepicted are exemplary constructs described herein that comprise a first targeting domain (e.g., constructs C1-C4) comprising an unnatural amino acid (e.g., FSY) and a second targeting domain (e.g., anti-CD3 [construct C6]; anti-CD16 [construct C7]; anti-NKp46; anti-NKp30; anti-TCRα; anti-TCRβ, anti-TCRγ; anti-TCRδ).

[0022] Figure 5B Depicted is an SDS-PAGE analysis of various constructs provided herein. Lanes 1-15 are labeled as follows: 1. C12 (C4-L6-C6); 2. C12 + EGFR; 3. C13 (C4-109FSY-L6-C6); 4. C13 + EGFR; 5. C14 (C4-L2-C7); 6. C14 + EGFR; 7. C15 (C4-109FSY-L2-C7); 8. C15 + EGFR; 9. C16 (C2-L6-C6); 10. C16 + PSMA; 11. C18 (C2-54FSY-L6-C6); 12. C18 + PSMA; 13. PSMA; 14. EGFR; 15. Ladder. Bands corresponding to EGFR, PSMA, and free sdAb dimer are labeled. Cross-linked material is indicated by an asterisk.

[0023] Figure 6 Depicted are SDS-PAGE analyses of various constructs according to embodiments of the present disclosure. Lanes 0 to 11 are labeled as follows: 0. marker / ladder; 1. C20 (C37-L2-C35), without PSMA; 2. C20 (C37-L2-C35), with PSMA; 3. C21 (C37-L1-C35), without PSMA; 4. C21 (C37-L1-C35), with PSMA; 5. C22 (C37-L3-C35), without PSMA; 6. C22 (C37-L3-C35), with PSMA; 7. C23 (C37-L4-C35), without PSMA; 8. C23 (C37-L4-C35), with PSMA; 9. C24 (C37-L5-C35), without PSMA; 10. C24 (C37-L5-C35), with PSMA; 11. PSMA. Cross-linked material, PSMA, and uncross-linked conjugate are labeled.

[0024] Figure 7 A-7F illustrate the binding and dissociation curves of constructs according to embodiments of the present disclosure to PSMA.

[0025] Figure 7 A shows the binding and dissociation curves of negative control to PSMA.

[0026] Figure 7 B shows the binding and dissociation curves of C21 to PSMA.

[0027] Figure 7 C shows the binding and dissociation curves of C20 to PSMA.

[0028] Figure 7 D shows the binding and dissociation curves of C22 to PSMA.

[0029] Figure 7 E shows the binding and dissociation curves of C23 to PSMA at different concentrations.

[0030] Figure 7 F shows the binding and dissociation curves of C24 to PSMA at different concentrations.

[0031] Figure 8 A-8F illustrate the binding and dissociation curves of constructs according to embodiments of the present disclosure to CD16a.

[0032] Figure 8 A illustrates the binding and dissociation curves of the control to CD16a.

[0033] Figure 8 B shows the binding and dissociation curves of C21 to CD16a.

[0034] Figure 8 C shows the binding and dissociation curves of C20 to CD16a.

[0035] Figure 8 D shows the binding and dissociation curves of C22 to CD16a.

[0036] Figure 8 E shows the binding and dissociation curves of C23 to CD16a at different concentrations.

[0037] Figure 8 F shows the binding and dissociation curves of C24 to CD16a at different concentrations.

[0038] Fig. 9 A-9D illustrates the binding and dissociation curves of constructs C22 and C25 to PSMA at pH 5.7 or pH 7.4.

[0039] Fig. 9 A shows the binding and dissociation curves of C25 to PSMA at different concentrations in pH 5.7 buffer.

[0040] Fig. 9 B shows the binding and dissociation curves of C22 to PSMA at different concentrations in pH 5.7 buffer.

[0041] Fig. 9C shows the binding and dissociation curves of C25 to PSMA at different concentrations in pH 7.4 buffer.

[0042] Fig. 9 D illustrates the binding and dissociation curves of C22 to PSMA at different concentrations in pH 7.4 buffer, and the dissociation curve illustrates that at physiological pH (pH 7.4), the C22 construct containing FSY dissociates less than the C25 equivalent without FSY.

[0043] Fig.10 A shows the binding and dissociation curves of C37 (anti-CD16a-sdAb) to CD16a at different concentrations.

[0044] Fig.10 B shows the binding and dissociation curves of C25 (anti-CD16a-sdAb) to CD16a at different concentrations.

[0045] Fig.10 C shows the binding and dissociation curves of C22 (anti-CD16a-sdAb) to CD16a at different concentrations.

[0046] Fig.11A A graph with a y-axis corresponding to relative light units (RLU) and an x-axis corresponding to test article concentration (nM) is depicted. Test articles included J591 mAb, C25 (TYR), C22 (FSY), hIgG isotype (control), and C37, C36, C35, and were incubated with high PSMA density target cells (PC3pip cells) for 24 hours. The results show that C22 (FSY) (unfilled squares) is able to bind more PSMA than C25 (TYR).

[0047] Fig. 11B A graph with a y-axis corresponding to relative light units (RLU) and an x-axis corresponding to test article concentration (nM) is depicted. Test articles included J591 mAb, C25 (TYR), C22 (FSY), hIgG isotype (control), and C37 and were incubated with high PSMA density target cells (PC3pip cells) for 24 hours, followed by a wash step after 4 hours. The results indicate that C22 (FSY) (unfilled squares) is able to bind to PSMA.

[0048] Fig. 12AA graph with a y-axis corresponding to relative light units (RLU) and an x-axis corresponding to test article concentration (nM) is depicted. Test articles included J591 mAb, C25 (TYR), C22 (FSY), hIgG isotype (control), C37, C36, C35, and endotoxin control and were incubated with low PSMA density target cells (22Rv1 cells) for 24 hours. The results showed that C22 (FSY) (unfilled squares) and C25 (TYR) (unfilled black circles) were able to bind to PSMA.

[0049] Fig. 12B A graph with a y-axis corresponding to the percentage of cell lysis (%) and an x-axis corresponding to the test article concentration (nM) is depicted. The conjugates tested included C25(TYR), C22(FSY), J591 mAb and were incubated with low PSMA density target cells (22Rv1 cells) for 24 hours, followed by a wash step after 4 hours. The results indicate that C22(FSY) is able to covalently bind to low PSMA density target cells, as evidenced by an increase in RLU.

[0050] Fig.13A A graph with a y-axis corresponding to the percentage of cell lysis (%) and an x-axis corresponding to the test article concentration (nM) is depicted. The conjugates tested included C22, C25, C37 and were incubated with primary NK cells for 20 hours.

[0051] Fig. 13B A graph with a y-axis corresponding to the percentage of cell lysis (%) and an x-axis corresponding to the test article concentration (nM) is depicted. The conjugates tested included C22, C25, C37 and were incubated with primary NK cells for 20 hours with a wash step after 5 hours.

[0052] Fig.14A Depicted is the SDS-PAGE of the constructs (or conjugates) in the presence of PSMA. Constructs C27(FSY) and C26(TYR) were mixed with PSMA and aliquots were sampled at different time intervals (0, 5, 10 and 15 minutes) in the presence (R) or absence (NR) of the receptor and analyzed by SDS-PAGE. Asterisks indicate displaced material (*), non-displaced receptors (**) and non-crosslinked C26 or C27 (***). The results indicate that C27(FSY) is able to covalently bind to the PSMA target.

[0053] Fig. 14BDepicted is the SDS-PAGE of construct C28(TYR) in the presence of PSMA. Construct C28(TYR) was mixed with PSMA and aliquots were sampled at different time intervals (0, 5, 10 and 15 minutes) in the presence (R) or absence (NR) of the receptor and analyzed by SDS-PAGE. Asterisks indicate non-displaced receptors (*) and non-crosslinked C28 (**). The results indicate that C28(TYR) is unable to covalently bind to the PSMA target.

[0054] Fig. 14C Depicted is the SDS-PAGE of the constructs in the presence of PSMA. Constructs C29(TYR) and C30(FSY) were mixed with PSMA and aliquots were sampled at different time intervals (0, 5, 10 and 15 minutes) in the presence (R) or absence (NR) of the receptor and analyzed by SDS-PAGE. Asterisks indicate displaced material (*), non-displaced receptor (**) and non-crosslinked C29 or C30 (***). The results indicate that C30(FSY) is able to covalently bind to the PSMA target.

[0055] Fig.14D Depicted is the SDS-PAGE of the constructs in the presence of PSMA. Constructs C31(TYR) and C32(TYR) were mixed with PSMA and aliquots were sampled at different time intervals (0, 5, 10 and 15 minutes) in the presence (R) or absence (NR) of the receptor and analyzed by SDS-PAGE. Asterisks indicate undisplaced receptors (*) and uncrosslinked C31 or C32 (**). The results indicate that C31(TYR) and C32(TYR) are unable to covalently bind to the PSMA target.

[0056] Fig.14E Depicted is the SDS-PAGE of the constructs in the presence of PSMA. Constructs C34(FSY) and C33(TYR) were mixed with PSMA and aliquots were sampled at different time intervals (0, 5, 10 and 15 minutes) in the presence (R) or absence (NR) of the receptor and analyzed by SDS-PAGE. Asterisks indicate displaced material (*), non-displaced receptors (**) and non-crosslinked C33 or C34 (***). The results indicate that C34(FSY) is able to covalently bind to the PSMA target.

[0057] Fig.15 A graph of a T cell ADCC luciferase reporter assay is depicted, with the y-axis corresponding to relative light units (RLU) and the x-axis corresponding to the concentration (nM) of the conjugate according to embodiments of the present disclosure.

[0058] Figures 16A-16CGraphs of three T cell ADCC luciferase reporter assays are depicted, with the y-axis corresponding to relative light units (RLU) and the x-axis corresponding to the concentration (nM) of a conjugate according to an embodiment of the present disclosure, a commercially available CD3-PSMA bispecific, and an isotype (control).

[0059] exist Fig.16A Comparison of binding curves of C27 (FSY), C26 (TYR), and commercially available CD3-PSMA bispecifics and isotype controls showed that C27 bound to PSMA-expressing PC3Pip target cells with an EC50 lower than that of C26. Fig. 16B Comparison of binding curves of C30 (FSY), C29 (TYR), and commercially available CD3-PSMA bispecifics and isotype controls showed that C30 bound to PSMA-expressing PC3Pip target cells with an EC50 lower than that of C29. Fig. 16C Comparison of the binding curves of C33 (FSY), C34 (TYR), and commercially available CD3-PSMA bispecifics and isotype controls showed that C34 bound to PSMA-expressing PC3Pip target cells with an EC50 less than that of C33.

[0060] Fig.17 Depicted is a graph of T cell activation in PC3Pip cells, wherein the graph illustrates a y-axis corresponding to relative light units (RLU) versus an x-axis corresponding to the concentration (nM) of conjugates according to embodiments of the present disclosure, commercially available CD3-PSMA bispecifics, and isotypes (controls). The graph illustrates that in the absence of PSMA expression on target cells, various constructs according to embodiments of the present disclosure do not activate T cells. DETAILED DESCRIPTION

[0061] Antibodies, antibody fragments and antibody-related constructs can become useful tools for research and clinical applications. However, in some cases, the use of these molecules is limited by the binding / dissociation rate and stability of the target. Provided herein are compositions and methods for specifically and covalently binding a conjugate to a target. In some cases, the conjugate comprises a first targeting domain and a second targeting domain and at least one unnatural amino acid (UAA), wherein the first targeting domain is configured to bind to a first target on a first cell and the second targeting domain is configured to bind to a second target on a second cell. In some cases, the first cell is a tumor cell and the second cell is an immune cell. In some cases, the second targeting domain is configured to bind to a protein on the surface of an immune cell and the immune cell is a T cell, NK cell, myeloid cell or macrophage. In some cases, T cells are NKT cells. In some cases, the first targeting domain or the second targeting domain comprises at least one UAA present near the interface between the target and the targeting moiety, so that when the targeting domain is combined with the target, a covalent bond is formed between the target and the UAA. In some cases, the covalent interaction eliminates or reduces the dissociation rate of the conjugate binding to the target, or otherwise stabilizes the contact with the target. In some cases, the second targeting domain may also contain UAA. In some cases, only the first targeting domain and not the second domain contains UAA. In some cases, only the first targeting domain contains UAA and the first targeting domain is configured to bind to a first target on a tumor cell. In some cases, only the first targeting domain contains UAA and the first targeting domain is configured to bind to a first target on a tumor cell, and the second targeting domain is configured to bind to a second target on an immune cell.

[0062] Conjugate

[0063] The conjugate herein includes a first targeting domain and a second targeting domain, wherein the first targeting domain is configured to bind to a first target (such as a first target on a tumor cell), and the second targeting domain is configured to bind to a second target present on different cells. In some cases, the second target is on an immune cell (such as a T cell, NK cell, myeloid cell, or macrophage). In some cases, the conjugate includes at least one non-natural amino acid (UAA), which is included in the first targeting domain, the second targeting domain, or each of the first targeting domain and the second targeting domain includes at least one UAA, so that the targeting domain with UAA is configured to bind to its target, and one of the UAAs in the targeting domain forms a covalent bond with the target. In some cases, the first targeting domain is configured to form a covalent bond with the target, so that at least one UAA is present in the targeting domain, near the interface between the target and the targeting domain, so that when the targeting domain is bound to the target or close to the target, in the targeting domain of the conjugate, a covalent bond is formed between the target and the UAA.

[0064] In some cases, when the UAA contained in the first targeting domain forms a covalent bond with its target (e.g., a target on the surface of a tumor cell) and the second targeting domain in the conjugate is bound to a second target on an immune cell (such as a T cell, NK cell, myeloid cell, or macrophage) (e.g., specifically binds to the second target, or binds to the second target by the UAA that forms a covalent bond with the second target), the conjugate brings the immune cell (e.g., T cell, NK cell, myeloid cell, or macrophage) close to the tumor cell and thus activates the immune system against the tumor cell. In one embodiment, the immune cell is a T cell and the second targeting domain is bound to the second target on the T cell. In another embodiment, the immune cell is an NK cell and the second targeting domain is bound to the second target on the NK cell. In some cases, the T cell is an NKT cell. In another embodiment, the immune cell is a myeloid cell and the second targeting domain is bound to the second target on the myeloid cell. In another embodiment, the immune cell is a macrophage and the second targeting domain is bound to the second target on the macrophage.

[0065] In some cases, the conjugate comprises more than two targeting domains and has at least 1, 2, 3, 4, 5, 6 or more than 7 targeting domains. In some cases, the targeting domains are attached to each other via a connector (e.g., a chemical connector, a fusion protein, or other connectors provided herein). In some cases, the first targeting domain and the second targeting domain of the conjugate herein are connected as a fusion protein.

[0066] In some cases, the targeting domain (the first targeting domain, the second targeting domain, or both) comprises an antibody or antigen binding fragment, such as a monospecific Fab2, a bispecific Fab2, a trispecific Fab3, a monovalent IgG, scFv, a bispecific diabody, a trispecific tribody, scFv-Fc, sdAb, a minibody, IgNAR, V-NAR, hcIgG, VHH, or a peptibody. In some embodiments, the targeting moiety comprises a single domain antibody (sdAb; also referred to as a nanobody). In some cases, the targeting domain comprises one or more complementary determining regions (CDR) regions. In some embodiments, the targeting domain comprises an antibody or antigen binding fragment that is bound to a cell surface molecule. In some cases, the conjugate comprises a second targeting domain and the second targeting domain comprises an antibody or antigen binding fragment, such as a monospecific Fab2, a bispecific Fab2, a trispecific Fab3, a monovalent IgG, scFv, a bispecific diabody, a trispecific tribody, scFv-Fc, sdAb, a minibody, IgNAR, V-NAR, hcIgG, VHH, or a peptibody. In some embodiments, the first targeting domain and the second targeting domain each comprise an antibody or antigen binding fragment, and the structures of such antibodies or antigen binding fragments can be the same or different. For example, the first targeting domain can be a single-chain antibody (e.g., Fv), and the second targeting domain can be an sdAb, or for example, the first targeting domain can be an sdAb, and the second targeting domain can be an sdAb.

[0067] In some cases, the targeting domain (eg, the first targeting domain and / or the second targeting domain) is an antibody mimetic, such as an affibody, a Darpin, or a minibinder.

[0068] Non-natural amino acids can be located at any position in the conjugate. In some cases, the first targeting domain comprises non-natural amino acids. In some cases, the first targeting domain is an antibody or Fab comprising one or more complementary determining regions (CDRs), and one or more non-natural amino acids are included in or near the CDR in the first targeting domain. In some cases, the second targeting domain comprises non-natural amino acids. In some cases, the second targeting domain is an antibody or Fab comprising one or more complementary determining regions (CDRs), and one or more non-natural amino acids are included in or near the CDR in the second targeting domain.

[0069] In some cases, the targeting domain comprises any one of SEQ ID NOs: 1-4, 16-18, 20, 22, 29, 50, or 51. In some cases, the targeting domain comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NOs: 1-4, 16-18, 20, 22, 25, 29, 50, or 51. In some cases, the targeting domain comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NOs: 1-4, 16-18, 20, 22, 25, 29, or 50-55 and at least one unnatural amino acid. In some cases, the targeting domain comprises construct C1, C2, C3, C4, C5, C6, C7, C10, C11, C17, C35, C36, C37, C38, C39 or C40. In an exemplary arrangement, the conjugate comprises at least two targeting domains (e.g., a first targeting domain and a second targeting domain). In some cases, the conjugate comprises at least two targeting domains selected from constructs C1, C2, C3, C4, C5, C6, C7, C10, C11, C17, C35, C36, C37, C38, C39 and C40. In some cases, the conjugate comprises a first targeting domain and a second targeting domain selected from constructs C1, C2, C3, C4, C5, C10, C11, C17, C35, C36, C37, C38, C39 and C40. In some cases, the second targeting domain comprises C6, C7, C37, C38, C39, and C40. In some cases, the conjugate comprises a second targeting domain of C6, C7, C37, C38, C39, and C40 and also comprises a first targeting domain that binds to a cell surface protein on a tumor cell. In some cases, the first targeting domain and the second targeting domain are the same. In some cases, the first targeting domain and the second targeting domain are different.

[0070] In some cases, the conjugate comprises a tag, such as a tag for purification (e.g., a his6 tag). In some cases, the tag comprises a polyhistidine tag (e.g., his3, his4, his5, his6, his7, his8, or his9), a hemagglutinin (HA) tag, an SP tag (SEQ ID NO: 34), or a combination thereof. In some cases, the conjugate does not comprise a his6 tag, or the tag is removed before administration. In some cases, the conjugate comprises a leader sequence, such as for expression or secretion. In some cases, the conjugate does not comprise a leader sequence, or the leader sequence is removed before administration.

[0071] In some cases, the conjugate comprises a signal sequence. The signal sequence can allow the conjugate to be expressed, folded or oxidized in a bacterial cell. The signal sequence can allow the conjugate expressed in the bacterium to be transported to another location or environment to promote the folding or function of the conjugate. The signal sequence can be a PelB sequence. The signal sequence can allow the conjugate to be transported to the periplasm of the bacterial cell. The environment can be oxidizing or reducing to allow the formation of disulfides or the reduction of disulfides.

[0072] Target

[0073] The conjugates provided herein can be configured to bind to one or more targets. In some cases, the first targeting domain and the second targeting domain are bound to one or more targets. In some cases, the UAA contained in the targeting domain forms a covalent bond between the targeting domain and the target. In some cases, the conjugate comprises a first targeting domain comprising the first UAA and a second targeting domain comprising the second UAA. These UAAs are identical in some cases, or different in other cases. In some cases, the target is a cell surface molecule (i.e., present in whole or in part on the extracellular surface). In some cases, the first targeting domain and the second targeting domain each bind to different cell surface molecules.

[0074] In some cases, the first targeting domain of the conjugate is configured to bind to a first target, and the first target is a cell surface molecule present on a tumor cell. In some cases, the first target comprises a first cell surface molecule. In some cases, the target is a monomer. In some cases, the target is contained in a multimeric structure of homogeneous or heterogeneous units. In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, CD20, CD20 5. CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6, CD45, CD46, CD4 7. CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2. CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C(GCC), HER2, HER3, HLA-DR, ICAM -1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, integrin α10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT. In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD1 9. CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45 , CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP1, CDH17, CDH6, C EA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCL K1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB, fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR 4. CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, Fol Ra, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT.In some cases, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Mucl, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target comprises a cytokine. In some cases, the cytokine comprises CD2, CD13, CD19, CD20, CD22, CD24, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CD123, CD138, CD142, CD147, CD155, CD166, CD171, CD205, CD228, or CD248.

[0075] In some cases, the second targeting domain of the conjugate is configured to bind to a second target and the second target is a cell surface molecule present on an immune cell. In some cases, the immune cell is a T cell, a NK cell, a γδT cell, a macrophage, a myeloid cell, or other immune cell. In some cases, the T cell is a NKT cell. In some cases, the second target comprises CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, Vγ9Vδ2, or PD-L1.

[0076] In some cases, the first targeting domain binds to a first target of a first cell and the second targeting domain binds to a second target of a second cell, and the first cell is a tumor cell and the second cell is an immune cell. In some cases, the first target on the first cell comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19 , CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD 44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CE A, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, Ep hA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C(GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, integrin α 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, One or more of RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD 20. CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD5 6. CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6 、CLDN9、cMET、CSP-1、CSPG4、CXCR3、CXCR4、CXCR5、DCLK1、DLK1、DLL1、DLL3、Doppel、DPEP3、DPP4、DR5、DUX4、Dysadherin、EDB fibronectin、EGFR、EGFRviii、EMP2、endo180、endoglin、ENPP3、EpCAM、EphA2、EphA3、EphA4、 ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GR PR, GSPT1, GUCY2C(GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR 4. CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, Fol Ra, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT.In some cases, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Mucl, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target comprises a lymphocyte antigen. In some cases, the lymphocyte antigens comprise BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7RILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPα, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB or VPREB1. In some cases, the second target on the second cell comprises one or more of CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, Vγ9Vδ2 or PD-L1.

[0077] The target (e.g., the first target, the second target, or both) engaged by a targeting domain (e.g., the first targeting domain, the second targeting domain, or both) can include various structures. In some cases, the target comprises one or more epitopes that can be engaged by a targeting domain. In some cases, the target comprises multiple epitopes and can be engaged by multiple targeting domains. In some cases, the target comprises a monomer. In some cases, the target comprises a single-stranded peptide. In some cases, the target comprises a polymer molecule. In some cases, the polymer molecule comprises two or more subunits. In some cases, the subunits have the same structure. In some cases, the subunits are different structures, or a combination of the same and different structures. In some cases, the polymer molecule comprises two or more molecules in a complex. In some cases, the polymer molecule comprises two proteins that are compounded or interact with each other.

[0078] In some embodiments, the conjugate can be bound to a first target. In some cases, the conjugate comprises a first targeting domain configured to bind to a first target on a first cell. In some cases, the first targeting domain is bound to the first target via ionic bonds, electrostatic interactions, hydrogen bonding, van der Waals forces, π-π stacking, or a combination thereof. In some embodiments, the first targeting component forms a covalent bond (i.e., covalently crosslinked or covalently bound) with the first target. In some cases, when the first targeting component comprises at least one UAA, the first targeting component forms a covalent bond with the first target.

[0079] In some embodiments, the conjugate can be bound to a second target. In some cases, the conjugate comprises a second targeting domain configured to bind to a second target on a second cell. In some cases, the second targeting domain is bound to the second target via ionic bonds, electrostatic interactions, hydrogen bonding, van der Waals forces, π-π stacking or a combination thereof. In some embodiments, the second targeting component forms a covalent bond (i.e., covalently crosslinked or covalently bound) with the second target. In some cases, when the second targeting component comprises at least one UAA, the second targeting component forms a covalent bond with the second target.

[0080] In some embodiments, the binding of a conjugate component to a target can be determined by an affinity constant (K A ), which can be expressed as the dissociation constant (K D ). In some cases, the conjugate comprises a first targeting domain configured to bind to a first target on a first cell. In some cases, the binding of the first targeting domain to the first target can be mediated by K D1 In some cases, K D1 In some cases, KD1 ranges from about 1 nM to about 1 μM, from 10 nM to about 50 nM, from about 50 nM to about 100 μM, from about 1 μM to about 100 μM. In some cases, KD1 ranges from about 1 nM to about 1 μM, from 10 nM to about 500 nM, from about 50 nM to about 250 nM, from about 100 nM to about 500 nM, or from about 1 nM to about 100 nM. In some cases, K D1 At least about 1 nM, about 10 nM, about 25 nM, 50 nM, about 100 nM, about 250 nM, about 500 nM, about 1 μM, about 50 μM, about 100 μM, about 250 μM, about 500 μM, or about 1 mM. In some cases, when the first targeting domain comprises at least one UAA, the at least one UAA can be covalently bound to the first target. In some cases, when the at least one UAA is covalently bound to the first target, K D1 It is about 0 pM, about 10 pM, about 20 pM, about 50 pM or about 100 pM.

[0081] In some embodiments, the binding of a conjugate component to a target can be determined by an affinity constant (K A ), which can be expressed as the dissociation constant (K D ). In some cases, the conjugate comprises a second targeting domain configured to bind to a second target on the first cell. In some cases, the binding of the second targeting domain configured to bind to the second target can be through K D2 In some cases, K D2 In some cases, K D2 In some cases, K D2 At least about 1 nM, about 10 nM, about 25 nM, 50 nM, about 100 nM, about 250 nM, about 500 nM, about 1 μM, about 50 μM, about 100 μM, about 250 μM, about 500 μM, or about 1 mM. In some cases, when the first targeting domain comprises at least one UAA, the at least one UAA can be covalently bound to the first target. In some cases, when the at least one UAA is covalently bound to the first target, K D2 It is about 0 pM, about 10 pM, about 20 pM, about 50 pM or about 100 pM.

[0082] In some embodiments, the binding of a conjugate component to a target can be measured by the rate of binding to the target (k on ). In some cases, the conjugate comprises a first targeting domain configured to bind to a first target on a first cell. In some cases, the binding of the first targeting domain to the first target can be characterized by a rate of binding k on,1 In some cases, k on,1 Determined by enzyme kinetics measurement. In some cases, enzyme kinetics measurement includes biolayer interferometry (BLI), surface plasmon resonance (SPR), etc. In some cases, k on,1 For single-phase. In some cases, k on,1 In some cases, k on,1 The range is from about 1×10 1 M -1 s -1 About 1×10 6 M -1 s -1 , from about 5×10 1 M -1 s-1 About 1×10 5 M -1 s -1 , from about 1×10 2 M -1 s -1 About 5×10 4 M -1 s -1 or from about 5×10 2 M -1 s -1 About 1×10 3 M -1 s -1 In some cases, k on,1 At least about 1×10 1 M -1 s -1 , about 2×10 1 M -1 s -1 , about 5×10 1 M -1 s -1 , 1×10 1 M -1 s -1 , about 2×10 1 M -1 s -1 , about 5×10 1 M -1 s -1 , about 1×10 2 M -1 s -1 , about 2×10 2 M -1 s -1 , about 5×10 2 M -1 s -1 , about 1×10 3 About M -1 s -1 , about 2×10 3 M -1 s -1 , about 5×10 3 M -1 s -1 , about 1×10 4 M -1 s -1 , about 2×10 4 M -1 s -1 , about 5×10 4 M -1 s -1 , about 1×10 5 M-1 s -1 , about 2×10 5 M -1 s -1 , about 5×10 5 M -1 s -1 or about 1×10 6 M -1 s -1 , about 2×10 6 M -1 s -1 , about 5×10 6 M -1 s -1 In some cases, k on,1 At most, about 1×10 4 M -1 s -1 , about 2×10 4 M -1 s -1 , about 5×10 4 M -1 s -1 , about 1×10 5 M -1 s -1 , about 2×10 5 M -1 s -1 , about 5×10 5 M -1 s -1 or about 1×10 6 M -1 s -1 , about 2×10 6 M -1 s -1 , about 5×10 6 M -1 s -1 .

[0083] In some embodiments, the binding of a conjugate component to a target can be measured by the rate of binding to the target (k on ). In some cases, the conjugate comprises a second targeting domain configured to bind to a second target on a second cell. In some cases, the binding of the second targeting domain to the second target can be characterized by a rate of binding k on,2 In some cases, k on,2 Determined by enzyme kinetics measurement. In some cases, enzyme kinetics measurement includes biolayer interferometry (BLI), surface plasmon resonance (SPR), etc. In some cases, k on,2 For single-phase. In some cases, k on,2In some cases, k on,2 The range is from about 1×10 1 M -1 s -1 About 1×10 6 M -1 s -1 , from about 5×10 1 M -1 s -1 About 1×10 5 M -1 s -1 , from about 1×10 2 M -1 s -1 About 5×10 4 M -1 s -1 or from about 5×10 2 M -1 s -1 About 1×10 3 M -1 s -1 In some cases, k on,2 At least about 1×10 1 M -1 s -1 , about 2×10 1 M -1 s -1 , about 5×10 1 M -1 s -1 , 1×10 1 M -1 s -1 , about 2×10 1 M -1 s -1 , about 5×10 1 M -1 s -1 , about 1×10 2 M -1 s -1 , about 2×10 2 M -1 s -1 , about 5×10 2 M -1 s -1 , about 1×10 3 About M -1 s -1 , about 2×10 3 M -1 s -1 , about 5×10 3 M -1 s -1 , about 1×104 M -1 s -1 , about 2×10 4 M -1 s -1 , about 5×10 4 M -1 s -1 , about 1×10 5 M -1 s -1 , about 2×10 5 M -1 s -1 , about 5×10 5 M -1 s -1 or about 1×10 6 M -1 s -1 , about 2×10 6 M -1 s -1 , about 5×10 6 M -1 s -1 In some cases, k on,2 At most, about 1×10 4 M -1 s -1 , about 2×10 4 M -1 s -1 , about 5×10 4 M -1 s -1 , about 1×10 5 M -1 s -1 , about 2×10 5 M -1 s -1 , about 5×10 5 M -1 s -1 or about 1×10 6 M -1 s -1 , about 2×10 6 M -1 s -1 , about 5×10 6 M -1 s -1 .

[0084] In some embodiments, the binding of a conjugate component to a target can be measured by the dissociation rate or "off-rate" (which can be expressed as k off). In some cases, the conjugate comprises a first targeting domain configured to bind to a first target on a first cell. In some cases, the binding of the first targeting domain to the first target can be characterized by a rate of binding k off,1 In some cases, k off,1 Determined by enzyme kinetics measurement. In some cases, enzyme kinetics measurement includes biolayer interferometry (BLI), surface plasmon resonance (SPR), etc. In some cases, k off,1 For single-phase. In some cases, k off,1 In some cases, k off,1 The range is from about 1×10 -9 s -1 About 1×10 -2 M -1 s -1 , from about 1×10 -8 s -1 About 1×10 -3 M -1 s -1 or from about 1×10 -7 s -1 About 1×10 -4 M -1 s -1 In some cases, k off,1 At least about 1×10 -9 s -1 , about 2×10 -9 s -1 , about 5×10 -9 s -1 , about 1×10 -8 s -1 , about 2×10 -8 s -1 , about 5×10 -8 s -1 , about 1×10 -7 s -1 , about 2×10 -7 s -1 , about 5×10 -7 s -1 , about 1×10 -6 s -1 , about 2×10 -6 s -1 , about 5×10 -6 s -1 , about 1×10 -5 s -1 , about 2×10 -5 s -1 , about 5×10 -5 s -1, about 1×10 -4 s -1 , about 2×10 -4 s -1 , about 5×10 -4 s -1 , about 1×10 -3 s -1 , about 2×10 -3 s -1 , about 5×10 -3 s -1 , about 1×10 -2 s -1 , about 2×10 -2 s -1 , about 5×10 -2 s -1 or about 1×10 -1 s -1 , about 2×10 -1 s -1 , about 5×10 -1 s -1 In some cases, k off,1 At most, about 1×10 -4 s -1 , about 2×10 -4 s -1 , about 5×10 -4 s -1 , about 1×10 -3 s -1 , about 2×10 -3 s -1 , about 5×10 -3 s -1 , about 1×10 -2 s -1 , about 2×10 -2 s -1 , about 5×10 -2 s -1 or about 1×10 -1 s -1 , about 2×10 -1 s -1 , about 5×10 -1 s -1 .

[0085] In some embodiments, the binding of a conjugate component to a target can be measured by the dissociation rate or "off-rate" (which can be expressed as k off ). In some cases, the conjugate comprises a second targeting domain configured to bind to a second target on a second cell. In some cases, the binding of the second targeting domain to the second target can be characterized by a rate of binding k off,2In some cases, k off,2 Determined by enzyme kinetics measurement. In some cases, enzyme kinetics measurement includes biolayer interferometry (BLI), surface plasmon resonance (SPR), etc. In some cases, k off,2 For single-phase. In some cases, k off,2 In some cases, k off,2 The range is from about 1×10 -9 s -1 About 1×10 -2 M -1 s -1 , from about 1×10 -8 s -1 About 1×10 -3 M -1 s -1 or from about 1×10 -7 s -1 About 1×10 -4 M -1 s -1 In some cases, k off,2 At least about 1×10 -9 s -1 , about 2×10 -9 s -1 , about 5×10 -9 s -1 , about 1×10 -8 s -1 , about 2×10 -8 s -1 , about 5×10 -8 s -1 , about 1×10 -7 s -1 , about 2×10 -7 s -1 , about 5×10 -7 s -1 , about 1×10 -6 s -1 , about 2×10 -6 s -1 , about 5×10 -6 s -1 , about 1×10 -5 s -1 , about 2×10 -5 s -1 , about 5×10 -5 s -1 , about 1×10 -4 s -1 , about 2×10 -4 s -1 , about 5×10 -4 s-1 , about 1×10 -3 s -1 , about 2×10 -3 s -1 , about 5×10 -3 s -1 , about 1×10 -2 s -1 , about 2×10 -2 s -1 , about 5×10 -2 s -1 or about 1×10 -1 s -1 , about 2×10 -1 s -1 , about 5×10 -1 s -1 In some cases, k off,2 At most, about 1×10 -4 s -1 , about 2×10 -4 s -1 , about 5×10 -4 s -1 , about 1×10 -3 s -1 , about 2×10 -3 s -1 , about 5×10 -3 s -1 , about 1×10 -2 s -1 , about 2×10 -2 s -1 , about 5×10 -2 s -1 or about 1×10 -1 s -1 , about 2×10 -1 s -1 , about 5×10 -1 s -1 .

[0086] Exemplary Targeting Domains and Exemplary Conjugates

[0087] The conjugates herein include a targeting domain that can be assembled by a molecule that is engaged with a target. In some cases, the targeting domain includes an antigen binding region, wherein the antigen binding region is engaged with a specific target. Such antigen binding regions may include CDRs, such as 3 CDRs commonly found in the heavy or light chains of antibodies. In some cases, the targeting domain includes an antigen binding fragment, which includes CDRs, such as VHH (also referred to as a single domain antibody (sdAb)). In some cases, a single domain antibody includes one or more UAAs. In some cases, the targeting domain of the conjugate is selected from the single domain antibodies of Table 1, such as any one of C1, C2, C3, C4, C5, C6, C7, C10, C11, C17, C35 or C37. In some cases, the targeting domain of the conjugate is selected from a single domain antibody of Table 1, such as any one of C1, C2, C3, C4, C5, C6, C7, C10, C11, C17, C35 or C37, and one or more UAAs are present in or near the CDR of the single domain antibody. In some cases, the first targeting domain of the conjugate is selected from a single domain antibody of Table 1, such as any one of C1, C2, C3, C4, C5, C6, C7, C10, C11, C17, C35 or C37, and the second targeting domain binds to a second target on a second cell. In some cases, the second cell is an immune cell. In some cases, the second targeting domain comprises C6, C7, C37, C38, C39 or C40. In some cases, the second targeting domain is C6 or C7. In some cases, the second targeting domain is C37, C38, C39 or C40. In some cases, the first targeting domain and the second targeting domain are not the same. In some cases, the conjugate comprises a tag, such as a polyhistidine tag, an HA tag, or an SP tag. In some cases, the conjugate does not comprise a tag. In some cases, the tag (such as a polyhistidine tag, an HA tag, or an SP tag) can be cleaved.

[0088] In some cases, the first targeting domain of the conjugate comprises a construct C1 having an unnatural amino acid in CDR1, CDR2 or CDR3. In some cases, the conjugate comprises a construct C1 having an unnatural amino acid at any one of positions 26, 28, 29, 30, 99, 102, 103, 105, 108, 110, 111, 112, 113, 114 and 115 in SEQ ID NO: 1, 4 or 20. In some cases, the conjugate comprises a construct C1 having an unnatural amino acid at any one of positions 28, 102, 112 and 113 in SEQ ID NO: 1, 4 or 20. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb. In some cases, such an sdAb comprises SEQ ID NO: 1. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 1. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 1. In some cases, such conjugates have a second targeting domain that binds to an immune cell. In some cases, the second targeting domain comprises C6, C7, C37, C38, C39 or C40, or SEQ ID NO: 22, 25, 52, 53, 54 or 55. In some cases, the second targeting domain comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO:22, 25, 52, 53, 54, or 55.

[0089] In some cases, the first targeting domain of the conjugate comprises a construct C2 having an unnatural amino acid in CDR1, CDR2, or CDR3. In some cases, the conjugate comprises a construct C2 having an unnatural amino acid at any one of positions 50, 52, 53, 54, 56, 58, or 100 of SEQ ID NO: 2, 28, 29, or 30. In some cases, the conjugate comprises a single domain antibody (sdAb) comprising an sdAb and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises SEQ ID NO: 2. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 2. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 2. In some cases, such conjugates have a second targeting domain that binds to immune cells. In some cases, the second targeting domain comprises C6, C7, C37, C38, C39, or C40, or SEQ ID NO: 22, 25, 52, 53, 54, or 55. In some cases, the second targeting domain comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 22, 25, 52, 53, 54, or 55.

[0090] In some cases, the first targeting domain of the conjugate comprises a construct C3 having an unnatural amino acid in CDR1, CDR2, or CDR3. In some cases, the conjugate comprises a construct C3 having an unnatural amino acid at any one of positions 58, 62, 101, 103, or 107 of SEQ ID NO: 3. In some cases, the conjugate comprises an unnatural amino acid in CDR1, CDR2, or CDR3 of C3. In some cases, the conjugate comprises an unnatural amino acid at position 109. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises SEQ ID NO: 3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises a sequence with at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 3. In some cases, the conjugate comprises a first targeting domain with at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 3. In some cases, such conjugates have a second targeting domain that binds to an immune cell. In some cases, the second targeting domain comprises C6, C7, C37, C38, C39 or C40, or SEQ ID NO: 22, 25, 52, 53, 54 or 55. In some cases, the second targeting domain comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO:22, 25, 52, 53, 54, or 55.

[0091] In some cases, the first targeting domain of the conjugate comprises construct C4 having an unnatural amino acid in CDR1, CDR2 or CDR3. In some cases, the conjugate comprises construct C3 having an unnatural amino acid at position 109 of SEQ ID NO: 16. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises SEQ ID NO: 16. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 16. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 16. In some cases, such conjugates have a second targeting domain that binds to immune cells. In some cases, the second targeting domain comprises C6, C7, C37, C38, C39, or C40, or SEQ ID NO: 22, 25, 52, 53, 54, or 55. In some cases, the second targeting domain comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 22, 25, 52, 53, 54, or 55.

[0092] In some cases, the first targeting domain of the conjugate is included in a construct C5 with an unnatural amino acid in CDR1, CDR2 or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) in or near the CDR region in the sdAb, wherein the sdAb comprises SEQ ID NO: 18. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) in or near the CDR region in the sdAb, wherein the sdAb comprises a sequence with at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 18. In some cases, the conjugate comprises a first targeting domain with at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 18. In some cases, such conjugates have a second targeting domain that is bound to an immune cell. In some cases, the second targeting domain comprises C6, C7, C37, C38, C39, or C40, or SEQ ID NO: 22, 25, 52, 53, 54, or 55. In some cases, the second targeting domain comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 22, 25, 52, 53, 54, or 55.

[0093] In some cases, the second targeting domain of the conjugate comprises construct C6. In some cases, the second targeting domain of the conjugate comprises construct C6 with unnatural amino acids in CDR1, CDR2 or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) in or near the CDR region in the sdAb, wherein the sdAb comprises SEQ ID NO: 22. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) in or near the CDR region in the sdAb, wherein the sdAb comprises a sequence with SEQ ID NO: 22 having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity. In some cases, the conjugate comprises a second targeting domain with at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 22. In some cases, such conjugates comprise a first targeting domain that binds to a first target on the surface of a tumor cell.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6 , CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, C EACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB, fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, EphA 3. EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, G RPR, GSPT1, GUCY2C(GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD 20. CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD5 6. CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6 、CLDN9、cMET、CSP-1、CSPG4、CXCR3、CXCR4、CXCR5、DCLK1、DLK1、DLL1、DLL3、Doppel、DPEP3、DPP4、DR5、DUX4、Dysadherin、EDB fibronectin、EGFR、EGFRviii、EMP2、endo180、endoglin、ENPP3、EpCAM、EphA2、EphA3、EphA4、 ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GR PR, GSPT1, GUCY2C(GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR 4. CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, Fol Ra, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT.In some cases, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Mucl, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target comprises a lymphocyte antigen. In some cases, the lymphocyte antigens comprise BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, In some cases, the first targeting domain comprises C1, C2, C3, C4, C5, C10, C11, C17, C35 or C36, or the first targeting domain has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to any one of SEQ ID NO: 1, 2, 3, 16, 18, 20, 29, 50 or 51.

[0094] In some cases, the second targeting domain of the conjugate comprises a construct C7 having an unnatural amino acid in CDR1, CDR2 or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises SEQ ID NO: 25. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 25. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 25. In some cases, such conjugates comprise a first targeting domain that binds to a first target on the surface of a tumor cell.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6 , CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, C EACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB, fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, EphA 3. EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, G RPR, GSPT1, GUCY2C(GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36 , CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP 1. CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR 4. CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB, fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, and integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR 4. CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, Fol Ra, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT.In some cases, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Mucl, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target comprises a lymphocyte antigen. In some cases, the lymphocyte antigens comprise BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, In some cases, the first targeting domain comprises C1, C2, C3, C4, C5, C10, C11, C17, C35 or C36, or the first targeting domain has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to any one of SEQ ID NO: 1, 2, 3, 16, 18, 20, 29, 50 or 51.

[0095] In some cases, the second targeting domain of the conjugate comprises construct C37. In some cases, the second targeting domain of the conjugate comprises construct C37 with unnatural amino acids in CDR1, CDR2 or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near the CDR region within the sdAb, wherein the sdAb comprises SEQ ID NO: 52. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near the CDR region within the sdAb, wherein the sdAb comprises a sequence with at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 52. In some cases, the conjugate comprises a second targeting domain with at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 52. In some cases, such conjugates comprise a first targeting domain that binds to a first target on the surface of a tumor cell.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171 , CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD4 0. CD44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6 , CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, E phA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C(GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36 , CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP 1. CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR 4. CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB, fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, and integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR 4. CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, Fol Ra, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT.In some cases, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Mucl, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target comprises a lymphocyte antigen. In some cases, the lymphocyte antigens comprise BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7RILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPα, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB or VPREB1. In some cases, the first targeting domain comprises C1, C2, C3, C4, C5, C10, C11, C17, C35 or C36. In some cases, the first targeting domain has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any of SEQ ID NO: 1, 2, 3, 16, 18, 20, 29, 50, or 51.

[0096] In some cases, the second targeting domain of the conjugate comprises a construct C38 having an unnatural amino acid in CDR1, CDR2 or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises SEQ ID NO: 53. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 53. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 53. In some cases, such conjugates comprise a first targeting domain that binds to a first target on the surface of a tumor cell.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6 , CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, C EACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB, fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, EphA 3. EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, G RPR, GSPT1, GUCY2C(GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36 , CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP 1. CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR 4. CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB, fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, and integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR 4. CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, Fol Ra, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT.In some cases, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Mucl, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target comprises a lymphocyte antigen. In some cases, the lymphocyte antigens comprise BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7RILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPα, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB or VPREB1. In some cases, the first targeting domain comprises C1, C2, C3, C4, C5, C10, C11, C17, C35 or C36. In some cases, the first targeting domain has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any of SEQ ID NO: 1, 2, 3, 16, 18, 20, 29, 50, or 51.

[0097] In some cases, the conjugate comprises a construct C39 with an unnatural amino acid in CDR1, CDR2 or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises SEQ ID NO: 54. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 54. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity to SEQ ID NO: 54. In some cases, such conjugates comprise a first targeting domain that binds to a first target on the surface of a tumor cell.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171 , CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD4 0. CD44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6 , CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, E phA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C(GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36 , CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP 1. CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR 4. CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB, fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, and integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR 4. CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, Fol Ra, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT.In some cases, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Mucl, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target comprises a lymphocyte antigen. In some cases, the lymphocyte antigens comprise BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7RILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPα, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB or VPREB1. In some cases, the first targeting domain comprises C1, C2, C3, C4, C5, C10, C11, C17, C35 or C36. In some cases, the first targeting domain has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any of SEQ ID NO: 1, 2, 3, 16, 18, 20, 29, 50, or 51.

[0098] In some cases, the conjugate comprises a construct C40 with an unnatural amino acid in CDR1, CDR2 or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises SEQ ID NO: 55. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one unnatural amino acid (UAA) within or near a CDR region within the sdAb, wherein the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity with SEQ ID NO: 55. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity with SEQ ID NO: 55. In some cases, such conjugates comprise a first targeting domain that binds to a first target on the surface of a tumor cell.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171 , CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD4 0. CD44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6 , CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, E phA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C(GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36 , CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP 1. CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR 4. CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB, fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, and integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR 4. CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, Fol Ra, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT.In some cases, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Mucl, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target comprises a lymphocyte antigen. In some cases, the lymphocyte antigens comprise BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7RILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPa, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB, or VPREB1.

[0099] In some cases, the first targeting domain comprises C1, C2, C3, C4, C5, C10, C11, C17, C35, or C36. In some cases, the first targeting domain has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NO: 1, 2, 3, 16, 18, 20, 29, 50, or 51.

[0100] The conjugates described herein may include two or more targeting domains. In some cases, the conjugate having the first targeting domain and the second targeting domain includes any one of SEQ ID NO: 19, 21, 23, 24, 26, 27, 30, 35-49, 57 or 64. In some cases, the conjugate has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70% or at least 65% sequence identity with any one of SEQ ID NO: 19, 21, 23, 24, 26, 27, 30, 35-49, 57 or 64. In some cases, the first targeting domain and the second targeting domain are attached to each other via a connector. In some cases, the conjugate is a fusion protein. In some cases, the connector includes a connector L1 (SEQ ID NO: 14), L2 (SEQ ID NO: 31), L3 (SEQ ID NO: 32), L4 (SEQ ID NO: 33) or L5 (SEQ ID NO: 34). In some cases, the conjugate comprises any one of SEQ ID NO: 19, 21, 23, 24, 26, 27, 28, 30, 35-49, 57, or 64. In some cases, the conjugate has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NO: 19, 21, 23, 24, 26, 27, 28, 30, 35-49, 57, or 64. In some cases, the conjugate comprises any one of SEQ ID NO: 19, 21, 23, 24, 26, 27, 28, 30, 35-49, 57, or 64 without a terminal his6, HA, or SP tag.

[0101] Exemplary targeting domain-associated sequences are described herein in Table 1.

[0102] Table 1: Exemplary targeting domain-associated sequences

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110] Note: X indicates the position of the FSY incorporation site. Sequences in the table with tags (such as His6 purification tags, HA tags), sortase recognition sites, SP linkers (L5) and / or PeIB leader sequences are also reflected herein. The sequences of Table 1 may be present without tags.

[0111] Unnatural amino acids (UAA) can be incorporated into the conjugates described herein. In some cases, UAA is present in the targeting domain of the conjugate. In some cases, UAA is configured in the targeting domain to covalently bind to the target. In some cases, the conjugate comprises one, two, three, four or more UAA. In some cases, the conjugate comprises a first targeting domain comprising a first UAA and a second targeting domain comprising a second UAA. In some cases, UAA is configured in the targeting domain to covalently bind to the amino acid present in the target when the targeting domain is engaged with the target. In some cases, such UAA includes nucleophilic amino acids. In some cases, UAA forms a covalent bond with lysine, histidine or tyrosine. In some cases, UAA is located in the target binding domain. In some cases, one or more UAAs are located in one or more CDRs of a targeting domain (such as a targeting domain comprising an antibody or an antigen binding fragment, such as a single domain antibody). In some embodiments, UAA comprises an aryl fluorosulfate moiety. In some cases, UAA is genetically encoded into the conjugates described herein. In some cases, UAA includes variants of tyrosine or lysine. In some embodiments, the non-natural amino acid residue comprises the structure of Formula I: In some embodiments, the non-natural amino acid residue comprises the structure of Formula II: In some embodiments, the unnatural amino acid is 2-amino-3-(4-((fluorosulfonyl)oxy)phenyl)propanoic acid: In some embodiments, the unnatural amino acid is fluorosulfonyltyrosine (FSY): In some embodiments, the unnatural amino acid is N6-(4-((fluorosulfonyl)oxy)benzoyl)lysine: In some embodiments, the unnatural amino acid is fluorosulfonyloxybenzoyl-L-lysine (FSK): In some embodiments, the unnatural amino acid is 2-amino-3-(3-fluoro-4-((fluorosulfonyl)oxy)phenyl)propanoic acid: In some embodiments, the unnatural amino acid is fluoro-fluorosulfonyltyrosine (FFY):

[0112] In some embodiments, the unnatural amino acid (UAA) has the structure of Formula (IA):

[0113]

[0114] in,

[0115] Each X is independently O or NR';

[0116] Y is a bond, -O-, -NR- or -N=;

[0117] A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4;

[0118] When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl;

[0119] R 1 is hydrogen, fluorine or iodine; R 2 is hydrogen or methyl;

[0120] L is -(CH2) p -or-C(O)NH-(CH2) p -; p is an integer from 1 to 6; and

[0121] When Y is -O- or -NR-, m is 1; when Y is -N=, m is 2.

[0122] In some embodiments, the UAA of Formula (IA) has Formula (IA-a): In some embodiments, the UAA of formula (IA) has formula (IA-b): structure.

[0123] In some embodiments, the UAA of Formula (IA) has the structure of Formula (IB):

[0124]

[0125] In some embodiments, the UAA of Formula (IB) has Formula (IB-a): In some embodiments, the UAA of formula (IB) has formula (IB-b): structure.

[0126] In some embodiments, the UAA of Formula (IA) has the structure of Formula (IC):

[0127]

[0128] In some embodiments, the UAA of Formula (IC) has Formula (IC-a): In some embodiments, the UAA of formula (IB) has formula (IB-b): In some embodiments, R is hydrogen.

[0129] In some embodiments, the UAA of Formula (IA) has the structure of Formula (ID):

[0130]

[0131] wherein each X is independently O or NR';

[0132] Y is a bond, -O-, -NR- or -N=;

[0133] A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4;

[0134] When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl;

[0135] R 1 is hydrogen, fluorine or iodine; R 2 is hydrogen or methyl; and

[0136] When Y is a bond, -O- or -NR-, m is 1; when Y is -N=, m is 2.

[0137] In some embodiments, the UAA of Formula (ID) has Formula (ID-a): In some embodiments, the UAA of formula (ID) has formula (ID-b): structure.

[0138] In some embodiments, the UAA of Formula (IA) has the structure of Formula (IE):

[0139]

[0140] wherein each X is independently O or NR';

[0141] Y is a bond, -O-, -NR- or -N=;

[0142] A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4;

[0143] When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl;

[0144] R 1 is hydrogen, fluorine or iodine; R 2 is hydrogen or methyl; and

[0145] When Y is a bond, -O- or -NR-, m is 1; when Y is -N=, m is 2.

[0146] In some embodiments, the UAA of Formula (IE) has Formula (IE-a): In some embodiments, the UAA of Formula (IE) has Formula (IE-b): In certain embodiments, Y is a bond, -O-, or -NR-, and m is 1. In other embodiments, Y is -N=, and m is 2. In certain embodiments, Y is -O- and m is 1. In other embodiments, Y is -NR- and m is 1. In other embodiments, Y is a bond and m is 1. In other embodiments, Y is O- or -NR-, and m is 1.

[0147] In some embodiments, the UAA of Formula (IA) has the structure of Formula (IIA):

[0148]

[0149] in:

[0150] X is independently O or NR'; and

[0151] When present, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl.

[0152] In some embodiments, the UAA of Formula (IIA) has Formula (IIA-a): In some embodiments, the UAA of formula (IIA) has formula (IIA-b): structure.

[0153] In some embodiments, the UAA of Formula (IA) has the structure of Formula (IIB):

[0154]

[0155] in:

[0156] X is independently O or NR'; and

[0157] When present, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl.

[0158] In some embodiments, the UAA of Formula (IIB) has Formula (IIB-a): In some embodiments, the UAA of formula (IIB) has formula (IIB-b): structure.

[0159] In some embodiments, the unnatural amino acid (UAA) has The structure,

[0160] in,

[0161] Each X is independently O or NR';

[0162] Y is a bond, -O-, -NR- or -N=;

[0163] A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4;

[0164] When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl;

[0165] Ring A is a 5- to 6-membered aryl or heteroaryl group;

[0166] Each R A are independently -OH, -OR X , halogen, NHR X 、N(R X )2 or optionally substituted alkyl; p is 0, 1, 2, 3 or 4; each R X is an optionally substituted alkyl group;

[0167] L is -(CH2) p -or-C(O)NH-(CH2) p -; p is an integer from 1 to 6; and

[0168] When Y is a bond, -O- or -NR-, m is 1; when Y is -N=, m is 2.

[0169] In some embodiments, A is a bond. In other embodiments, A is -(CH2) n-. In some embodiments, n is 1, 2, 3, or 4. In one embodiment, n is 1. In another embodiment, n is 2. In another embodiment, n is 3. In another embodiment, n is 4.

[0170] In some embodiments, Ring A is a 5-membered ring. In some embodiments, Ring A is a 6-membered ring. In some embodiments, Ring A is an aryl group. In some embodiments, Ring A is a heteroaryl group. In some embodiments, Ring A is a 6-membered aryl group. In some embodiments, Ring A is a 6-membered heteroaryl group. In one embodiment, Ring A is a phenyl group.

[0171] In some embodiments, p is 0. In some embodiments, p is an integer from 1 to 4. In some embodiments, p is an integer from 1 to 3. In one embodiment, p is 1. In another embodiment, p is 2. In another embodiment, p is 3. In another embodiment, p is 4.

[0172] In some embodiments, each R A is independently -OH, halogen, or optionally substituted alkyl. A is independently halogen or optionally substituted alkyl. A is independently -OH or optionally substituted alkyl. A is independently optionally substituted alkyl. A is independently substituted alkyl. A is independently unsubstituted alkyl. A In another embodiment, each R A In one embodiment, wherein p is 1, R A In another specific embodiment, wherein p is 2, each R A It is methyl.

[0173] In some embodiments, Y is a bond, -O-, -NR-, or -N=. In some embodiments, Y is -O-, -NR-, or -N=. In some embodiments, Y is a bond, -O-, or -NR-. In some embodiments, Y is a bond, -O-, or -N=. In some embodiments, Y is a bond, -NR-, or -N=. In some embodiments, Y is -O-, or -NR-. In some embodiments, Y is -O-, or -N=. In some embodiments, Y is -NR-, or -N=. In one embodiment, Y is a bond. In another embodiment, Y is -O-. In another embodiment, Y is -NR-. In another embodiment, Y is -N=.

[0174] In some embodiments, L is -(CH2) p -. In other embodiments, L is -C(O)NH-(CH2) p -. In some embodiments, p is an integer from 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2. In one embodiment, p is from 1 to 4. In another embodiment, p is 1 or 2. In another embodiment, p is 1 or 4. In one embodiment, L is -CH2-. In another embodiment, L is -C(O)NH-(CH2)4-.

[0175] In some embodiments, R is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl. In some embodiments, R is hydrogen or substituted or unsubstituted alkyl. In one embodiment, R is hydrogen. In another embodiment, R is substituted or unsubstituted C 1-6 In another embodiment, R is an unsubstituted C 1-6 In one embodiment, R is methyl. In another embodiment, R is hydrogen or methyl.

[0176] In some embodiments, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl. In some embodiments, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. In some embodiments, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl. In some embodiments, R' is hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl. In embodiments, R' is hydrogen. In another embodiment, R' is substituted or unsubstituted. In another embodiment, R' is substituted or unsubstituted aryl.

[0177] In some embodiments, R 1 In some embodiments, R 1 In some embodiments, R 1 In some embodiments, R 2 In other embodiments, R 2 In some embodiments, R 1 is hydrogen and R 2 In some embodiments, R 1 is hydrogen and R 2In some embodiments, R 1 is fluorine and R 2 In some embodiments, R 1 is iodine and R 2 For hydrogen.

[0178] In some cases, UAA is located near one or more residues on the target. In some cases, UAA forms a covalent bond with a residue on the target. In some cases, the residue on the target is an amino acid in the polypeptide chain of the target, such as lysine, tyrosine or histidine. In some cases, after the targeting domain is combined with the target, UAA is within 5-20, 5-10, 8-20, 10-17, 10-20 or 1-20 angstroms of the residue on the target, and forms a covalent bond with it. In some cases, the non-natural amino acids described herein are incorporated into the peptide chain of the targeting domain. In some cases, the non-natural amino acids described herein are incorporated into the peptide chain of the targeting domain via an amide bond.

[0179] Connector

[0180] In some embodiments, useful functional reactive groups for conjugating or binding the targeting domain to another targeting domain described herein include, for example, zero or higher order linkers. In some cases, the conjugated moiety includes a functional reactive group that reacts with a linker described herein (optionally pre-attached to the targeting domain or other parts of the conjugate). In some embodiments, the linker includes a reactive group that reacts with a natural amino acid in a targeting moiety described herein.

[0181] In various embodiments, the targeting domain is connected or separated by a connector. The connector can be a polypeptide connector. The connector can be expressed via recombinant technology and can be encoded using a nucleic acid sequence together with the expression of the targeting domain. The connector can connect the first targeting domain and the second targeting domain to form a fusion protein. The presence of the connector in the conjugate can allow the targeting domain to function properly without being disturbed by the space of other targeting domains. The connector can be a flexible connector. The flexibility of the connector can allow the targeting domain to adopt an independent conformation with minimal interference from other targeting domains. In some embodiments, the connector is a polypeptide connector comprising, for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 30, 35, 40, 45, 50 or more amino acids. In some cases, the polypeptide connector comprises at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 30, 35, 40, 45, 50 or less amino acids. In other cases, the polypeptide linker comprises about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids. In some cases, the polypeptide linker comprises L1. In some cases, the peptide linker comprises (GGGGS) x (SEQ ID NO:65) or (GGGGSGGGS) x (SEQ ID NO:56), wherein x is an integer from 1 to 10. In some cases, the peptide linker comprises (GGGGS) x , wherein x is an integer from 1 to 4.

[0182] In some embodiments, the linking group consists of an amino acid, a dipeptide, a tripeptide, or a polypeptide, wherein the amino acid, dipeptide, tripeptide, or polypeptide comprises at least two activating groups as described herein. In some embodiments, the linking group (L) comprises a moiety selected from amino, ether, thioether, maleimide, disulfide, amide, ester, thioester, olefin, cycloolefin, alkyne, triazole, carbamate, carbonate, cathepsin B cleavable and hydrazone.

[0183] In some embodiments, L comprises an atomic chain of 1 to about 60, or 1 to 30 or longer, 2 to 5, 2 to 10, 5 to 10 or 10 to 20 atoms. In some embodiments, the chain atoms are all carbon atoms. In some embodiments, the chain atoms in the skeleton of the linker are selected from C, O, N and S. In some cases, the chain atoms and the linker are selected according to their expected solubility (hydrophilicity) to provide a more soluble conjugate. In some embodiments, L provides a functional group that can be cut by an enzyme or other catalyst or by hydrolysis conditions found in a target tissue or organ or cell. In some embodiments, the length of L is sufficient to reduce the possibility of steric hindrance.

[0184] Optionally, multiple targeting domains or modified targeting domain molecules can be connected by a linker polypeptide, wherein the length of the linker polypeptide is optionally 1, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12 amino acids, and longer, wherein optionally, the N-terminus of one targeting domain is fused to the C-terminus of the linker polypeptide, and the N-terminus of the linker polypeptide is fused to the N-terminus of another targeting domain.

[0185] Treatment

[0186] The conjugates described herein can be used to treat conditions and / or diseases. In some cases, the disease includes a proliferative disease. In some cases, the proliferative disease includes cancer. In some cases, cancer includes tumor cells. In some cases, cancer includes solid or liquid tumors. In some cases, the conjugate is administered to kill rapidly dividing cells (such as tumor cells) or inhibit the growth of rapidly dividing cells. In some cases, the method for treating a proliferative disease or condition of an object in need includes administering a therapeutically effective amount of the conjugate described herein to the object. In some embodiments, the proliferative disease or condition is cancer. In some embodiments, cancer is a solid tumor cancer. In some embodiments, solid tumor cancer is bladder cancer, bone cancer, brain cancer, breast cancer, colorectal cancer, esophageal cancer, eye cancer, head and neck cancer, kidney cancer, lung cancer, melanoma, ovarian cancer, pancreatic cancer or prostate cancer. In some instances, the disease includes PCa (prostate cancer), CRPCa (castration-resistant prostate cancer), solid tumors (neovasculature), NSCLC (non-small cell lung cancer), HNSCC (head and neck squamous cell carcinoma), ESCC (esophageal cancer), GC (gastric cancer), CRC (colorectal cancer), SCLC (small cell lung cancer), MPM (mesothelioma), PDAC (pancreatic ductal adenocarcinoma), ALL (acute lymphoblastic leukemia), AML (acute myeloid leukemia), MDS (myelodysplastic syndrome), MSI-high tumors, melanoma, DLBCL (diffuse large B-cell lymphoma), endometrial cancer, cervical cancer, bladder cancer, BrCa (breast cancer), TNBC (triple negative breast cancer), NE-PCa (neuroendocrine prostate cancer), GBM (glioblastoma) and RCC (renal cell carcinoma).

[0187] In some cases, the tumor cells targeted herein overexpress one or more targets. In some cases, the targets include surface markers or receptors. In some cases, the targets are selected from 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, C D20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, CE ACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, endoglin, ENPP3, EpCAM, EphA2, EphA 3. EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, G RPR, GSPT1, GUCY2C(GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, integrin α 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, One or more of RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target comprises 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD 20. CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD5 6. CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6 、CLDN9、cMET、CSP-1、CSPG4、CXCR3、CXCR4、CXCR5、DCLK1、DLK1、DLL1、DLL3、Doppel、DPEP3、DPP4、DR5、DUX4、Dysadherin、EDB fibronectin、EGFR、EGFRviii、EMP2、endo180、endoglin、ENPP3、EpCAM、EphA2、EphA3、EphA4、 ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GR PR, GSPT1, GUCY2C(GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, p-cadherin, PD-L1, PD-L2, podocalyxin, PRLR, prostaglandin F2 receptor negative regulator, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR 4. CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, Fol Ra, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT.In some cases, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Mucl, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target comprises a lymphocyte antigen. In some cases, the lymphocyte antigens comprise BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7RILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPa, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB, or VPREB1.

[0188] The pharmaceutical composition is applied in a manner suitable for the disease to be treated (or prevented). The appropriate dosage, appropriate duration and frequency of application will be determined by factors such as the patient's condition, the type and severity of the patient's disease, the specific form of the active ingredient and the method of administration. In general, appropriate dosage and treatment regimen provide compositions in an amount sufficient to provide treatment and / or prevention benefits (e.g., improved clinical results), or to alleviate the severity of symptoms. The optimal dose is usually determined using experimental models and / or clinical trials. The optimal dose depends on the patient's body mass, weight or blood volume.

[0189] In one embodiment, the injectable pharmaceutical compositions described herein are used to prepare a medicament for treating a disease or condition in a mammal that would benefit from administration of any of the injectable pharmaceutical combinations of the disclosed conjugates. A method of treating any disease or condition described herein in a mammal in need of such treatment involves administering to the mammal a pharmaceutical composition comprising at least one compound described herein, or a pharmaceutically acceptable salt, active metabolite, prodrug, or pharmaceutically acceptable solvate thereof, in a therapeutically effective amount.

[0190] In certain embodiments, a composition containing a compound as described herein is administered for preventive and / or therapeutic treatment. In certain therapeutic applications, the composition is administered to a patient who has suffered from the disease or condition in an amount sufficient to cure or at least partially alleviate at least one symptom of the disease or condition. The effective amount of this usage depends on the severity and course of the disease or condition, previous treatment, the patient's health, body weight and response to the drug, and the judgment of the attending physician. The therapeutically effective amount is optionally determined by methods including but not limited to dose escalation and / or dose range clinical trials.

[0191] In preventive applications, compositions containing compounds described herein are administered to patients susceptible to or at risk of a particular disease, disorder or condition. Such an amount is defined as a "prophylactically effective amount or dose". In this use, the exact amount also depends on the patient's health, weight, etc. When used for a patient, the effective amount used will depend on the severity and course of the disease, disorder or condition, previous treatment, the patient's health and response to the drug, and the judgment of the attending physician. In one aspect, preventive treatment includes administering a pharmaceutical composition comprising a compound described herein or a pharmaceutically acceptable salt thereof to a mammal to prevent the recurrence of symptoms of a disease or condition, wherein the mammal has previously experienced at least one symptom of the disease being treated and is currently in remission.

[0192] In certain embodiments, where the patient's condition has not improved, according to the physician's judgment, the compound is administered chronically, i.e., for an extended period of time, including throughout the patient's life, to improve or otherwise control or limit the symptoms of the patient's disease or condition.

[0193] Manufacturing method

[0194] The conjugates described herein can be synthesized using an in vivo or in vitro method or a combination of methods. In some cases, the method is an in vivo method. In some cases, the method is an in vitro method. In some cases, the conjugate comprises a first targeting domain and a second targeting domain, and the first targeting domain comprising a non-natural amino acid is synthesized in vivo, and the second targeting domain is attached in vivo (such as by a fusion protein). In some cases, the conjugate comprises a first targeting domain and a second targeting domain, and an in vitro chemical method is used to synthesize the first targeting domain comprising a non-natural amino acid. In some cases, the method is an ex vivo method. In some cases, recombinant production or chemical synthesis comprises a conjugate described herein comprising a natural amino acid mutation or a non-natural amino acid mutation. In some cases, the first targeting domain, the second targeting domain, or the first targeting domain and the second targeting domain described herein are both recombinantly produced, for example, by a host cell system or a cell-free system.

[0195] In general, methods for preparing target polypeptides comprising non-standard amino acids are known. In some cases, the aminoacyl tRNA synthetase / tRNA pair homologous to the non-natural amino acid is orthogonal to the cellular components of the cell in which it is used. The orthogonality (and therefore suitability) of the exogenous aminoacyl tRNA synthetase / tRNA pair depends on the type of host organism. Four major orthogonal aminoacyl tRNA synthetases have been developed for genetic code expansion: Methanococcus janaschii tyrosyl-tRNA synthetase (MjTyrRS) / tRNA synthetase (MjTyrRS) CUA Escherichia coli tyrosyl-tRNA synthetase (EcTyrRS) / tRNA CUA , Escherichia coli leucyl-tRNA synthetase (EcLeuRS) / tRNA CUA Pyrrolysyl-tRNA synthetase PylRS / tRNA from Methanomethylophilus alvus CUA Pyrrolysyl-tRNA synthetase (PylRS) / tRNA from certain Methanosarcina species CUA (tRNA pyl )Yes. PylRS / tRAN CUA The pairs are orthogonal in bacteria, eukaryotic cells, and animals (see, e.g., Chin, Jason W. "Expanding and reprogramming the genetic code of cells and animals." Annual review of biochemistry 83 (2014): 379-408).

[0196] In some cases, pyrrolysyl-tRNA synthetase (tRNA pyl ) is incorporated into the unnatural amino acid (UAA) provided herein. The unnatural amino acid (UAA) is introduced into the transfer RNA molecule (tRNA) to make it available for translation. However, the attachment of the unnatural amino acid to the tRNA is not necessarily accomplished by the naturally occurring aminoacyl-tRNA synthetase. Therefore, engineered aminoacyl tRNA synthetases such as those generated from tRNA pyl Engineered tRNAs prepared and selected from mutant libraries pyl Can be used to attach a desired UAA to a tRNA, thereby enabling the desired UAA to be incorporated by mutagenesis.

[0197] In some embodiments, an engineered mutant tRNA capable of attaching this UAA can be used pylVariants attach a UAA provided herein (e.g., a UAA of Formula (I), (II), (III), (IA), (IB), (IC), (ID), (IE), (IIA), (IIB), or (IV) (such as FSY, FSK, and FFY)) to a tRNA. In some embodiments, as with a wild-type tRNA pyl In comparison, mutant tRNA pyl Variants comprise single amino acid mutations. In other embodiments, such as with wild-type tRNA pyl In comparison, mutant tRNA pyl Variants include multiple amino acid mutations. In some embodiments, those skilled in the art prepare and screen tRNA pyl Variant library to select the appropriate tRNA pyl Variants are used to attach the desired UAA. In some embodiments, the tRNA used to introduce the UAA in the conjugates provided herein pyl Variants are tRNAs described in US 8,735,093, US 9,133,449, WO2020206341 pyl variants, each of which is incorporated herein by reference.

[0198] In some embodiments, the mutant pyrrolysyl-tRNA synthetase provided herein comprises at least 5 amino acid residues replaced within the substrate binding site of the mutant pyrrolysyl-tRNA synthetase. In some embodiments, the mutant pyrrolysyl-tRNA synthetase provided herein has the amino acid sequence of SEQ ID NO:58. In some embodiments, the mutant pyrrolysyl-tRNA synthetase comprises the amino acid sequence of SEQ ID NO:58. In some embodiments, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence with SEQ ID NO:58 having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity. In some embodiments, the mutant pyrrolysyl-tRNA synthetase provided herein is encoded by the nucleic acid sequence of SEQ ID NO:59. In some embodiments, the mutant pyrrolysyl-tRNA synthetase is encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO:59. In some embodiments, the mutant pyrrolysyl-tRNA synthetase is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 59. In some embodiments, the mutant pyrrolysyl-tRNA synthetase provided herein has an amino acid sequence of SEQ ID NO: 61. In some embodiments, the mutant pyrrolysyl-tRNA synthetase comprises an amino acid sequence of SEQ ID NO: 61. In some embodiments, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 61. In some embodiments, the mutant pyrrolysyl-tRNA synthetase provided herein has an amino acid sequence of SEQ ID NO: 61. In some embodiments, the mutant pyrrolysyl-tRNA synthetase comprises an amino acid sequence of SEQ ID NO: 61. In some embodiments, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 61.

[0199] In some cases, sequences related to the mutant pyrrolysyl-tRNA synthetases herein are in Table 2.

[0200] Table 2. Pyrrolysyl-tRNA synthetases

[0201]

[0202]

[0203]

[0204] In some cases, the conjugate comprises a first targeting domain and a second targeting domain and the conjugate is recombinantly produced by a host cell system, for example as a fusion protein comprising a first targeting domain and a second targeting domain. In some cases, the host cell is a eukaryotic cell (e.g., a mammalian cell, an insect cell, a yeast cell, or a plant cell), an archaeal cell, or a prokaryotic cell (e.g., a gram-positive or gram-negative bacterium). In some cases, the eukaryotic host cell is a mammalian host cell. In some cases, the mammalian host cell is a stable cell line, or a cell line in which the genetic material of interest is incorporated into its own genome and can express the product of the genetic material after multiple generations of cell division. In other cases, the mammalian host cell is a transient cell line, or a cell line in which the genetic material of interest is incorporated into its own genome and does not have the ability to express the genetic material product after multiple generations of cell division.

[0205] Exemplary mammalian host cells include 293T cell lines, 293A cell lines, 293FT cell lines, 293F cells, 293H cells, A549 cells, MDCK cells, CHO DG44 cells, CHO-S cells, CHO-K1 cells, Expi293F cells, TM Cells, Flp-In TM T-REx TM 293 cell line, Flp-In TM -293 cell line, Flp-In TM -3T3 cell line, Flp-In TM BHK cell line, Flp-In TM -CHO cell line, Flp-In TM -CV-1 cell line, Flp-In TM The Jurkat cell line, FreeStyle TM 293-F cells, FreeStyle TM CHO-S cells, GripTite TM 293MSR cell line, GS-CHO cell line, Heparg TM Cells, T-REx TM Jurkat cell line, Per.C6 cell, T-REx TM -293 cell line, T-REx TM-CHO cell lines and T-REx TM HeLa cell line.

[0206] In some embodiments, the eukaryotic host cell is an insect host cell. Exemplary insect host cells include Drosophila S2 cells, Sf9 cells, Sf21 cells, and Cellular High Five TM cell.

[0207] In some embodiments, the eukaryotic host cell is a yeast host cell. Exemplary yeast host cells include Pichia pastoris strains such as GS115, KM71H, SMD1168H and X-33, and Saccharomyces cerevisiae strains such as INVSC1.

[0208] In some embodiments, the eukaryotic host cell is a plant host cell. In some cases, the plant cell includes a cell from algae. Exemplary plant cell lines include strains from Chlamydomonas reinhardtii 137c or Synechococcus elongatus PPC 7942.

[0209] In some embodiments, the host cell is a prokaryotic host cell. Exemplary prokaryotic host cells include BL21, Mach1 TM 、DH10B TM 、TOP10、DH5α、DH10Bac TM 、OmniMax TM 、MegaX TM DH12S TM , INV110, TOP10F', INVαF, TOP10 / P3, ccdB Survival, PIR1, PIR2, Stbl2 TM 、Stbl3 TM or Stbl4 TM .

[0210] In some cases, suitable nucleic acid molecules or vectors for producing the targeting domains described herein include any suitable vector derived from a eukaryotic or prokaryotic source. Exemplary nucleic acid molecules or vectors include vectors from bacteria (e.g., Escherichia coli), insects, yeast (e.g., Pichia pastoris), algae, or mammalian sources. Bacterial vectors include, for example, pACYC177, pASK75, pBAD series vectors, pBADM series vectors, pET series vectors, pETM series vectors, pGEX series vectors, pHAT2, pMal-C2, pMal-p2, pQE series vectors, pRSET A, pRSET B, pRSET C, pTrcHis2 series, pZA31-Luc, pZE21-MCS-1, pFLAG ATS, pFLAG CTS, pFLAG MAC, pFLAG Shift-12C, pTAC-MAT-1, pFLAG CTC, or pTAC-MAT-2.

[0211] Insect vectors include, for example, pFastBac1, pFastBac DUAL, pFastBac ET, pFastBac HTa, pFastBac HTb, pFastBac HTc, pFastBac M30a, pFastBac M30b, pFastBac, M30c, pVL1392, pVL1393M 10, pVL1393M11, pVL1393M 12, FLAG vectors such as pPolh-FLAG1 or pPolh-MAT2, or MAT vectors such as pPolh-MAT1 or pPolh-MAT 2.

[0212] Yeast vectors include, for example, pDEST TM 14 vector, pDEST TM 15 vector, pDEST TM 17 vector, pDEST TM 24 vector, pYES-DEST52 vector, pBAD-DEST49Target vector, pAO815 Pichia vector, pFLD1 Pichia vector, pGAPZA, Pichia C vector, Pichia pPIC3.5K vector, pPIC 6A, B and Pichia C vector, pPIC9K vector, pTEF1 / Zeo, pYES2 yeast vector, pYES2 / CT yeast vector, pYES2 / NT A, B and C yeast parents or pYES3 / CT yeast vector.

[0213] Algae vectors include, for example, pChlamy-4 vectors or MCS vectors.

[0214] Mammalian vectors include, for example, transient expression vectors or stable expression vectors. Exemplary mammalian transient expression vectors include p3xFLAG-CMV 8, pFLAG-Myc-CMV19, pFLAG-Myc-CMV 23, pFLAG-CMV 2, pFLAG-CMV 6a, b, c, pFLAG-CMV 5.1, pFLAG-CMV 5a, b, c, p3xFLAG-CMV 7.1, pF-CMV 20, p3xFLAG-Myc-CMV 24, pCMV-FLAG-MAT1, pCMV-FLAG-MAT2, pBICEP-CMV 3, or pBICCMV-4. Exemplary mammalian stable expression vectors include pFLAG-CMV 3, p3xFLAG-CMV 9, p3xFLAG-CMV 13, pFLAG-Myc-CMV 21, p3xFLAG-Myc-CMV 25, pFLAG-CMV 4, p3xFLAG-CMV 10, p3xFLAG-CMV14, pFLAG-Myc-CMV 22, p3xFLAG-Myc-CMV 26, pBICEP-CMV 1, or pBICEP-CMV 2.

[0215] In some cases, a cell-free system is used to produce a targeting domain as described herein. In some cases, the cell-free system includes a mixture of cytoplasm and / or nuclear components from a cell, and is suitable for in vitro nucleic acid synthesis. In some cases, the cell-free system utilizes prokaryotic cell components. In other cases, the cell-free system utilizes eukaryotic cell components. Nucleic acid synthesis is achieved in a cell-free system based on, for example, fruit fly cells, Xenopus eggs, archaea or HeLa cells. Exemplary cell-free systems include E. coli S30 extract system, E. coli T7S 30 system or XpressCF and XpressCF+.

[0216] Cell-free translation systems variously include ingredients, such as plasmids, mRNA, DNA, tRNA, synthetases, release factors, ribosomes, chaperones, translation initiation and elongation factors, natural and / or non-natural amino acids and / or other components for protein expression. These components are optionally modified to improve yield, increase synthesis rate, increase the fidelity of protein products, improve folding or chaperone activity or incorporate non-natural amino acids. In some embodiments, the targeting domain containing non-natural amino acids as described herein is synthesized using the cell-free translation system described in US 8,778,631, US2017 / 0283469, US2018 / 0051065, US2014 / 0315245 or US 8,778,631. In some embodiments, the cell-free translation system includes modified release factors, or even removes one or more release factors from the system. In some embodiments, the cell-free translation system includes reduced protease concentrations. In some embodiments, the cell-free translation system includes modified tRNAs with redistributed codons encoding non-natural amino acids. In some embodiments, the synthetases described herein for incorporating unnatural amino acids are used in a cell-free translation system. In some embodiments, the tRNA is pre-loaded with an unnatural amino acid using an enzymatic or chemical process before the tRNA is added to the cell-free translation system. In some embodiments, the components for the cell-free translation system are obtained from modified organisms, such as modified bacteria, yeast, or other organisms.

[0217] An orthogonal or amplified genetic code can be used to generate a targeting domain as described herein, wherein one or more specific codons present in the nucleic acid sequence of the targeting domain are assigned to encode an unnatural amino acid, such that it can be genetically incorporated into a conjugate (e.g., a targeting domain) by using an orthogonal tRNA synthetase / tRNA pair. An orthogonal tRNA synthetase / tRNA pair is capable of loading the tRNA with an unnatural amino acid and is capable of incorporating the unnatural amino acid into a polypeptide chain in response to a codon. The tRNA synthetase and tRNA can be those described in (or generated using the methods described in) Wang et al., “Genetically Encoding Fluorosulfate-L-tyrosine To React with Lysine, Histidine, and Tyrosine via SuFEx in Proteins in Vivo,” J. Am. Chem. Soc. 2018, 140 4995-4999 or Wang et al., “A Genetically Encoded Fluorosulfonyloxybenzoyl-L-lysine for Expansive Covalent Bonding of Proteins via SuFEx Chemistry,” J. Am. Chem. Soc. 2021, 143 10341-10351.

[0218] In some cases, the codon is an amber codon, an ochre codon, an opal codon, or a quadruple codon. In some cases, the codon corresponds to an orthogonal tRNA that will be used to carry an unnatural amino acid. In some cases, the codon is an amber codon. In other cases, the codon is an orthogonal codon.

[0219] In some cases, the codon is a quadruplet codon that can be decoded by an orthogonal ribosomal ribo-Q1. In some cases, the quadruplet codon is as described in Neumann et al., "Encoding multiple unnatural amino acid analysis of a quadruplet-decoding ribosome," Nature, 464(7287): 441-444 (2010).

[0220] In some cases, the codons used in the present disclosure are recoded codons, for example, synonymous codons or rare codons replaced by replacement codons. In some cases, the recoded codons are described in Napolitano et al., "Emergent rules for codon choice isolated by editing of a ray array code in Escherichia coli," PNAS, 113 (38): E5588-5597 (2016). In some cases, the recoded codons are described in Ostrov et al., "Design, synthesis, and testing translated a 57-codegene," Science 353 (6301): 819. sub. 822 (2016).

[0221] definition

[0222] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are amino acids encoded by the genetic code, as well as amino acids that are later modified, for example, hydroxyproline, g-carboxyglutamate, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as natural amino acids, i.e., carbon bound to hydrogen, carboxyl, amino, and R groups, for example, homoserine, norleucine, methionine sulfoxide, methionine methylsulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as natural amino acids. Amino acid mimetics refer to compounds that have a structure that is different from the general chemical structure of an amino acid, but function in a manner similar to a natural amino acid.

[0223] Herein, amino acids may be referred to by either their common three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides may also be referred to by their commonly accepted single-letter codes.

[0224] The term "amino acid side chain" refers to a functional substituent contained on an amino acid. For example, an amino acid side chain can be a side chain of a naturally occurring amino acid. Naturally occurring amino acids are amino acids encoded by the genetic code (e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, or valine), as well as amino acids that are later modified, such as hydroxyproline, g-carboxyglutamate, and O-phosphoserine. In some aspects, an amino acid side chain can be a non-natural amino acid side chain. In some aspects, an amino acid side chain is H, In some embodiments, the unnatural amino acid side chain is In some embodiments, the unnatural amino acid side chain is In some embodiments, the unnatural amino acid side chain is

[0225] The term "non-natural amino acid" or "unnatural amino acid" or "Uaa" or "non-natural amino acid" refers to a functional replacement for a compound having the same basic chemical structure as a natural amino acid, i.e., a carbon bound to a hydrogen, carboxyl, amino, and R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methylsulfonium, allylalanine, 2-aminoisobutyric acid. The term may refer to amino acid analogs, synthetic amino acids, and amino acid mimetics that are not found in nature, such as amino acid residues containing arylamide, vinylsulfonamide, sulfonyl fluoride, arylfluorosulfate, arylsulfonyl fluoride, arylfluorosulfate, and 4-sulfotetrafluorophenyl (STP) ester. Non-natural amino acids are naturally occurring or chemically synthesized non-protein amino acids. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as natural amino acids. Non-limiting examples include exo-cis-3-aminobicyclo[2.2.1]hept-5-ene-2-carboxylic acid hydrochloride, cis-2-aminocycloheptanecarboxylic acid hydrochloride, cis-6-amino-3-cyclohexene-1-carboxylic acid hydrochloride, cis-2-amino-2-methylcyclohexanecarboxylic acid hydrochloride, cis-2-amino-2-methylcyclopentanecarboxylic acid hydrochloride, 2-(Bocaminomethyl), benzoic acid, 2-(Bocamino) suberic acid, Boc-4,5-dehydro-Leu-OH (dicyclohexyl ammonium salt), Boc-4-(Fmoc-amino)-L-phenylalanine, Boc-P-Homopyr-OH, Boc- (2-Indanyl)-Gly-OH, 4-Boc-3-morpholineacetic acid, 4-Boc-3-morpholineacetic acid, Boc pentafluoro-D-phenylalanine, Boc-pentafluoro-L-phenylalanine, Boc-Phe(2-Br)-OH, Boc-Phe(4-Br)-OH, Boc-D-Phe(4-Br)-OH, Boc-D-Phe(3-Cl)-OH, Boc-Phe(4-NH2)-OH, Boc-Phe(3-NH2)-OH, Boc-Phe(3,5-F2)-OH, 2-(4-Boc-piperazinyl)-2-(3,4-dimethoxyphenyl)acetic acid purum, 2-(4-Boc-piperazino)-2-(2-fluorophenyl)acetic acid purum, 2-(4-Boc-piperazino)-2-(3-fluorophenyl)acetic acid purum, 2-(4-Boc-piperazino)-2-(4-fluorophenyl)acetic acid purum, 2-(4-Boc-piperazino)-2-(4-methoxyphenyl)acetic acid purum, 2-(4-Boc-piperazino)-2-phenylacetic acid purum, 2-(4-Boc-piperazino)-2-(3-pyridyl)acetic acid purum, 2-(4-Boc-piperazino)-2-[4-(trifluoromethyl)phenyl]acetic acid purum, Boc-P-(2-quinolyl)-Ala-OH, NBoc-1,2,3,6-tetrahydro-2-pyridinecarboxylic acid, Boc-P-(4-thiazolyl)- Ala-OH, Bo-b (2-thienyl) -D-Ala-OH, Fmoc-N- (4-Boc-aminobutyl) -Gly-OH, Fmoc-N- (2-Boc-aminoethyl) -Gly-OH, Fmoc-N- (2,4-dimethoxybenzyl) -Gly-OH, Fmoc- (2-indanyl) -Gly-OH, Fmoc-pentafluoro-L-phenylalanine, Fmoc-Pen (Trt) -OH, Fmoc-Phe (2-Br) -OH, Fmoc-Phe (4-Br) -OH, FmocPhe (3,5-F2) -OH, Fmoc-P- (4-thiazolyl) -Ala-OH, Fmoc-P- (2-thienyl) -Ala-OH, 4- (hydroxymethyl) -D-phenylalanine. In some embodiments, the non-natural amino acid comprises the structure of Formula I:,

[0226] In some embodiments, the unnatural amino acid comprises the structure of Formula II: In some embodiments, the unnatural amino acid is 2-amino-3-(4-(fluorosulfonyl)oxy)phenyl)propanoic acid:

[0227] In some embodiments, the unnatural amino acid is fluorosulfonyltyrosine (FSY): In some embodiments, the unnatural amino acid is N6-(4-((fluorosulfonyl)oxy)benzoyl)lysine:

[0228] In some embodiments, the unnatural amino acid is fluorosulfonyloxybenzoyl-L-lysine (FSK):

[0229] "Conservatively modified variants" apply to both amino acids and nucleic acid sequences. For a specific nucleic acid sequence, "conservatively modified variants" refer to those nucleic acids that encode the same or substantially the same amino acid sequence. Due to the degeneracy of the genetic code, many nucleic acid sequences will encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine. Therefore, at each position where alanine is specified by a codon, the codon can be changed to any of the corresponding codons described without changing the encoded polypeptide. This nucleic acid variation is a "silent variation," which is a type of conservatively modified variation. Each nucleic acid sequence encoding a polypeptide herein also describes each possible silent variation of the nucleic acid. Those skilled in the art will recognize that each codon in the nucleic acid (except AUG and TGG, AUG is usually the only codon for methionine, and TGG is usually the only codon for tryptophan) can be modified to produce functionally identical molecules. Therefore, each silent variation of a nucleic acid encoding a polypeptide is implicit in each of the described sequences.

[0230] As for amino acid sequences, those skilled in the art will recognize that a single substitution, deletion or addition to a nucleic acid, peptide, polypeptide or protein sequence that alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant," wherein such alteration results in the replacement of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to, and do not exclude, polymorphic variants, interspecies homologs and alleles of the present disclosure.

[0231] The following eight groups each contain amino acids that are conservative substitutions for one another: (1) alanine (A), glycine (G); (2) aspartic acid (D), glutamic acid (E); (3) asparagine (N), glutamine (Q); (4) arginine (R), lysine (K); (5) isoleucine (I), leucine (L), methionine (M), valine (V); (6) phenylalanine (F), tyrosine (Y), tryptophan (W); (7) serine (S), threonine (T); and (8) cysteine ​​(C), methionine (M). (See, e.g., Creighton, Proteins (1984)).

[0232] In some embodiments, the pyrrolysyl-tRNA synthetase (tRNA pyl ) is an aminoacyl-tRNA synthetase that catalyzes the reaction for attaching the α-amino acid pyrrolysine or a similar unnatural amino acid to a cognate tRNA, thereby allowing the incorporation of pyrrolysine or a similar unnatural amino acid during protein production at an amber stop codon (i.e., UAG). Wild-type tRNA from Methanosarcina species pyl(which naturally incorporates pyrrolysine) is orthogonal to endogenous tRNAs and aminoacyl-tRNA synthetases in E. coli and eukaryotic cells. Using this pair and their synthetically evolved derivatives or variants, we and others have directed the efficient incorporation of unnatural amino acids, including post-translationally modified amino acids, chemical handles, and photocaged amino acids, at specific sites in desired proteins in E. coli, yeast, and mammalian cells.

[0233] In some embodiments, a tRNA described herein pyl Any recombinant or naturally occurring form of pyrrolysyl-tRNA synthetase or variant, homolog or isoform thereof that retains tRNA pyl activity (e.g., compared with wild-type tRNA pyl In some embodiments, the variant, homolog, or isoform has at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 contiguous amino acid portion) compared to a naturally occurring pyrrolysyl-tRNA synthetase. In some embodiments, the mutant tRNA pyl Catalyzes the attachment of an unnatural amino acid (UAA) (e.g., a UAA of Formula I), such as fluorosulfate L-tyrosine (FSY), to a tRNA pyl , in order to incorporate unnatural amino acids.

[0234] In some embodiments, the tRNA provided herein pyl is a tRNA that can be engineered by a person skilled in the art pyl Derivatives or variants. In some embodiments, the tRNA provided herein pyl It is a single-stranded RNA molecule containing about 70 to 90 nucleotides, which folds through intrastrand base pairing to form a characteristic cloverleaf structure that carries a specific amino acid (e.g., UAA of Formula I), such as FSY) and matches it with the corresponding codon on mRNA during protein synthesis.

[0235] An "imaging ligand" or "detectable agent" is a composition detectable by appropriate means, such as spectroscopic, photochemical, biochemical, immunochemical, chemical, magnetic resonance imaging or other physical means. For example, useful detectable agents include 18 F. 32 P. 33 P. 45 Ti, 47 Sc, 52Fe 59 Fe 62 Cu、 64 Cu、 67 Cu、 67 Ga 68 Ga 77 As 86 Y、 90 Y、 89 Mr. 89 Zr、 94 Tc 99m Tc 99 For 105 pd 105 Rh、 111 Ag 111 in 123 I 124 I 125 I 131 I 142 Mr. 149 PM 153 Sm、 154-1581 God 161 Tb 166 Dy 166 Ho 169 Err 175 sun 177 sun 186 Re 188 Re 189 Re 194 Ir 198 I 199 I 211 And 211 Pb、 212 Hello 212 Pb、 213 Hello 223 Ra 225 And 153 Sm、 177 sun 90 Y、 131 I 149 Tb 212 Pb / 212 Hello 213 Hello 227 Th、Cr、V、Mn、Fe、Co、Ni、Cu、La、Ce、Pr、Nd、Pm、Sm、Eu、Gd、Tb、Dy、Ho、Er、Tm、Yb、Lu、 32P, fluorophores (e.g., fluorescent dyes), electron-dense reagents, enzymes (e.g., commonly used in ELISA), biotin, digoxigenin, paramagnetic molecules, paramagnetic nanoparticles, ultrasmall superparamagnetic iron oxide ("USPIO") nanoparticles, USPIO nanoparticle aggregates, superparamagnetic iron oxide ("SPIO") nanoparticles, SPIO nanoparticle aggregates, single crystalline iron oxide nanoparticles, single crystalline iron oxide, nanoparticle contrast agents, liposomes or other delivery vehicles containing gadolinium chelate ("Gd chelate") molecules, gadolinium, radioisotopes, radionuclides (e.g., carbon-11, nitrogen-13, oxygen-15, fluorine-18, rubidium-82), fluorodeoxyglucose (e.g., fluorine-18 labeled), any gamma-ray emitting radioactive The invention relates to a method for detecting a target peptide or a combination of a radioactive nuclide, a positron emitting radionuclide, a radiolabeled glucose, a radiolabeled water, a radiolabeled ammonia, a biocolloid, a microbubble (e.g., a microbubble shell comprising albumin, galactose, a lipid and / or a polymer; a microbubble gas core comprising air, a heavy gas, a perfluorocarbon, nitrogen, octafluoropropane, a perfluorohexane lipid microsphere, a perfluoropropane, etc.), an iodinated contrast agent (e.g., iohexol, iodixanol, iofosmol, ioisophthalol, ioxilan, iopromide, diatrizoate, metrizoate and iocolic acid), barium sulfate, thorium dioxide, gold, gold nanoparticles, gold nanoparticle aggregates, fluorophores, two-photon fluorophores or haptens and proteins or other detectable entities, for example, by incorporating a radiolabel into a peptide or antibody that specifically reacts with a target peptide. The detectable portion is a monovalent detectable agent or a detectable agent that is capable of forming a bond with another composition.

[0236] According to embodiments of the present disclosure, radioactive substances (e.g., radioisotopes) that can be used as imaging agents and / or labeling agents include, but are not limited to 18 F. 32 P. 33 P. 45 Ti, 47 Sc, 52 Fe, 59 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 77 As, 86 Y. 90 Y. 89 Sr. 89 Zr, 94 Tc, 94 Tc, 99m Tc, "Mo, 105 Pd, 105 Rh, 111 Ag, 111 Ln,123 I. 124 I. 125 I. 131 I. 142 Pr, 143 Pr, 149 Pm, 153 Sm, 154-1581 Gd, 161 Tb, 166 Dy, 166 HO, 169 2. 175 Lu, 177 Lu, 186 Re, 188 Re, 189 Re, 194 Ir, 198 Au, 199 Au, 211 At 211 Pb, 212 Bi, 212 Pb, 213 Bi, 223 Ra, 225 Ac, 153 Sm, 177 Lu, 90 Y. 131 I. 149 Tb, 212 Pb / 212 Bihe 227 Th. According to embodiments of the present disclosure, paramagnetic ions that may be used as additional imaging agents include, but are not limited to, ions of transition metals and lanthanide metals (e.g., metals with atomic numbers 21-29, 42, 43, 44, or 57-71). These metals include ions of Cr, V, Mn, Fe, Co, Ni, Cu, La, Ce, Pr, Nd, Pm, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, and Lu.

[0237] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues, wherein in embodiments the polymer may be conjugated to a moiety that does not consist of amino acids. These terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. "Fusion protein" refers to a chimeric protein encoding two or more separate protein sequences that are recombinantly expressed as a single part.

[0238] Amino acid or nucleotide base "positions" are represented by numbers that sequentially identify each amino acid (or nucleotide base) in the reference sequence based on its position relative to the N-terminus (or 5' terminus). Because deletions, insertions, truncations, fusions, etc. must be considered when determining the optimal alignment, in general, the number of amino acid residues in a test sequence determined by simple counting from the N-terminus is not necessarily the same as the number of its corresponding position in the reference sequence. For example, in the case where a variant has a deletion relative to the aligned reference sequence, there will be no amino acid in the variant that corresponds to the site of the deletion in the reference sequence. If there is an insertion in the aligned reference sequence, the insertion will not correspond to a numbered amino acid position in the reference sequence. In the case of truncations or fusions, a stretch of amino acids in the reference sequence or aligned sequence may not correspond to any amino acids in the corresponding sequence.

[0239] The terms "numbered with reference to" or "corresponding to" when used in the context of numbering a given amino acid or polynucleotide sequence means that the residues of the reference sequence are numbered as specified when comparing the given amino acid or polynucleotide sequence to the reference sequence.

[0240] When the amino acid residue in the protein occupies the same essential structural position as a given residue in the protein, it "corresponds" to a given residue. For example, when the selected residue has the same essential space or other structural relationship as Ala302 in the PylRS protein, the selected residue in the selected protein corresponds to Ala302 of the PylRS protein. In an embodiment, when the selected protein and the PylRS protein are compared for maximum homology, the position in the compared selected protein compared with Ala302 is considered to correspond to Ala302. In addition to the primary sequence comparison, a three-dimensional structure comparison can also be used, for example, the structure of the selected protein is aligned for maximum correspondence with the PylRS protein and the overall structure of the comparison. In this case, the amino acid that occupies the same essential position as Ala302 in the structural model is considered to correspond to the Ala302 residue.

[0241] "Percentage of sequence identity" is determined by comparing two optimally aligned sequences within a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may contain additions or deletions (i.e., gaps) compared to a reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the same nucleic acid base or amino acid residue occurs in the two sequences to produce the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and then multiplying the result by 100 to obtain the percentage of sequence identity.

[0242] In the context of two or more nucleic acid or polypeptide sequences, the term "identical" or "percent identity" refers to two or more sequences or subsequences that are identical or have a specified percentage of the same amino acid residue or nucleotide measured using BLAST or BLAST 2.0 sequence comparison algorithms with the default parameters described below or by manual alignment and visual inspection (see, for example, NCBI website ncbi.nlm.nih.gov / BLAST / , etc.) (i.e., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity in a specified region when compared and aligned for maximum correspondence over a comparison window or a specified region). Such sequences are then referred to as "substantially identical". This definition also refers to or can be applied to the complementary sequence of a test sequence. The definition also includes sequences with deletions and / or additions, and sequences with replacements. As described below, the algorithm can take into account spaces, etc. The identity exists over a region that is at least about 25 amino acids or nucleotides in length, or over a region that is 50-100 amino acids or nucleotides in length.

[0243] "Antibodies" are large, complex proteins with a complex internal structure. Natural antibody molecules contain two pairs of identical polypeptide chains, each pair having a light chain and a heavy chain. Each light chain and heavy chain is composed of two regions: a variable ("V") region involved in binding to the target antigen, and a constant ("C") region that interacts with other components of the immune system. The light chain and heavy chain variable regions are gathered together in three-dimensional space to form a variable region that binds to an antigen (e.g., a receptor on the surface of a cell). Within each light chain or heavy chain variable region, there are three short segments (with an average length of 10 amino acids) called complementary determining regions ("CDRs"). The six CDRs in the antibody variable domain (three from the light chain and three from the heavy chain) are folded together in three-dimensional space to form an actual antibody binding site that docks with the target antigen. Kabat, E. et al., Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, 1983, 1987 precisely define the position and length of CDRs. The portion of the variable region not contained in the CDRs is called the framework ("FR"), which forms the environment of the CDRs.

[0244] The term "antibody" is used according to its well-known meaning in the art. Antibodies exist, for example, as complete immunoglobulins or as many well-characterized fragments produced by digestion with various peptidases. Thus, for example, pepsin digests the antibody below the disulfide bond in the hinge region to produce F(ab)'2-a dimer of Fab, which itself is a light chain connected to VH-CH1 by a disulfide bond. F(ab)'2 can be reduced under mild conditions to destroy the disulfide bond in the hinge region, thereby converting the F(ab)'2 dimer into a Fab' monomer. Fab' monomers are essentially Fabs with a partial hinge region (see Fundamental Immunology (Pauled., 3d ed. 1993)). Although various antibody fragments are defined based on the digestion of complete antibodies, it will be appreciated by those skilled in the art that these fragments can be synthesized de novo chemically or by using recombinant DNA methods. Thus, the term antibody as used herein also includes antibody fragments produced by modification of whole antibodies or antibody fragments synthesized de novo using recombinant DNA methodologies (e.g., single-chain Fv) or antibody fragments identified using phage display libraries (e.g., McCafferty et al., Nature 348:552-554 (1990)).

[0245] Exemplary immunoglobulin (antibody) structural units include tetramers. Each tetramer is composed of two pairs of identical polypeptide chains, each pair having a "light" chain (about 25kD) and a "heavy" chain (about 50-70kD). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids that is primarily responsible for antigen recognition. The terms variable light chain (VL) and variable heavy chain (VH) refer to these light chains and heavy chains, respectively. Fc (i.e., fragment crystallizable region) is the "base" or "tail" of immunoglobulin, and is generally composed of two heavy chains, which contribute two or three constant domains, depending on the class of the antibody. By binding to specific proteins, the Fc region ensures that each antibody produces an appropriate immune response to a given antigen. The Fc region also binds to various cell receptors (such as Fc receptors) and other immune molecules (such as complement proteins).

[0246] Antibody " antigen-binding fragment " provided herein refers to a polypeptide that can be bound to an antigen and includes one or more domains of an antibody or its fragment. Non-limiting examples of antibody variants include single-domain antibodies (nano antibodies), affibodies (smaller than monoclonal antibodies and capable of binding antigens with high affinity and mimicking the polypeptides of monoclonal antibodies (e.g., about 6 kDa)), monospecific Fab2, bispecific Fab2, trispecific Fab3, monovalent IgG, scFv, bispecific biantibodies, trispecific triantibodies, scFv-Fc, microantibodies, IgNAR, V-NAR, hcIgG, VhH or peptibody. " Peptibody " provided herein refers to a peptide portion attached to the Fc domains of an antibody (by covalent or non-covalent linker). Other non-limiting examples of antibody variants known in the art include antibodies produced by cartilaginous fish or camelids. A general description of antibodies and variable regions of camelids and methods of their production, isolation and use can be found in references WO 97 / 49805 and WO 97 / 49805, which are incorporated herein by reference in their entirety for all purposes. Likewise, antibodies and variable regions from cartilaginous fish and methods of their production, isolation and use can be found in WO 2005 / 118629, which is incorporated herein by reference in its entirety for all purposes.

[0247] "Single domain antibody" or "nanobody" interchangeably refers to an antibody fragment with a single monomeric variable antibody domain. Like a complete antibody, it is able to selectively bind to a specific antigen. In some embodiments, a single domain antibody is a human or humanized single domain antibody. In some embodiments, a single domain antibody is a camelid single domain antibody.

[0248] The term "antigen" provided herein refers to a molecule that can be bound to an antibody binding domain provided herein. "Antigen binding domain" provided herein is a region in an antibody that binds to an antigen (epitope). As described above, the antigen binding domain may include a constant domain and a variable domain for each of a heavy chain and a light chain (VL, VH, CL and CH1, respectively). In an embodiment, the antigen binding domain includes a light chain variable domain and a heavy chain variable domain. In an embodiment, the antigen binding domain includes a light chain variable domain, and does not include a heavy chain variable domain and / or a heavy chain constant domain. The paratope or antigen binding site is formed at the N-terminus of the antigen binding domain. The two variable domains of the antigen binding domain can bind to the epitope of the antigen. For example, antibodies exist in the form of complete immunoglobulins or many well-characterized fragments produced by digestion with various peptidases. Therefore, for example, pepsin digests the antibody below the disulfide bond in the hinge region to produce F (ab) '2, which is a dimer of Fab, which itself is a light chain connected to VH-CH1 by a disulfide bond. F(ab)'2 can be reduced under mild conditions to destroy the disulfide bonds in the hinge region, thereby converting the F(ab)'2 dimer into a Fab' monomer. Fab' monomers are essentially antigen binding moieties with a partial hinge region (see Fundamental Immunology (Pauled., 3d ed. 1993)). Although various antibody fragments are defined based on the digestion of intact antibodies, it will be appreciated by those skilled in the art that these fragments can be synthesized de novo chemically or by using recombinant DNA methods. Therefore, the term antibody used herein also includes antibody fragments produced by modifying whole antibodies, or antibody fragments (e.g., single-chain Fv) synthesized de novo using recombinant DNA methods, or antibody fragments identified using phage display libraries (see, e.g., McCafferty et al., Nature 348: 552-554 (1990)).

[0249] Example

[0250] Example 1: Cloning and expression of FSY-modified sdAb

[0251] The vector pBAD sequence lacking the ORF insert (Invitrogen #43001) was PCR amplified using the following primers:

[0252] Forward Primer:

[0253] CTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAG(SEQ ID NO:62)

[0254] Reverse Primer:

[0255] GTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGCCCAAAAAAACGGGTATGGAG(SEQ IDNO:63)

[0256] The resulting PCR-amplified vector was gel extracted and purified using the Zymo PCR purification kit (Zymoclean Gel DNA Recovery Kit Cat# D4002). The dsDNA sequences of the single-domain antibody (sdAb) and biparatopic constructs were ligated to the PCR-amplified pBAD backbone and transformed into Escherichia coli DH10b chemically competent cells (Fisher ThermoScientific TM DH10B competent cells; high efficiency; FEREC0113). Clones were miniprepped and sequence verified using the pBAD forward primer. For constructs incorporating FSY residues, a TAG codon was engineered into the DNA sequence at the desired position for the amino acid replacement within the open reading frame of the sdAb or biparatopic construct.

[0257] Expression and purification:

[0258] The pEVOL-FSYRS plasmid (reference: J.Am.Chem.Soc.2018,140,15,4995–4999) was synthesized by Genscript. This plasmid expresses the engineered Mm FSYRS aminoacyl tRNA synthetase and is transformed into chemically competent DH10b competent cells using standard methods to generate the parent strain FSYRS-DH10b. Individual plasmids encoding each single domain antibody, biparatopic construct, or variant are transformed into chemically competent FSYRS-DH10b using standard methods. A single colony was inoculated into 2xYT medium (Teknova #Y0166) containing 100 μg / ml ampicillin and 5 μg / ml chloramphenicol and grown overnight at 37°C with shaking at approximately 220 rpm. The overnight culture was mixed 1:1 with sterile 50% glycerol and stored at -80°C.

[0259] In the presence of 100 μg / ml ampicillin and 34 μg / ml chloramphenicol, strains carrying plasmids encoding sdAb or biparatopic constructs were cultured in 2xYT medium (Teknova #Y0166). Before induction, cells were grown at a temperature of 37°C. When OD600 was 0.6, 1 mM FSY was supplemented to the culture and induced by adding 0.2% arabinose. During induction, the culture was moved to 25°C while shaking overnight at 220 RPM for a total of 16 hours.

[0260] Expression was collected by pelleting the cells at 2,200 x g for 30 minutes at 4 ° C. The supernatant was removed, the cell pellet was weighed and stored at -80 ° C. The cell pellet was resuspended for lysis by adding B-PER protein extraction reagent (ThermoFisher #78243) at 4 mL / g of precipitate. The resuspended precipitate was lysed by placing the sample on an orbital shaker at medium speed for 15 minutes at room temperature. The lysed cells were then clarified by centrifugation at 2200 x g for 30 minutes. The soluble portion of the supernatant was removed for further purification.

[0261] In order to purify the soluble part, HisPur-Ni-NTA resin (ThermoFisher #88222) is used to capture soluble substances from the lysate. Remove the resin storage buffer, and the resin is balanced by washing in batches in a wash buffer (40mM sodium phosphate, pH 7.2, 300mM NaCl, 20mM imidazole). Repeat the batch washing, totaling 50x resin volume. The above-mentioned clarified lysate is added to the washed Ni-NTA resin and combined with constant rotation for 1 hour at room temperature. After binding, the protein-bound resin is washed in batches with 50x resin volume in a wash buffer to remove unbound pollutants. The protein-bound resin is then transferred to a centrifugal column and briefly rotated at 700xg to remove the remaining wash buffer. Then use elution buffer (40mM sodium phosphate, 7.2, 300mM NaCl, 500mM imidazole) to elute the target protein. Add elution buffer with 2x resin volume, and incubate at room temperature for 5 minutes. The samples were centrifuged briefly and the eluted proteins were collected in new tubes. The elution procedure was repeated twice using the same conditions. The eluted fractions were combined and eluted by A on a Nanodrop 2000. 280 Quantitation, blank control with elution buffer.Ni-NTA purified protein was then concentrated using 0.5 mL, 3 kDa MWCO PES spin filters (ThermoFisher #88512) and the buffer exchanged to 1x PBS via repeated dilutions at 8-10x volume of sample and concentration.

[0262] Example 2: EGFR-targeting biparatopic constructs

[0263] An EGFR targeting sdAb with FSY (C4-109FSY, SEQ ID NO: 17) and a biparatopic construct with two EGFR targeting sdAbs connected by a linker (C9 (C4-109FSY-L1-C5), SEQ ID NO: 19) were constructed, cloned and expressed as described in Example 1. The constructs were synthesized with the pelB leader sequence (SEQ ID NO: 15) cleaved from the mature protein and His-Tag purification was performed using six C-terminal histidines. The biparatopic construct C9 contained a GGGGSGGGGS (SEQ ID NO: 14) linker (L1) between the first sdAb C4 and the second sdAb C5.

[0264] The kinetics of EGFR cross-linking of FSY-modified sdAbs was evaluated. The protein was incubated with EGFR at a molar ratio of 8:1 (EGFR final concentration was 0.125 mg / mL, 1.25 μM). Samples were taken at time points of 0-180 minutes, and the percentage of EGFR cross-linking was evaluated by SDS-PAGE. The percentage of cross-linking bands was calculated by quantifying the sdAb EGFR cross-linking bands, and the EGFR band intensity was quantified using Image J.

[0265] Samples were collected from time zero to 360 minutes. The kinetics of the coupling were Figure 1A-1B The biparatopic construct C9 (C4-109FSY-L1-C5, SEQ ID NO: 19) was compared with a monoparatopic construct containing only the sdAb C4 with the FSY modification (C4-109FSY, SEQ ID NO: 17). Figure 2 As shown, the biparatopic construct C9 couples to EGFR faster than the monoparatopic C4-109FSY sequence as measured by the shortened time to half maximal cross-linking compared to the monoparatopic construct.

[0266] Example 3: Engineering sdAb C1 to remove disulfide bonds in CDR3

[0267] PSMA-targeted sdAb C1 was constructed to express the sdAb with the sequence shown below. The construct was synthesized with the pelB leader sequence (SEQ ID NO: 15) cleaved from the mature protein and six C-terminal histidines were used for His-Tag purification.

[0268] The C1 WT protein sequence (C1) is SEQ ID NO: 1. Starting from C1, additional constructs were made that removed the two cysteine ​​residues in CDR3 (SEQ ID NO: 7) by modifying these residues to alanine to generate C10 (C1-101A / 104A, SEQ ID NO: 20).

[0269] This construct was then further modified to install FSY at residue 102 to generate C10-102FSY (C1-101A / 104A / 102FSY, SEQ ID NO: 4). The diagram of the sdAb is shown in Figure 3 The cross-linking ability of these constructs was assessed using the method of Example 2. SDS-PAGE analysis showed that under these conditions, the cross-linking levels of all constructs were comparable.

[0270] Example 4: PSMA-targeted monoparatopic bivalent constructs

[0271] As described in Example 1, the PSMA-targeted sdAb C10-102FSY (SEQ ID NO:4 from Example 3) containing FSY was cloned and expressed. The bivalent construct C11-102FSY (C10-102FSY-L1-C10, SEQ ID NO:21) was created by linking C10-102FSY from Example 3 with an additional copy of C10 (SEQ ID NO:20, without FSY). The construct was designed by adding a GGGGSGGGGS (SEQ ID NO:14) linker (L1) between the two sdAb amino acid sequences. The bivalent construct was then cloned into the pBAD vector and expressed as described in Example 1. The construct was synthesized with the pelB leader sequence (SEQ ID NO:15) cleaved from the mature protein and His-Tag purification was performed using six histidines at the C-terminus.

[0272] Crosslinking of monoparatopic sdAbs and biparatopic constructs to PSMA was assessed by SDS-PAGE over a time course as described in Example 2. Figure 4A-4B As shown, the biparatopic construct provided faster coupling compared to the sdAb construct.

[0273] Example 5: Construction of bispecific immune cell engagers

[0274] Bispecific T cell engagers were constructed with an sdAb that binds a target ("target sdAb") connected via a linker to an sdAb that targets either CD3 or CD16 ("adapter sdAb"). In each case, the target sdAb contained an incorporated FSY. Exemplary structures are shown in Figure 5A middle.

[0275] The bispecific constructs C12 (C4-L6-C6, SEQ ID NO: 23) or C13 (C4-109FSY-L6-C6, SEQ ID NO: 24) were generated by linking C4 from Example 2 with an additional copy of C6 (C6, SEQ ID NO: 22, without FSY) that recruits T cells. The constructs were designed by adding a GGGGSGGGS (SEQ ID NO: 56) linker between the two sdAb amino acid sequences. The bispecific constructs were then cloned into the pBAD vector and expressed as described in Example 1. The constructs were synthesized with the pelB leader sequence (SEQ ID NO: 15) cleaved from the mature protein and His-Tag purification was performed using six histidines at the C-terminus.

[0276] The bispecific constructs C14 (C4-L2-C7, SEQ ID NO:26) or C15 (C4-109FSY-L2-C7, SEQ ID NO:27) were generated by linking C4-109FSY from Example 2 with an additional sdAb (C7 (SEQ ID NO:25), a NK cell binding sequence lacking FSY). The constructs were designed by adding a 3x(G4S)(GGGGSGGGGSGGGGS (SEQ ID NO:31)) linker (L2) between the two sdAb amino acid sequences. The bispecific constructs were then cloned into the pBAD vector and expressed as described in Example 1. The constructs were synthesized with the pelB leader sequence (SEQ ID NO:15) cleaved from the mature protein and His-Tag purification was performed using six C-terminal histidines.

[0277] The bispecific constructs C16 (C2-L6-C6, SEQ ID NO: 28) or C18 (C2-54FSY-L6-C6, SEQ ID NO: 30) were generated by linking C17 (C2-54FSY, SEQ ID NO: 29) with an additional sdAb C6 (SEQ ID NO: 22), a T cell binding sequence lacking FSY. The constructs were designed by adding an L6 linker (SEQ ID NO: 56) between the two sdAb amino acid sequences. The bispecific constructs were then cloned into the pBAD vector and expressed as described in Example 1. The constructs were synthesized with the pelB leader sequence (SEQ ID NO: 15) cleaved from the mature protein and His-Tag purification was performed using six C-terminal histidines.

[0278] The cross-linking of bispecific FSY-modified sdAbs to EGFR and PSMA was evaluated. The protein was incubated with EGFR or PSMA at a molar ratio of 8:1 (the final concentration of EGFR was 0.125 mg / mL, 1.25 μM). The samples were incubated overnight at 37°C in 1xPBS (pH 7.4). The percentage of EGFR or PSMA cross-linking was evaluated by SDS-PAGE. (Figure 5). 1.C12(C4-L6-C6); 2.C12+EGFR; 3.C13(C4-109FSY-L6-C6); 4.C13+EGFR; 5.C14(C4-L2-C7); 6.C14+EGFR; 7.C15(C4-109FSY -L2-C7); 8.C15+EGFR; 9.C16(C2-L6-C6); 10.C16+PSMA; 11.C18(C2-54FSY-L6-C6); 12.C18+PSMA; 13.PSMA; 14.EGFR; 15.Ladder.

[0279] The anti-CD16a sdAb, C37 (SEQ ID NO:52) was conjugated to the anti-PSMA sdAb, FSY (SEQ ID NO:53) using a 2x(G4S)(L1: GGGGSGGGGS (SEQ ID NO:15)) linker, a 3x(G4S)(L2: GGGGSGGGGSGGGGS (SEQ ID NO:31)) linker, a 4x(G4S)(L3: GGGGSGGGGSGGGGSGGGGS (SEQ ID NO:32)) linker, a 5x(G4S)(L4: GGGGSGGGGSGGGGSGGGGSGGGGS (L4; SEQ ID NO:33)) linker, or a SP(L5: SPSTPPTPSPSTPP (SEQ ID NO:34)) linker, respectively. The bispecific constructs C20 (C37-L2-C35), C21 (C37-L1-C35), C22 (C37-L3-C35), C23 (C37-L4-C35), and C24 (C37-L5-C35) were generated by connecting the anti-CD16 asdAb, C37 (SEQ ID NO:52) to the anti-PSMA sdAb-TYR (SEQ ID NO:51) with a 4x(G4S)(L3) linker. The bispecific constructs were then cloned into the pBAD vector and expressed as described in Example 1. The constructs were synthesized with the pelB leader sequence (SEQ ID NO:15) cleaved from the mature protein and His-Tag purification was performed using six C-terminal histidines.

[0280] Purified FSY-containing bispecific sdAb constructs were incubated with PSMA (+PSMA) (SinoBiological; Catalog No. 15877-H07H) in 1× PBS (pH 7.4) at a molar ratio of approximately 8:1 or in the absence of PSMA (-PSMA; control) for 5 min at 37°C. After incubation, the reaction was quenched with SDS-Laemmli loading dye (1× final concentration, containing 100 mM DTT), heated to 95°C for 5 min, and analyzed by SDS-PAGE (4–20% HPLC) stained with Coomassie blue. TGX TM )analyze.

[0281] like Figure 6 As shown, each bispecific variant was able to rapidly cross-link to PSMA within 5 min, regardless of linker length or composition. Figure 6 Depicted are SDS-PAGE analyses of various constructs provided herein. Lanes 1-12 are labeled as follows: 0. Ladder; 1. C20 (C37-L2-C35), without PSMA; 2. C20 (C37-L2-C35), with PSMA; 3. C21 (C37-L1-C35), without PSMA; 4. C21 (C37-L1-C35), with PSMA; 5. C22 (C37-L3-C35), without PSMA; 6. C22 (C37-L3-C35), with PSMA; 7. C23 (C37-L4-C35), without PSMA; 8. C23 (C37-L4-C35), with PSMA; 9. C24 (C37-L5-C35), without PSMA; 10. C24 (C37-L5-C35), with PSMA; 11. PSMA. Bands corresponding to EGFR, PSMA and free sdAb dimer are labeled. Cross-linked material is indicated by an asterisk.

[0282] Example 6: Binding confirmation and kinetic binding characteristics of bispecific adapter variants to recombinant human CD16a and recombinant human PSMA

[0283] Kinetic binding experiments were performed on the Octet instrument using the conjugates generated in Example 6 by bio-layer interferometry to the recombinant antigen. For some conjugates, qualitative experiments were performed using a single concentration (or estimated concentration of a moderately pure sample) to confirm binding to the antigen and approximate affinity ranges. For other conjugates, a series of dilutions of highly purified conjugates were used to characterize the kinetic binding profile and affinity (k on , k off and K D Binding experiments evaluated the binding of antigens to recombinant human CD16a and PSMA antigens.

[0284] PSMA binding

[0285] To assess PSMA binding, PSMA-hFc (Acro Biosystms Cat. No. PSA-H5264) was immobilized on an anti-human capture biosensor (Sartorius Cat. No. 18-5060) and binding to test proteins diluted to the estimated affinity range was performed in 10 mM sodium citrate phosphate (pH 5.7), 150 mM sodium chloride, and 0.01% PS20. Figure 7 Initial curves were collected and presented in A. C21 (SEQ ID NO: 36) was tested at a concentration of about 150 nM or a range of concentrations (150 nM to 500 nM) ( Figure 7 B), C20 (SEQ ID NO: 35) ( Figure 7 C), C22 (SEQ ID NO: 37) ( Figure 7 D), C23 (SEQ ID NO: 38) ( Figure 7 E) and C24 (SEQ ID NO: 39) ( Figure 7 F) Binding of the conjugate. Figure 7 All four constructs with different numbers of G4S repeats in the linker (A-7F) Figure 7 B-7E) and a construct with an SP linker (L5) ( Figure 7 F) Binding to PSMA at pH 5.7, the signal is significantly above the baseline.

[0286] CD16a binding

[0287] CD16a binding was assessed by immobilizing biotinylated CD16a (Acro P / N CDA-H82E8) on a streptavidin biosensor (Sartorius P / N 18-5019) and binding to test proteins diluted to the estimated affinity range in either phosphate pH 7.4 or HEPES buffered saline containing 0.01% PS20. (A) An initial baseline was collected prior to the introduction of any constructs. (B) C21 (SEQ ID NO:36) was tested for binding at 180 nM; (C) C20 (SEQ ID NO:35) was tested at 150 nM; (D) C22 (SEQ ID NO:37) was tested at 500 nM; (E) C23 (SEQ ID NO:38) was tested at 150 nM, 50 nM, 16.7 nM and 5.6 nM; and (F) C24 (SEQ ID NO:39) was tested at 150 nM, 50 nM, 16.7 nM and 5.6 nM. Kinetic binding signals (grey) and 1:1 binding model fit curves (black) for bispecific constructs bound to immobilized CD16a. Figure 8 As shown in A-8F, all five constructs bound to CD16a with estimated affinities in the low nanomolar range.

[0288] Kinetic binding of NK cell bispecific constructs to PSMA at pH 5.7 and 7.4

[0289] Compound C22 (SEQ ID NO: 37) with FSY and non-covalent construct C25 (SEQ ID NO: 40) containing tyrosine (TYR) instead of FSY were produced, expressed and purified as described in Example 6. The constructs were further purified by size exclusion chromatography (SEC) and chromatography using nC-slyD-A1 resin to generate bispecific constructs with a purity greater than 90%. The constructs were then evaluated in a titration series to determine the affinity of each binding domain for its respective antigen.

[0290] Biotinylated his-tagged human PSMA was immobilized on a streptavidin sensor as described above and binding was assessed at pH 5.7 or 7.4. Fig. 9 A and 9C) or pH 7.4 (respectively Fig. 9 The binding of C25 and C22 to immobilized PSMA was measured in a 1:2 dilution series from 2 μM to 21.25 nM in (B and 9D) buffer, and the kinetic binding signals and model fitting curves (smooth, black) were generated. For the non-covalent control construct C25, the binding to PSMA between pH 5.7 and 7.4 ( Fig. 9 A and 9B) were almost identical, whereas the FSY-containing bispecific construct C22 showed a clear shift in binding kinetics associated with cross-linking at pH 5.7 and 7.4 ( Fig. 9 C and 9D). At pH 7.4 ( Fig. 9 D), the association curve of the bispecific construct containing FSY showed a biphasic rather than a 1:1 kinetic curve, and the apparent dissociation was reduced. Fig. 9 C), where covalent cross-linking (or covalent binding) is significantly reduced, these effects are reduced, allowing only binding events to be measured and domain affinities to be calculated.

[0291] The purified constructs were also evaluated for binding to CD16a immobilized on a streptavidin biosensor as described previously. The CD16a-sdAb domain purified alone was also evaluated as a control. Kinetic binding signals and model fit curves were generated from the binding of the molecules at dilutions ranging from 200 nM to 3.125 nM. Concentrations above saturation were not included in the fitting analysis.

[0292] like Fig.10As shown in A-10C, the kinetics of binding to CD16a are similar for the CD16a sdAb domains alone (C37; Fig.10 A), C25( Fig.10 B) and C22( Fig.10 C) The conjugates are similar, indicating that the conjugate does not impair binding of the CD16a adapter component of the conjugate.

[0293] The determined kinetic binding parameters for C25 and C22 are provided in Table 3. The results show similar binding to PSMA at pH 5.7 and similar binding to CD16a at pH 7.4, but a large difference in the binding pattern to PSMA at pH 7.4. These results suggest that the difference in the binding pattern of the constructs to PSMA at pH 7.4 is due to cross-linking of the anti-PSMA sdAb to its target.

[0294] Table 3. Kinetic binding parameters derived from BLI experiments

[0295]

[0296] Example 7: ADCC activity induced by NK cell bispecific constructs

[0297] An ADCC reporter assay was used to examine the effect of covalent attachment to target cells on the ability of the bivalent constructs to promote T cell activity in the presence of target cells expressing different levels of PSMA. PC3pip cells expressing high density PSMA (as described in US 9,713,649B2, the entire contents of which are incorporated herein by reference) and 22Rv1 cells expressing low density PSMA (ATCC CRL-2505) were seeded at 12,500 cells / well in 100 μL RPMI-1640, 10% FBS in a 96-well black clear bottom plate and incubated at 37°C, 5% CO2 for 24 hours to allow cells to adhere to the plate.

[0298] The next day, the medium was removed and C25 and C22 bispecific constructs were generated and purified to greater than 90% purity as described above, or monospecific anti-CD16a sdAb (C37), anti-PSMA sdAb (TYR) (C36), anti-PSMA (FSY) (C35), or endotoxin control sdAb were added at 10 concentration points in 3-fold serial dilutions starting at a final concentration of 120 nM in ADCC assay buffer (RPMI 1640, 4% low IgG-FBS). For further comparison, treatment with monoclonal anti-PSMA antibody, J591, and human IgG isotype control antibody was also tested at 10 concentration points in 3-fold serial dilutions starting at a final concentration of 30 nM in ADCC assay buffer. For cells receiving continuous treatment, some culture medium was removed, and then the test article and Jurkat CD16aV158 ADCC reporter cells from the Promega ADCC reporter bioassay kit (Promega, G7010) were added, the latter having an effector cell: target cell (E: T) ratio of 6: 1 in fresh culture medium. The cell and test article mixture was then incubated at 37°C for 24 hours. For a 4-hour washout treatment, some culture medium was removed and some fresh culture medium was added to the test article, and incubated at 37°C for 4 hours. After incubation for 4 hours, the cells were washed with ADCC assay buffer, and then reporter cells were added at a 6: 1 effector cell: target cell (E: T) ratio, and then incubated at 37°C for 20 hours. For the specificity of signal induction, wells with only target cells (plate background), effector cells plus target cells without test articles (effector cell background), and effector cells plus the highest concentration of each test article (target-independent NK reporter activation) were included.

[0299] BioGlo assay buffer and substrate were added to each well and luminescence was read on a Victor X5 plate reader (Perkin Elmer) after incubation at room temperature for 5-30 minutes and shaking on a plate shaker for 1 minute. Fold induction was calculated by dividing the relative light units (RLU) of the treated wells minus the background by the RLU of the untreated wells minus the background. (Fold induction = RLU (induction - background) / RLU (no test article control / plate background). Data were plotted and curve fit and EC50 were calculated using "log (agonist) vs. response - variable slope (four parameters)".

[0300] Activation of reporter cells expressing CD16a (treated with increasing concentrations of test article for 24 h or washed out after 4 h) after incubation with high PSMA density target cells PC3pip is plotted on Fig.11A and 11BThe activation of reporter cells expressing CD16a (treated with increasing concentrations of test article for 24 h or washed out after 4 h) after incubation with low PSMA density target cells 22Rv1 is plotted in Tables 4 and 5, respectively, with the corresponding EC50 data. Fig. 12A and 12B In the figure, there are tables with corresponding EC50 data (Tables 6 and 7, respectively).

[0301] Table 4: EC of various constructs tested against high PSMA expressing PC3pip cells 50 parameter

[0302]

[0303] Table 5: EC50 parameters for various constructs tested for intermediate washout on high PSMA expressing PC3pip cells after 4 hours

[0304]

[0305] like Fig.11A As shown, continuous exposure of high PSMA density target cells (PC3pip cells) to the bispecific construct for 24 hours resulted in robust and dose-dependent induction of reporter cell signaling, but no signal from the negative control molecule indicating the dependence of signaling on antigen expression. The FSY-modified bispecific construct resulted in greater signal induction and greater potency compared to the TYR-containing construct. The differences observed between the FSY and TYR bispecific constructs were amplified in the 4-hour washout experiment ( Fig. 11B ), where the FSY-modified construct produced a similar maximal signal and a slight reduction in potency compared to 24 h of continuous treatment, but the TYR construct lost almost all activity.

[0306] like Fig. 12A As shown, continuous exposure of low PSMA density target cells (22Rv1 cells) to the bispecific constructs for 24 hours also resulted in a dose-dependent induction of reporter cell signal. However, the maximum RLU was much lower for both FSY and TYR containing constructs. These results correlate with the lower antigen density and are described in Table 6. No signal was observed for any negative control molecule. Similar to the observations for the PC3pip model, the difference between the FSY and TYR constructs was amplified in the 4 hour washout experiment ( Fig. 12B ), where the FSY-modified construct produced a similar maximum signal and a slightly reduced potency compared to 24 hours of continuous treatment, and the TYR construct lost almost all activity. The results are described in Table 7.

[0307] Together, these results demonstrate that both arms of the bispecific construct are capable of inducing reporter cell activation in response to target cells. Furthermore, across a range of receptor densities, the FSY-modified conjugate has a superior ability to engage and activate CD16a-expressing Jurkat NFAT reporter cells in a dose- and target-dependent manner.

[0308] Table 6: EC of various constructs tested against low PSMA expressing 22Rv1 cells 50 parameter

[0309]

[0310] Table 7: EC of various constructs tested for intermediate washout on low PSMA expressing 22Rv1 cells after 4 hours 50 parameter

[0311]

[0312] Example 8: Bispecific conjugates induce primary human NK cell-mediated cytotoxicity against PSMA-expressing cells

[0313] The effect of covalent attachment to target cells on the ability of heterodimeric bivalent constructs to induce primary human NK cell-mediated cytotoxicity of target cells expressing high levels of PSMA was tested.

[0314] According to the manufacturer's protocol, human primary NK cells were isolated from fresh PBMC using an NK cell isolation kit (Miltenyi Biotech catalog number 130-092-657). The purity of the isolated NK cells was assessed by flow cytometry. The total purity of the enriched NK cells was determined to be >95%, and most of the isolated cells had CD56 dim (i.e., cytotoxic phenotype).

[0315] PC3pip cells expressing high density PSMA (as described in US 9,713,649 B2, the entire contents of which are incorporated herein by reference) were seeded at 10,000 cells / well in 100 μL RPMI 1640, 10% FBS in a 96-well black clear bottom plate and incubated at 37° C., 5% CO 2 for 24 hours to allow the cells to adhere to the plate.

[0316] In order to continuously treat with the test article, the next day, the culture medium was removed, C25 and C22 were generated and purified to a purity greater than 90% as described above. C37 monospecific anti-CD16a-sdAb (as a control for target-independent NK cell activation) was also generated and purified as described above. In the RPMI-1640 culture medium supplemented with 10% heat-inactivated FBS (cRPMI), each of C25, C22 and C37 was added at 9 concentration points of 4 times serial dilutions to make the final concentration range between 100 and 0.0015nM. Each concentration was tested in duplicate. A control without a test article was also included. 100,000 primary NK cells and human IL-2 (hIL-2) added in cRPMI were used to reach a final hIL-2 concentration of 25ng / mL. The final volume was about 100 μL. The plate was then incubated for 20 hours at 37°C, 5% CO2.

[0317] For 5h wash out test article, remove culture medium from each well and replace with diluted test article in duplicate. Plate is incubated for 5 hours at 37°C, 5% CO2, then carefully remove all culture medium, and wash once with 100 μL cRPMI, and then remove culture medium. The final volume of 100,000 primary NK cells is 100 μL cRPMI, containing hIL-2 (final concentration is 25ng / mL) (E:T is 10:1). All plates are then incubated for 20 hours at 37°C, 5% CO2.

[0318] The next day, the plates were removed from the incubator and cytotoxicity was determined by the CellTiter-Glo luminescent cell viability assay (Promega). Luminescence was measured using a ClarioStar (BMG Labtech) reader. Cell lysis values ​​were calculated using the following formula:

[0319] % cytotoxicity = 100[T-(T Eab -E)] / [T–T dead ],in:

[0320] T = target cell

[0321] T Eab = treated target cells and effector cells

[0322] E = effector cells

[0323] T dead = Target cells lysed with 0.1% Triton X-100

[0324] Data were plotted and curve fits and EC50 values ​​were calculated as described above. Error bars were calculated to represent standard error values.

[0325] When present for the entire duration of the experiment, the FSY-containing NK cell engager C22 was shown to be 106-fold more potent than the non-covalent C25 in inducing specific target cell killing ( Fig.13A ), and was 140-fold more potent than non-covalent C25 when it was incubated with target cells for 5 h and washed out before adding effector cells ( Fig. 13B ). This increased potency can be attributed to the ability of the C22 construct to covalently bind to PSMA expressed by target cells and is consistent with superior binding to target cells mediated by covalency. The results are listed in Tables 8 and 9.

[0326] Table 8: EC of various constructs tested for specific target cell killing effects 50 and E max parameter

[0327]

[0328] Table 9: EC of various constructs tested for specific target cell killing with intermediate washout at 5 hours 50 and E max parameter

[0329]

[0330] Example 9: Cross-linking of PSMA and T cell bispecific constructs

[0331] Additional bispecific conjugates were generated essentially as described in Example 5, with a PSMA-targeted sdAb having C35 (SEQ ID NO: 50) linked by a 4x (G4S) linker (L3; SEQ ID NO: 32) and C36 (SEQ ID NO: 51) without incorporated FSY and T cell engager sdAbs C38 or C39 (SEQ ID NO: 53 or SEQ ID NO: 54) targeting CD3-ε (CD3ε) or C40 (SEQ ID NO: 55) targeting T cell receptor α / β (TCRαβ). The intact mass of all bispecific conjugates was confirmed by liquid chromatography-mass spectrometry (LC-MS) analysis, and the purity of the preparations was determined to be 92.8-99.7% by high performance liquid chromatography-size exclusion chromatography (HPLC-SEC). The conjugates are summarized in Table 10 below:

[0332] Table 10. Constructs and corresponding SEQ ID NOs

[0333] Compound No. SEQ ID NO C26 41 C27 42 C28 43 C29 44 C30 45 C31 46 C32 47 C33 48 C34 49

[0334] Purified bispecific sdAb constructs were incubated with PSMA (+PSMA) (Sino Biological; Catalog No. 15877-H07H) in 1× PBS (pH 7.4) at a molar ratio of approximately 5:1 or in the absence of PSMA (-PSMA; control) at 37° C. for 0, 1, 5, or 10 minutes. After incubation, the reaction was quenched with SDS-Laemmli loading dye (1× final concentration, containing 100 mM DTT), heated to 95° C. for 5 min, and analyzed by SDS-PAGE (4-20% TGX TM ) analysis. Figures 14A-14E As shown, each bispecific variant was expressed and purified in sufficient quantities to evaluate cross-linking. All constructs containing FSY demonstrated time-dependent cross-linking to PSMA. The ability to cross-link to PSMA was unique to FSY, as bispecific variants containing TYR substitutions instead of FSY did not cross-link to PSMA.

[0335] Binding to immobilized recombinant human PSMA was determined by BLI essentially as described in Example 6. All constructs tested had highly similar binding sensorgrams (data not shown) and estimated affinities.

[0336] To evaluate the ability of C26 (with TYR) and C27 (with FSY) to crosslink PSMA, C26 and C27 were incubated with different concentrations of PSMA as described above. Samples of the incubation mixture were taken at 0, 1, 5, and 10 minutes and quenched with SDS-Laemmli loading dye as described above. The collected samples were subjected to SDS-PAGE and Fig.14A Figure 1. Lanes A, B and 1-12 are labeled as follows: A. Ladder; B. PSMA only; 1. Non-reduced C26 (no DTT), no PSMA; 2. Reduced (DTT) C26, no PSMA; 3. C26 with PSMA at 0 minutes; 4. C26 with PSMA after 1 minute; 5. C26 with PSMA after 5 minutes; 6. C26 with PSMA after 10 minutes; 7. Non-reduced C27 (no DTT), no PSMA; 7. Reduced (DTT) C27, no PSMA; 9. C27 with PSMA at 0 minutes; 10. C27 with PSMA after 1 minute; 11. C27 with PSMA after 5 minutes; 12. C27 with PSMA after 10 minutes. Different bands are marked with asterisks: * corresponds to cross-linked test article with PSMA; ** corresponds to PSMA; *** corresponds to test article C26 or C27.

[0337] To evaluate the ability of C28 (with TYR) to crosslink PSMA, C28 was incubated with different concentrations of PSMA as described above. Samples of the incubation mixture were taken at 0, 1, 5, and 10 minutes and quenched with SDS-Laemmli loading dye as described above. The collected samples were subjected to SDS-PAGE and Fig. 14B Lanes A, B and 1-6 are labeled as follows: A. PSMA only; B. Ladder; 1. Non-reduced C28 (no DTT), no PSMA; 2. Reduced (DTT) C28, no PSMA; 3. C28 with PSMA at 0 minutes; 4. C28 with PSMA after 1 minute; 5. C28 with PSMA after 5 minutes; 6. C28 with PSMA after 10 minutes. Different bands are marked with asterisks: * corresponds to PSMA; ** corresponds to test article C28.

[0338] To evaluate the ability of C29 (with TYR) and C30 (with FSY) to crosslink PSMA, C29 and C30 were incubated with different concentrations of PSMA as described above. Samples of the incubation mixture were taken at 0, 1, 5, and 10 minutes and quenched with SDS-Laemmli loading dye as described above. The collected samples were subjected to SDS-PAGE and Fig. 14C Lanes A, B, C, and 1-12 are labeled as follows: A. and B. Ladder; C. PSMA only; 1. Non-reduced C29 (no DTT), no PSMA; 2. Reduced (DTT) C29, no PSMA; 3. C29 with PSMA at 0 minutes; 4. C29 with PSMA after 1 minute; 5. C29 with PSMA after 5 minutes; 6. C29 with PSMA after 10 minutes; 7. Non-reduced C30 (no DTT), no PSMA; 7. Reduced (DTT) C30, no PSMA; 9. C30 with PSMA at 0 minutes; 10. C30 with PSMA after 1 minute; 11. C30 with PSMA after 5 minutes; 12. C30 with PSMA after 10 minutes. The different bands are marked with asterisks: * corresponds to the test article cross-linked with PSMA; ** corresponds to PSMA; *** corresponds to the test article C29 or C30.

[0339] To evaluate the ability of the PSMA-T cell engagement constructs to crosslink PSMA, C31 (with TYR) and C32 (with FSY) were incubated with different concentrations of PSMA as described above. Samples of the incubation mixture were taken at 0, 1, 5, and 10 minutes and quenched with SDS-Laemmli loading dye as described above. The collected samples were subjected to SDS-PAGE and Fig.14DSchematic representation in Figure 1. Lanes A, B, C and 1-12 are labeled as follows: A. PSMA only; B. and C. Ladder; 1. Non-reduced C31 (no DTT), no PSMA; 2. Reduced (DTT) C31, no PSMA; 3. C31 with PSMA at 0 minutes; 4. C31 with PSMA after 1 minute; 5. C31 with PSMA after 5 minutes; 6. C31 with PSMA after 10 minutes; 7. Non-reduced C32 (no DTT), no PSMA; 7. Reduced (DTT) C32, no PSMA; 9. C32 with PSMA at 0 minutes; 10. C32 with PSMA after 1 minute; 11. C32 with PSMA after 5 minutes; 12. C32 with PSMA after 10 minutes. Different bands are marked with asterisks: * corresponds to PSMA; ** corresponds to test article C31 or C32.

[0340] To evaluate the ability of the PSMA-T cell engagement constructs to crosslink PSMA, C33 (with TYR) and C34 (with FSY) were incubated with different concentrations of PSMA as described above. Samples of the incubation mixture were taken at 0, 1, 5, and 10 minutes and quenched with SDS-Laemmli loading dye as described above. The collected samples were subjected to SDS-PAGE and Fig.14E Lanes A, B, C, and 1-12 are labeled as follows: A. Ladder; B. PSMA; C. Ladder; 1. Non-reduced C33 (no DTT), no PSMA; 2. Reduced (DTT) C33, no PSMA; 3. C33 with PSMA at 0 minutes; 4. C33 with PSMA after 1 minute; 5. C33 with PSMA after 5 minutes; 6. C33 with PSMA after 10 minutes; 7. Non-reduced C34 (no DTT), no PSMA; 7. Reduced (DTT) C34, no PSMA; 9. C34 with PSMA at 0 minutes; 10. C34 with PSMA after 1 minute; 11. C34 with PSMA after 5 minutes; 12. C34 with PSMA after 10 minutes. The different bands are marked with asterisks: * corresponds to cross-linked test article with PSMA; ** corresponds to PSMA; *** corresponds to test article C33 or C34.

[0341] Example 10: ADCC activity induced by T cell bispecific constructs

[0342] The effect of covalent attachment to target cells on the ability of the bivalent constructs to promote T cell activity in the presence of target cells expressing varying levels of PSMA was tested. PC3pip cells were determined essentially as described in Example 8, except that the cells and constructs were incubated for 6 hours instead of 4 hours, and the constructs described in Example 10 were used. An IgG1 isotype control antibody (BioXCell) was used as a negative control, and an anti-PSMA-anti-CD3 IgG-type bispecific antibody (BPS Bioscience Catalog No. 101242-2) was used as a positive control.

[0343] like Fig.15 As shown, exposure to the tested T cell bispecific constructs for 6 hours in the presence of PSMA-expressing PC3pip target cells resulted in robust and dose-dependent induction of luminescent signal. Isotype control antibodies (solid circles) did not elicit any response. In general, FSY-modified T cell bispecific constructs (C27, CD3-PSMA bispecific, C30, and C34) showed greater potency compared to their TYR-containing counterparts. In some cases, FSY-equipped compounds were characterized by not only higher potency but also greater maximum signal ( Fig.16A -C). Fig.16A As shown, the FSY-modified compound C27 showed 12.7 times the potency of the TYR-containing analog C26 (EC50 of 0.59 nM and 7.4 nM, respectively). Moreover, the covalent binder C27 was 1.4 times more potent and 1.2 times more effective than the commercial CD3-PSMA bispecific antibody used as a positive control. The covalent binder C30 showed 11.8 times higher potency than its non-covalent counterpart C29 (EC50 of 0.51 nM and 5.98 nM; Fig. 16B C30 also had similar efficacy and was 1.6 times more potent than the commercial CD3-PSMA bispecific antibody (EC50 of 0.8 nM). The FSY-modified compound C34 was 21.9 times more potent than its TYR-containing analog C33 (EC50 of 1.42 nM vs. 31.09 nM; Fig. 16C ).

[0344] The three TYR-equipped T cell bispecific constructs, C28, C31, and C32, all effectively activated reporter cells with EC50 values ​​of 14.76 nM, 5.33 nM, and 1.42 nM, respectively.

[0345] No substantial level of T cell activation was observed with the T cell bispecific constructs when tested in the presence of PSMA-negative PC-3 target cells, demonstrating the dependence of activation on PSMA expression ( Fig.17). In contrast, the commercial CD3-PSMA bispecific antibody exhibited some T cell activation at about 50 to about 100 nM of the CD3-PSMA bispecific antibody, while the FSY-containing construct did not appear to stimulate T cell activation.

[0346] Although embodiments of the present disclosure have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided only as examples. Without departing from the present disclosure, those skilled in the art will now expect many variations, changes and substitutions. It should be understood that various alternatives to the embodiments of the present disclosure described herein may be adopted when practicing the present disclosure. The following claims are intended to define the scope of the present disclosure, and therefore encompass methods and structures within the scope of these claims and their equivalents.

[0347] The disclosure of the present application is further illustrated in the following embodiments, which are given for illustrative purposes only and are not intended to limit the present disclosure in any way:

[0348] Embodiment 1: A conjugate comprising a first targeting domain configured to bind to a first target on a first cell, and a second targeting domain configured to bind to a second target on a second cell, wherein the first targeting domain comprises at least one first unnatural amino acid (UAA), whereby the first targeting domain is capable of covalently binding to the first target at the site of the UAA and the first target.

[0349] Embodiment 2: The conjugate of embodiment 1, wherein the second cell is an immune cell.

[0350] Embodiment 3: The conjugate of embodiment 1 or embodiment 2, wherein the first cell is a tumor cell.

[0351] Embodiment 4: The conjugate of any one of Embodiments 1-3, wherein the first targeting domain comprises an antibody or an antigen-binding fragment thereof.

[0352] Embodiment 5: The conjugate of embodiment 4, wherein the first targeting domain comprises a single domain antibody (sdAb).

[0353] Embodiment 6: The conjugate of any one of Embodiments 1-5, wherein the first UAA is contained within or near the region of the first targeting domain that interfaces with the first target.

[0354] Embodiment 7: The conjugate of any one of Embodiments 1-6, wherein the second targeting domain comprises an antibody or an antigen-binding fragment thereof.

[0355] Embodiment 8: The conjugate of embodiment 7, wherein the second targeting domain comprises a single domain antibody (sdAb).

[0356] Embodiment 9: The conjugate of any one of Embodiments 1-8, wherein the first targeting domain and the second targeting domain are linked as a fusion protein.

[0357] Embodiment 10: The conjugate of any one of Embodiments 1-8, wherein the first targeting domain and the second targeting domain are linked by chemical conjugation.

[0358] Embodiment 11: The conjugate of embodiment 9 or embodiment 10, wherein the first targeting domain and the second domain are connected by a linker.

[0359] Embodiment 12: The conjugate of embodiment 11, wherein the linker is a polypeptide linker.

[0360] Embodiment 13: The conjugate of any one of Embodiments 1-2, wherein the first target is a first cell surface molecule.

[0361] Embodiment 14: The conjugate of any one of Embodiments 1-3, wherein the second target is a second cell surface molecule.

[0362] Embodiment 15: The conjugate of any one of Embodiments 1-14, wherein the at least one first UAA comprises a fluorosulfate moiety.

[0363] Embodiment 16: The conjugate of any one of Embodiments 1-15, wherein the at least one UAA comprises an aryl fluorosulfate moiety.

[0364] Embodiment 17: The conjugate of Embodiment 16, wherein the at least one first UAA comprises Formula I:

[0365] Embodiment 18: The conjugate of Embodiment 16, wherein the at least one first UAA has the structure:

[0366] Embodiment 19: The conjugate of Embodiment 16, wherein the at least one first UAA has the structure:

[0367] Embodiment 20: The conjugate of Embodiment 16, wherein the at least one first UAA comprises Formula II:

[0368] Embodiment 21: The conjugate of Embodiment 16, wherein the at least one first UAA has the structure:

[0369] Embodiment 22: The conjugate of Embodiment 16, wherein the at least one first UAA has the structure:

[0370] Embodiment 23: The conjugate of Embodiment 16, wherein the at least one first UAA comprises Formula III:

[0371] Embodiment 24: The conjugate of Embodiment 16, wherein the at least one first UAA has the structure:

[0372] Embodiment 25: The conjugate of Embodiment 16, wherein the at least one first UAA has the structure:

[0373] Embodiment 26: The conjugate of any one of Embodiments 1-15, wherein the at least one first UAA has a structure of Formula (IA):

[0374]

[0375] in,

[0376] Each X is independently O or NR';

[0377] Y is a bond, -O-, -NR- or -N=;

[0378] A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4;

[0379] When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl;

[0380] R 1 is hydrogen, fluorine or iodine; R 2 is hydrogen or methyl;

[0381] L is -(CH2) p -or-C(O)NH-(CH2) p -; p is an integer from 1 to 6; and

[0382] When Y is -O- or -NR-, m is 1; when Y is -N=, m is 2.

[0383] Embodiment 27: The conjugate of Embodiment 26, wherein the at least one first UAA has formula (IA-a): structure.

[0384] Embodiment 28: The conjugate of Embodiment 26, wherein the at least one first UAA has formula (IA-b): structure.

[0385] Embodiment 29: The conjugate of Embodiment 26, wherein the at least one first UAA has a structure of Formula (IB):

[0386]

[0387] Embodiment 30: The conjugate of Embodiment 26, wherein the at least one first UAA has a structure of Formula (IC):

[0388]

[0389] Embodiment 31: The conjugate of Embodiment 26, wherein the at least one first UAA has a structure of Formula (ID):

[0390]

[0391] in:

[0392] Each X is independently O or NR';

[0393] Y is a bond, -O-, -NR- or -N=;

[0394] A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4;

[0395] When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl;

[0396] R 1 is hydrogen, fluorine or iodine; R 2 is hydrogen or methyl; and

[0397] When Y is a bond, -O- or -NR-, m is 1; when Y is -N=, m is 2.

[0398] Embodiment 32: The conjugate of Embodiment 26, wherein the at least one first UAA has a structure of Formula (IE):

[0399]

[0400] in:

[0401] Each X is independently O or NR';

[0402] Y is a bond, -O-, -NR- or -N=;

[0403] A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4;

[0404] When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl;

[0405] R 1 is hydrogen, fluorine or iodine; R 2 is hydrogen or methyl; and

[0406] When Y is a bond, -O- or -NR-, m is 1; when Y is -N=, m is 2.

[0407] Embodiment 33: The conjugate of Embodiment 26, wherein the at least one first UAA has a structure of Formula (IIA):

[0408]

[0409] in:

[0410] X is independently O or NR'; and

[0411] When present, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl.

[0412] Embodiment 34: The conjugate of Embodiment 26, wherein the at least one first UAA has a structure of Formula (IIB):

[0413] in:

[0414] X is independently O or NR'; and

[0415] When present, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl.

[0416] Embodiment 35: A conjugate as described in any of Embodiments 1-15, wherein the at least one first UAA has The structure of which:

[0417] Each X is independently O or NR';

[0418] Y is a bond, -O-, -NR- or -N=;

[0419] A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4;

[0420] When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl;

[0421] Ring A is a 5- to 6-membered aryl or heteroaryl group;

[0422] Each R A are independently -OH, -OR X , halogen, NHR X 、N(R X )2 or optionally substituted alkyl; p is 0, 1, 2, 3 or 4; each R X is an optionally substituted alkyl group;

[0423] L is -(CH2) p -or-C(O)NH-(CH2) p -; p is an integer from 1 to 6; and

[0424] When Y is a bond, -O- or -NR-, m is 1; when Y is -N=, m is 2.

[0425] Embodiment 36: A conjugate as described in any of embodiments 13-35, wherein the first cell surface molecule is selected from PSMA, EGFR, HER2, HER3, CD3, CD16, NKp46, PD-L1, EphA4, fibronectin ED-B, CD45, EpCAM, CCR4, CD25, VEGF, VEGFR2, endo180, LIV-1, PTK7, CDH6, CSP-1, CD71, PRLR, SEZ6, DLL1, NOTCH3rec, NaPi2b, DLK1, Muc16, LRP5 and LRP6.

[0426] Embodiment 37: The conjugate of any one of Embodiments 14-36, wherein the second cell surface molecule is a cell surface molecule present on an immune cell.

[0427] Embodiment 38: The conjugate of Embodiment 37, wherein the immune cell is a T cell.

[0428] Embodiment 39: The conjugate of Embodiment 37, wherein the immune cell is a NK cell.

[0429] Embodiment 40: The conjugate of Embodiment 37, wherein the immune cell is a γδ T cell.

[0430] Embodiment 41: The conjugate of embodiment 37, wherein the second cell surface molecule is CD3, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, Vγ9Vδ2 or CD16.

[0431] Embodiment 42: The conjugate of any one of Embodiments 1-41, wherein the second domain comprises a second UAA, whereby the second domain is capable of covalently binding to the second target at the site of the second UAA.

[0432] Embodiment 43: The conjugate of any Embodiment 42, wherein the second UAA is different from the at least one UAA contained in the first targeting domain.

[0433] Embodiment 44: The conjugate of Embodiment 42, wherein the second UAA is identical to the at least one UAA contained in the first targeting domain.

[0434] Embodiment 45: The conjugate of any one of Embodiments 42-44, wherein the second UAA comprises a fluorosulfate moiety.

[0435] Embodiment 46: The conjugate of any one of Embodiments 42-44, wherein the second UAA comprises an aryl fluorosulfate moiety.

[0436] Embodiment 47: The conjugate of Embodiment 46, wherein the second UAA comprises Formula I:

[0437] Embodiment 48: The conjugate of Embodiment 46, wherein the second UAA has the structure:

[0438] Embodiment 49: The conjugate of Embodiment 46, wherein the second UAA has the structure:

[0439] Embodiment 50: The conjugate of Embodiment 46, wherein the second UAA comprises Formula II:

[0440] Embodiment 51: The conjugate of Embodiment 46, wherein the second UAA has the structure:

[0441] Embodiment 52: The conjugate of Embodiment 46, wherein the second UAA has the structure:

[0442] Embodiment 53: The conjugate of Embodiment 46, wherein the second UAA comprises Formula III:

[0443] Embodiment 54: The conjugate of Embodiment 46, wherein the second UAA has the structure:

[0444] Embodiment 55: The conjugate of Embodiment 46, wherein the second UAA has the structure:

[0445] Embodiment 56: A conjugate as described in any one of embodiments 42-44, wherein the second UAA has a structure of formula (IA):

[0446]

[0447] in,

[0448] Each X is independently O or NR';

[0449] Y is a bond, -O-, -NR- or -N=;

[0450] A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4;

[0451] When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl;

[0452] R 1 is hydrogen, fluorine or iodine; R 2 is hydrogen or methyl;

[0453] L is -(CH2) p -or-C(O)NH-(CH2) p -; p is an integer from 1 to 6; and

[0454] When Y is -O- or -NR-, m is 1; when Y is -N=, m is 2.

[0455] Embodiment 57: The conjugate of Embodiment 56, wherein the second UAA has formula (IA-a): structure.

[0456] Embodiment 58: The conjugate of Embodiment 56, wherein the second UAA has formula (IA-b): structure.

[0457] Embodiment 59: The conjugate of Embodiment 56, wherein the second UAA has a structure of Formula (IB):

[0458] Embodiment 60: The conjugate of Embodiment 56, wherein the second UAA has a structure of Formula (IC):

[0459] Embodiment 61: The conjugate of Embodiment 56, wherein the second UAA has a structure of Formula (ID):

[0460]

[0461] in:

[0462] Each X is independently O or NR';

[0463] Y is a bond, -O-, -NR- or -N=;

[0464] A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4;

[0465] When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl;

[0466] R 1 is hydrogen, fluorine or iodine; R 2 is hydrogen or methyl; and

[0467] When Y is a bond, -O- or -NR-, m is 1; when Y is -N=, m is 2.

[0468] Embodiment 62: The conjugate of Embodiment 56, wherein the second UAA has a structure of Formula (IE):

[0469]

[0470] in:

[0471] Each X is independently O or NR';

[0472] Y is a bond, -O-, -NR- or -N=;

[0473] A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4;

[0474] When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl;

[0475] R 1 is hydrogen, fluorine or iodine; R 2 is hydrogen or methyl; and

[0476] When Y is a bond, -O- or -NR-, m is 1; when Y is -N=, m is 2.

[0477] Embodiment 63: The conjugate of Embodiment 56, wherein the second UAA has the structure of Formula (IIA):

[0478]

[0479] in:

[0480] X is independently O or NR'; and

[0481] When present, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl.

[0482] Embodiment 64: The conjugate of Embodiment 56, wherein the second UAA has the structure of Formula (IIB):

[0483]

[0484] in:

[0485] X is independently O or NR'; and

[0486] When present, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl.

[0487] Embodiment 65: A conjugate as described in any of Embodiments 42-44, wherein the second UAA has The structure of

[0488] Each X is independently O or NR';

[0489] Y is a bond, -O-, -NR- or -N=;

[0490] A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4;

[0491] When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl;

[0492] Ring A is a 5- to 6-membered aryl or heteroaryl group;

[0493] Each R A are independently -OH, -OR X , halogen, NHR X 、N(R X )2 or optionally substituted alkyl; p is 0, 1, 2, 3 or 4; each R X is an optionally substituted alkyl group;

[0494] L is -(CH2) p -or-C(O)NH-(CH2) p -; p is an integer from 1 to 6; and

[0495] When Y is a bond, -O- or -NR-, m is 1; when Y is -N=, m is 2.

[0496] Embodiment 66: A conjugate as described in any of embodiments 13-35, wherein the first cell surface molecule is selected from PSMA, EGFR, HER2, HER3, CD3, CD16, NKp46, PD-L1, EphA4, fibronectin ED-B, CD45, EpCAM, CCR4, CD25, VEGF, VEGFR2, endo180, LIV-1, PTK7, CDH6, CSP-1, CD71, PRLR, SEZ6, DLL1, NOTCH3rec, NaPi2b, DLK1, Muc16, LRP5 and LRP6.

[0497] Embodiment 67: The conjugate of any one of Embodiments 14-36, wherein the second cell surface molecule is a cell surface molecule present on an immune cell.

[0498] Embodiment 68: The conjugate of Embodiment 65, wherein the immune cells comprise T cells or NK cells.

[0499] Embodiment 69: The conjugate of Embodiment 65, wherein the immune cell is a γδ T cell.

[0500] Embodiment 70: A conjugate as described in embodiment 65, wherein the second cell surface molecule is CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1 or Vγ9Vδ2.

[0501] Embodiment 71: The conjugate of any one of Embodiments 1-65, wherein the first targeting domain comprises any one of SEQ ID NOs: 1-4, 16-18, 20, and 29.

[0502] Embodiment 72: The conjugate of any one of Embodiments 1-65, wherein the first targeting domain comprises a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1-4, 16-18, 20, 29, 50, or 51.

[0503] Embodiment 73: The conjugate of any one of Embodiments 1-66, wherein the second targeting domain comprises SEQ ID NO: 22, 25, or 52-55.

[0504] Embodiment 74: The conjugate of any one of Embodiments 1-66, wherein the second targeting domain comprises a sequence having at least 70% sequence identity to SEQ ID NO: 22, 25, or 52-55.

[0505] Embodiment 75: The conjugate of any one of Embodiments 1-65, wherein the conjugate comprises any one of SEQ ID NOs: 19, 23, 24, 26-28, 30, or 35-49.

[0506] Embodiment 76: The conjugate of any one of Embodiments 1-65, wherein the conjugate comprises a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 19, 23, 24, 26-28, 30, or 35-49.

[0507] Embodiment 77: The conjugate of any one of Embodiments 1-65, wherein the conjugate comprises a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1-3, 16, 18, 22, 25, or 50-55.

[0508] Embodiment 78: The conjugate of any one of Embodiments 1-65, wherein the conjugate comprises a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 19, 21, 23, 24, 26-28, 30, or 35-49.

[0509] Embodiment 79: The conjugate of any one of Embodiments 1-65, wherein the first targeting domain comprises SEQ ID NO:1.

[0510] Embodiment 80: A conjugate as described in embodiment 75, wherein the UAA is present at an amino acid position selected from 26, 28, 29, 30, 99, 102, 103, 105, 108, 110, 111, 112, 113, 114 and 115 relative to SEQ ID NO:1.

[0511] Embodiment 81: The conjugate of any one of Embodiments 1-65, wherein the first targeting domain comprises SEQ ID NO:2.

[0512] Embodiment 82: A conjugate as described in Embodiment 77, wherein the UAA is present at an amino acid position selected from 50, 52, 53, 54, 56, 58 and 100 relative to SEQ ID NO:2.

[0513] Embodiment 83: The conjugate of any one of Embodiments 1-65, wherein the first targeting domain comprises SEQ ID NO:3.

[0514] Embodiment 84: The engineered sdAb of Embodiment 79, wherein the UAA is present at an amino acid position selected from the group consisting of 58, 62, 101, 103, and 107 relative to SEQ ID NO:3.

[0515] Embodiment 85: The conjugate of any one of Embodiments 1-65, wherein the first targeting domain comprises SEQ ID NO:16.

[0516] Embodiment 86: The conjugate of Embodiment 75, wherein the first targeting domain comprising SEQ ID NO: 16 further comprises a non-natural amino acid at position 109 relative to SEQ ID NO: 16.

[0517] Embodiment 87: The conjugate of any one of Embodiments 1-65, wherein the first targeting domain comprises SEQ ID NO:18.

[0518] Embodiment 88: The conjugate of any one of Embodiments 1-83, wherein the second targeting domain comprises SEQ ID NO:22.

[0519] Embodiment 89: The conjugate of any one of Embodiments 1-83, wherein the second targeting domain comprises SEQ ID NO:25.

[0520] Embodiment 90: A method comprising administering the conjugate of any one of Embodiments 1-85, wherein the conjugate covalently binds to the first target on the surface of a first cell.

[0521] Embodiment 91: A method comprising administering the conjugate of any one of Embodiments 1-85, wherein the conjugate binds to the second target on the surface of a second cell.

[0522] Embodiment 92: A method comprising administering the conjugate of any one of Embodiments 1-85, wherein the conjugate covalently binds to the first target on the surface of a first cell and the conjugate binds to the second target on a second cell.

[0523] Embodiment 93: The method of any one of Embodiments 86-89, wherein the second cell is a tumor cell.

[0524] Embodiment 94: The method of Embodiment 90, wherein the conjugate kills the tumor cells or inhibits the growth of the tumor cells.

[0525] Embodiment 95: A method as described in Embodiment 90 or 91, wherein the first target is selected from PSMA, EGFR, HER2, HER3, PD-L1, EphA4, fibronectin ED-B, CD45, EpCAM, CCR4, CD25, VEGF, VEGFR2, endo180, LIV-1, PTK7, CDH6, CSP-1, CD71, PRLR, SEZ6, DLL1, NOTCH3rec, NaPi2b, SIRPa, DLK1, Muc16, LRP5 and LRP6.

[0526] Embodiment 96: A method as described in embodiments 86-92, wherein the immune cell is a T cell.

[0527] Embodiment 97: A method as described in embodiments 86-93, wherein the immune cells are γδ T cells.

[0528] Embodiment 98: A method as described in embodiments 86-92, wherein the immune cell is a NK cell or a NKT cell.

[0529] Embodiment 99: A method as described in embodiments 86-95, wherein the second cell surface molecule is CD3, CD16, CD16a, CD3ε, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1 or Vγ9Vδ2.

[0530] Embodiment 100: A method of treating a proliferative disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the conjugate of any one of Embodiments 1-85.

[0531] Embodiment 101: The method of Embodiment 97, wherein the proliferative disease or condition is cancer.

[0532] Embodiment 102: A method as described in Embodiment 98, wherein the cancer is a solid tumor cancer selected from bladder cancer, bone cancer, brain cancer, breast cancer, colorectal cancer, esophageal cancer, eye cancer, head and neck cancer, kidney cancer, lung cancer, melanoma, ovarian cancer, pancreatic cancer and prostate cancer.

[0533] Embodiment 103: A method of making a conjugate as described in any one of embodiments 1-85, comprising synthesizing in vivo the first targeting domain comprising at least one unnatural amino acid.

[0534] Embodiment 104: A method as described in Embodiment 100, further comprising synthesizing the second domain in vivo.

[0535] Embodiment 105: A method as described in embodiment 100 or 101, wherein the synthesis includes the use of an orthogonal tRNA synthetase / suppressor tRNA pair.

[0536] Embodiment 106: A method as described in Embodiment 100, wherein the synthesis includes the orthogonal tRNA synthetase / suppressor tRNA pair, which is derived from pyrrolysine tRNA synthetase / tRNA Pyl .

Claims

1. A conjugate comprising: a first targeting domain configured to bind a first target on a first cell, and a second targeting domain configured to bind a second target on a second cell, wherein the first targeting domain comprises at least one first unnatural amino acid (UAA), such that the first targeting domain is capable of covalently binding to a first target at the site of the UAA and the first target.

2. The conjugate of claim 1, wherein the second cell is an immune cell.

3. The conjugate of claim 1 or claim 2, wherein the first cell is a tumor cell.

4. The conjugate of any one of claims 1-3, wherein the first targeting domain comprises an antibody or an antigen-binding fragment thereof.

5. The conjugate of claim 4, wherein the first targeting domain comprises a single domain antibody (sdAb).

6. The conjugate of any one of claims 1-5, wherein the first UAA is contained within or near the region of the first targeting domain that is connected to the first target.

7. The conjugate of any one of claims 1-6, wherein the second targeting domain comprises an antibody or an antigen-binding fragment thereof.

8. The conjugate of claim 7, wherein the second targeting domain comprises a single domain antibody (sdAb).

9. The conjugate of any one of claims 1-8, wherein the first targeting domain and the second targeting domain are linked by chemical conjugation.

10. The conjugate of claim 9, wherein the first targeting domain and the second domain are connected by a linker. The conjugate of claim 10 , wherein the linker is a polypeptide linker.

12. The conjugate of any one of claims 1 or 2, wherein the first target comprises a first cell surface molecule.

13. The conjugate of any one of claims 1-3, wherein the second target is a second cell surface molecule.

14. The conjugate of any one of claims 1-13, wherein the at least one UAA comprises an aryl fluorosulfate moiety.

15. The conjugate of claim 14, wherein the at least one first UAA comprises Formula I:

16. The conjugate of claim 14, wherein the at least one first UAA has the structure:

17. The conjugate of claim 14, wherein the at least one first UAA comprises Formula II:

18. The conjugate of claim 14, wherein the at least one first UAA has the structure:

19. The conjugate of claim 14, wherein the at least one first UAA comprises Formula III:

20. The conjugate of claim 14, wherein the at least one first UAA has the structure:

21. The conjugate of any one of claims 1-14, wherein the at least one first UAA has a structure of Formula (IA): in, Each X is independently O or NR'; Y is a bond, -O-, -NR- or -N=; A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4; When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl; R 1 is hydrogen, fluorine or iodine; R 2 is hydrogen or methyl; L is -(CH2) p -or-C(O)NH-(CH2) p -; p is an integer from 1 to 6; and When Y is -O- or -NR-, m is 1; when Y is -N=, m is 2.

22. The conjugate of claim 21, wherein the at least one first UAA has formula (IA-a): structure.

23. The conjugate of claim 21, wherein the at least one first UAA has a structure of Formula (IB):

24. The conjugate of claim 21, wherein the at least one first UAA has a structure of Formula (ID): in: Each X is independently O or NR'; Y is a bond, -O-, -NR- or -N=; A is a bond or -(CH2) n -; m is 1 or 2; n is an integer from 1 to 4; When present, each R and R' is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl; R 1 is hydrogen, fluorine or iodine; R 2 is hydrogen or methyl; and When Y is a bond, -O- or -NR-, m is 1; when Y is -N=, m is 2.

25. The conjugate of claim 21, wherein the at least one first UAA has a structure of Formula (IIA): in: X is independently O or NR'; and When present, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl.

26. The conjugate of claim 21, wherein the at least one first UAA has a structure of Formula (IIB): in: X is independently O or NR'; and When present, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl.

27. The conjugate of any one of claims 12-26, wherein the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Mucl, BCMA, C4.4a, CA6, CAIX, CanAg, CAX II, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT 3. FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT.

28. The conjugate of any one of claims 13-27, wherein the second cell surface molecule is a cell surface molecule present on an immune cell.

29. The conjugate of claim 28, wherein the immune cell comprises a T cell or a NK cell.

30. The conjugate of claim 28, wherein the second cell surface molecule is CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, or Vγ9Vδ2.

31. The conjugate of any one of claims 1-30, wherein the first targeting domain comprises any one of SEQ ID NO: 1-4, 16-18, 20, 29, 50 or 51.

32. The conjugate of any one of claims 1-31, wherein the first targeting domain comprises a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1-4, 16-18, 20, 29, 50, or 51.

33. The conjugate of any one of claims 1-31, wherein the second targeting domain comprises a sequence having at least 70% sequence identity to SEQ ID NO: 22, 25, or 52-55.

34. The conjugate of any one of claims 1-31, wherein the conjugate comprises a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 19, 21, 23, 24, 26-28, 30, 35-49, 57, or 64.

35. The conjugate of any one of claims 1-34, wherein the first targeting domain comprises SEQ ID NO: 16 or 51.

36. The conjugate of claim 35, wherein the first targeting domain comprising SEQ ID NO: 16 further comprises an unnatural amino acid at position 109 relative to SEQ ID NO:

16.

37. The conjugate of claim 35, wherein the first targeting domain comprising SEQ ID NO: 51 further comprises an unnatural amino acid at position 101 relative to SEQ ID NO:

51.

38. A method comprising administering the conjugate of any one of claims 1-37, wherein the conjugate covalently binds to the first target on the surface of a first cell.

39. A method comprising administering the conjugate of any one of claims 1-37, wherein the conjugate binds to the second target on the surface of a second cell.

40. A method comprising administering the conjugate of any one of claims 1-37, wherein the conjugate covalently binds to the first target on the surface of a first cell and the conjugate binds to the second target on a second cell.

41. The method of any one of claims 38-40, wherein the first cell is a tumor cell.

42. The method of claim 41, wherein the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, C CR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1 or xCT.

43. The method of claim 40, wherein the second cell is an immune cell, wherein the immune cell is a T cell or a NK cell.

44. The method of claim 40, wherein the second cell surface molecule is CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, or Vγ9Vδ2.

45. A method of treating a proliferative disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the conjugate of any one of claims 1-37.

46. ​​The method of claim 45, wherein the proliferative disease or condition is cancer.

47. A method of making the conjugate of any one of claims 1-37, comprising synthesizing in vivo the first targeting domain comprising at least one unnatural amino acid.

48. The method of claim 47, further comprising synthesizing the second domain in vivo.

49. The method of claim 47 or 48, wherein synthesizing comprises using an orthogonal tRNA synthetase / suppressor tRNA pair.

50. The method of claim 49, wherein the synthesis comprises the orthogonal tRNA synthetase / suppressor tRNA pair, which is derived from a pyrrolysine tRNA synthetase / tRNA Pyl .

Images