Nucleic acid for transfection

Abstract

Provided are: a nucleic acid for transfection having excellent cell membrane permeability; and a method for producing the nucleic acid for transfection. The present invention is a nucleic acid for transfection in which a target nucleic acid introduced into a cell is linked to a cell membrane permeable group having a structure represented by any one of general formulae (A1) to (A4) [in the formula, R0 represents an alkyl group having 1-30 carbon atoms, which may have an ether-linkable oxygen atom between carbon atoms and may be substituted with one or more fluorine atoms; (In the formula, n11, n12, n13, and n14 are each independently an integer of 1 or more, B is a nucleic acid base, RFE is a perfluoroalkyl group having 1 to 10 carbon atoms and optionally having an ether-linkable oxygen atom between carbon atoms, na is an integer of 1 to 10, and the black spot represents a bonding site]. # imgabs0 #

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority based on Special Application No. 2022-142206 filed in Japan on September 7, 2022, Special Application No. 2023-033984 filed in Japan on March 6, 2023, Special Application No. 2023-117905 filed in Japan on July 19, 2023, and Special Application No. 2023-128179 filed in Japan on August 4, 2023, and the contents of which are cited herein. Technical Field

[0003] The present invention relates to a nucleic acid for transfection having excellent cell membrane permeability and a method for producing the same. Background Art

[0004] In recent years, nucleic acid medicines using oligonucleotides have been studied. Nucleic acid medicines have the advantages of high specificity for target molecules and few side effects. However, since the phosphodiester bond of nucleic acids is easily decomposed by nucleases, nucleic acid medicines also have the problem of stability when administered to organisms. If the stability is low, it will be decomposed in the organism before reaching the target tissue, and the target drug effect cannot be obtained. In order to improve the stability of nucleic acids, chimeric nucleic acids with artificial nucleic acids are used, and the nuclease resistance of the artificial nucleic acids is better than that of natural nucleic acids. As the artificial nucleic acid, for example, non-cyclic glycol nucleic acid (GNA), peptide nucleic acid (PNA), non-cyclic threonine nucleic acid (aTNA) and serinol nucleic acid (SNA) etc. can be cited (non-patent document 1).

[0005] In addition, the cell membrane permeability of nucleic acid medicine is low, and it is difficult to reach the target molecule present in the cell. Particularly because siRNA is double-stranded, molecular weight and negative charge are all large compared with antisense RNA, cell membrane permeability is lower than antisense RNA, and it is necessary to utilize the drug delivery of carrier. As drug delivery agent, it is known to have the delivery agent (patent documentation 1) using lipid nanoparticles, the drug delivery agent (patent documentation 2) using cationic polymer nanoparticles. However, from the efficiency of cell membrane permeability, the aspect of worrying about toxicity, it should be improved mostly.

[0006] On the other hand, it is known that compounds having a polyfluorinated structure are stable in vivo and have low toxicity, and are excellent in uptake into cells and release from endosomes (Non-patent Document 2). It is also studied to utilize this property to introduce a polyfluorinated structure into oligonucleotides or peptide nucleic acids as a portion having cell membrane permeability (Patent Documents 3 and 4, Non-patent Documents 3 to 6).

[0007] Prior art literature

[0008] Patent Literature

[0009] Patent Document 1: International Publication No. 2011 / 036557

[0010] Patent Document 2: International Publication No. 2017 / 212006

[0011] Patent Document 3: International Publication No. 2012 / 130941

[0012] Patent Document 4: International Publication No. 2021 / 060506

[0013] Patent Document 5: Japanese Patent Application Publication No. 2006-321797

[0014] Patent Document 6: International Publication No. 2000 / 056694

[0015] Non-patent literature

[0016] Non-patent literature 1: Murayama et al., Chemistry A European Journal, 2013, vol. 19, p. 14151-14158.

[0017] Non-patent literature 2: Zhang et al., MRS Communications, 2018, vol. 8, p. 303-313.

[0018] Non-patent document 3: Godeau et al., Medicinal Chemistry Communications, 2010, vol. 1. p. 76-78.

[0019] Non-patent document 4: Ellipilli et al., Chemical Communications, 2016, vol. 52, p. 521-524.

[0020] Non-patent document 5: Rochambeaua et al., Polymer Chemistry, 2016, vol. 7, p. 4998-5003.

[0021] Non-patent document 6: Metelev et al., Theranostics, 2017, vol. 7, p. 3354-3368.

[0022] Non-patent document 7: Crombez, et al., Nucleic Acids Research, 2009, vol. 37(14), p. 4559-4569. Summary of the invention

[0023] The difficulty of the nucleic acid to which the cell membrane permeable group is bonded described in Non-Patent Document 3 is that it cannot be easily synthesized by the phosphoramidite method.

[0024] Non-Patent Document 4 describes a peptide nucleic acid to which excellent cell membrane permeability is imparted by a polyfluorinated structure, but does not describe nucleic acids.

[0025] Non-patent document 5 describes nucleic acids to which a polyfluorinated structure is added, but does not involve cell membrane permeability, and a transfection reagent is used separately for intracellular introduction.

[0026] Non-patent document 6 describes nucleic acids to which a perfluorinated structure is added, but further improvement in cell membrane permeability is desired.

[0027] An object of the present invention is to provide a nucleic acid for transfection having excellent cell membrane permeability and a method for producing the same.

[0028] The present inventors have discovered that by introducing an alkyl group that can be substituted with a fluorine atom into the side chain of an acyclic threonine alcohol-type nucleic acid (aTNA-type nucleic acid), or by replacing the nucleoside portion of a phosphoramidite with an organic group containing an ether bond-containing perfluoroalkyl group as a cell membrane permeable group, and linking the cell membrane permeable group to a target siRNA to be introduced into a cell, the cell membrane permeability of the siRNA can be improved, and the siRNA can be introduced into a cell even without using a transfection reagent in combination, thereby completing the present invention.

[0029] That is, the present invention is as follows.

[0030] [1] A nucleic acid for transfection, wherein the nucleic acid to be introduced into a cell is linked to a cell membrane permeable group,

[0031] The cell membrane permeable group is a structure represented by any one of the following general formulae (A1) to (A4),

[0032]

[0033] [In formulas (A1) to (A3), R 0 is an alkyl group having 1 to 30 carbon atoms substituted by one or more fluorine atoms, a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of an alkyl group having 2 to 30 carbon atoms substituted by one or more fluorine atoms, an alkyl group having 10 to 30 carbon atoms not substituted by fluorine atoms, or a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of an alkyl group having 10 to 30 carbon atoms not substituted by fluorine atoms, n11, n12 and n13 are each independently an integer greater than 1, B is a nucleic acid base, and a black dot indicates a bonding site],

[0034]

[0035] [In formula (A4), R FE It is a perfluoroalkyl group having 1 to 10 carbon atoms and oxygen atoms without ether bonds between carbon atoms, or a perfluoroalkyl group having 2 to 10 carbon atoms and oxygen atoms with 1 to 5 ether bonds between carbon atoms, na is an integer of 1 to 10, n14 is an integer greater than 1, and black dots represent bonding sites].

[0036] [2] The nucleic acid for transfection according to [1] above, wherein the target nucleic acid to be introduced into the cells is siRNA.

[0037] [3] The nucleic acid for transfection according to [1] or [2], wherein the R 0 It is an alkyl group having 1 to 30 carbon atoms substituted with at least 2 fluorine atoms.

[0038] [4] The nucleic acid for transfection according to [1] or [2], wherein the R 0 It is a perfluoroalkyl group having 1 to 10 carbon atoms, or a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of a perfluoroalkyl group having 1 to 10 carbon atoms.

[0039] [5] The nucleic acid for transfection according to [1] or [2], wherein the R 0 It is an alkyl group having 10 to 30 carbon atoms which is not substituted by a fluorine atom, or a group having 1 to 5 oxygen atoms in an ether-bonded state between carbon atoms of an alkyl group having 10 to 30 carbon atoms which is not substituted by a fluorine atom.

[0040] [6] The nucleic acid for transfection according to any one of [1] to [5], wherein the n11 is 2 or more, the n12 is 2 or more, the n13 is 2 or more, and the n14 is 2 or more.

[0041] [7] A method for nucleic acid transfection, comprising contacting the nucleic acid for transfection described in [1] to [6] above with a cell and introducing the nucleic acid into the cell.

[0042] [8] A method for producing siRNA that improves cell membrane permeability, comprising: linking a cell membrane permeable group to siRNA to produce siRNA that improves cell membrane permeability,

[0043] The cell membrane permeable group is a structure of the following general formula (A1), (A2) or (A3),

[0044]

[0045] [In formulas (A1) to (A3), R 0is an alkyl group having 1 to 30 carbon atoms substituted by one or more fluorine atoms, a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of an alkyl group having 2 to 30 carbon atoms substituted by one or more fluorine atoms, an alkyl group having 10 to 30 carbon atoms not substituted by fluorine atoms, or a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of an alkyl group having 10 to 30 carbon atoms not substituted by fluorine atoms, n11, n12 and n13 are each independently an integer greater than 1, B is a nucleic acid base, and a black dot indicates a bonding site],

[0046] The production method comprises the step of directly or indirectly linking the cell membrane permeable group to the sense strand of the siRNA by a phosphoramidite method using the phosphoramidite having the cell membrane permeable group as a raw material.

[0047] [9] An anticancer agent comprising as an active ingredient a molecule in which an siRNA targeting an oncogene is directly or indirectly linked to a cell membrane permeable group,

[0048] The cell membrane permeable group is a structure represented by any one of the following general formulae (A1) to (A4),

[0049]

[0050] [In formulas (A1) to (A3), R 0 is an alkyl group having 1 to 30 carbon atoms substituted by one or more fluorine atoms, a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of an alkyl group having 2 to 30 carbon atoms substituted by one or more fluorine atoms, an alkyl group having 10 to 30 carbon atoms not substituted by fluorine atoms, or a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of an alkyl group having 10 to 30 carbon atoms not substituted by fluorine atoms, n11, n12 and n13 are each independently an integer greater than 1, B is a nucleic acid base, and a black dot indicates a bonding site],

[0051]

[0052] [In formula (A4), R FE It is a perfluoroalkyl group having 1 to 10 carbon atoms and oxygen atoms without ether bonds between carbon atoms, or a perfluoroalkyl group having 2 to 10 carbon atoms and oxygen atoms with 1 to 5 ether bonds between carbon atoms, na is an integer of 1 to 10, n14 is an integer greater than 1, and black dots represent bonding sites].

[0053] The nucleic acid for transfection according to the present invention has a specific structure with excellent cell membrane permeability and thus has excellent cell membrane permeability, and even siRNA can be introduced into cells without using other transfection reagents in combination.

[0054] Furthermore, by using the nucleic acid for transfection according to the present invention for siRNA, which is an active ingredient of an anticancer agent, an anticancer agent with better efficacy can be produced. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 This is a graph showing the distribution of fluorescence intensity at each culture time of cells that have taken up the fluorine-added nucleic acid (PFC-ssDNA-FAM) modified with N[C8-PFC] at the 5' end and the control nucleic acid (ssDNA-FAM) in Example 1.

[0056] Figure 2 This is a diagram schematically showing the structures of a control nucleic acid (ssDNA-FAM) synthesized in Example 6 and a nucleic acid (AM-ssDNA-FAM) having the phosphoramidite synthesized in the synthesis example linked to its 5' end.

[0057] Figure 3 This is a graph showing the relative fluorescence intensity of cells that have taken up AM-ssDNA-FAM and a control nucleic acid (ssDNA-FAM) in Example 6, respectively.

[0058] Figure 4 This is a graph showing the relative fluorescence intensity of cells that have taken up AM-ssDNA-FAM and a control nucleic acid (ssDNA-FAM) at 4°C or 37°C in Example 6, respectively.

[0059] Figure 5 The graph shows the relative fluorescence intensity of cells that have taken up siRNA containing D-aTNA-N4[FC10])-Luc sense-FAM (A2-ssRNA-FAM) and siRNA containing Luc sense-FAM (ssRNA-FAM) at 37°C in Example 11.

[0060] Figure 6 This is a graph showing the results of measuring the relative luciferase expression levels of cells that have taken up each siRNA in Example 11.

[0061] Figure 7 This is a graph showing the results of measuring the relative luciferase expression levels of cells that have taken up each siRNA in the presence of chloroquine in Example 11.

[0062] Figure 8 This is a graph showing the relative fluorescence intensity of cells that have taken up fluorine-added nucleic acid (D-aTNA-N2[FC10]) in the presence of various inhibitors in Example 12. DETAILED DESCRIPTION

[0063] In the present invention and the specification of this application, "nucleic acid" refers to a molecule formed by phosphodiester bonding of nucleotides. The nucleotides include not only natural nucleotides such as DNA and RNA (naturally occurring nucleotides), but also artificial nucleotides that are modified from natural nucleotides and can form phosphodiester bonds with natural nucleotides. Examples of artificial nucleotides include artificial nucleotides in which the side chains of natural nucleotides are modified with functional groups such as amino groups, artificial nucleotides in which the 2'-hydroxyl group of the ribose backbone is substituted with a methoxy group, a fluoro group, a methoxyethyl group, etc., phosphorothioate nucleotides (nucleotides in which the oxygen atom of the phosphate group is substituted with a sulfur atom), morpholino nucleotides (nucleotides in which ribose and deoxyribose are substituted with a morpholine ring), BNA (Bridged Nucleic Acid), HNA (Hexitol Nucleic Acid), LNA (Locked Nucleic Acid), PNA (Peptide Nucleic Acid), TNA (Threose Nucleic Acid), GNA (Glycerol Nucleic Acid), CeNA (Cyclohexenyl Nucleic Acid), and the like. In addition, "nucleic acid" also includes any of the following molecules: molecules formed by phosphodiester bonding of only one or more natural nucleotides such as DNA and RNA, molecules formed by phosphodiester bonding of one or more natural nucleotides and one or more artificial nucleotides, and molecules formed by phosphodiester bonding of only one or more artificial nucleotides.

[0064] In the present invention and the specification of this application, “C p1-p2 "(p1 and p2 are positive integers satisfying p1<p2) refers to a group having a carbon atom number of p1~p2.

[0065] In the present invention and the specification of this application, “C 1-30 "Alkyl" refers to an alkyl group having 1 to 30 carbon atoms, which may be a straight chain or a branched chain. 2-30 "Alkyl" refers to an alkyl group having 2 to 30 carbon atoms, which may be a straight chain or a branched chain. 1-30Examples of the alkyl group include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, tert-pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl, octadecyl, nonadecyl, eicosyl, heneicosyl, docosyl, tricosyl, tetracosyl, pentacosyl, hexacosyl, heptacosyl, octacosyl, nonacosyl, triacontyl and the like.

[0066] In the present invention and the specification of this application, “C 1-20 "Alkyl" refers to an alkyl group having 1 to 20 carbon atoms, which may be a straight chain or a branched chain. 2-20 "Alkyl" refers to an alkyl group having 2 to 20 carbon atoms, which may be a straight chain or a branched chain. 1-20 Examples of the alkyl group include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, tert-pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl, octadecyl, nonadecyl, and eicosyl.

[0067] In the present invention and the specification of this application, “C 1-10 "Alkyl" refers to an alkyl group having 1 to 10 carbon atoms, which may be a straight chain or a branched chain. 2-10 "Alkyl" refers to an alkyl group having 2 to 10 carbon atoms, which may be a straight chain or a branched chain. 1-10 Examples of the alkyl group include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, tert-pentyl, hexyl, heptyl, octyl, nonyl and decyl.

[0068] In the present invention and the specification of this application, “C 10-30 "Alkyl" refers to an alkyl group having 10 to 30 carbon atoms, which may be a straight chain or a branched chain. 10-30 Examples of the alkyl group include undecyl, dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl, octadecyl, nonadecyl, eicosyl, heneicosyl, docosyl, tricosyl, tetracosyl, pentacosyl, hexacosyl, heptacosyl, octacosyl, nonacosyl, triacontyl and the like.

[0069] In the present invention and the specification of this application, “C 1-6 "Alkyl" refers to an alkyl group having 1 to 6 carbon atoms, which may be a straight chain or a branched chain. 1-6Examples of the alkyl group include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, tert-pentyl and hexyl.

[0070] In the present invention and the specification of this application, an "alkylene group" is a divalent group obtained by removing two hydrogen atoms from a saturated hydrocarbon, and may be a linear or branched group. Examples of the alkylene group include methylene, ethylene, trimethylene, tetramethylene, pentamethylene, hexamethylene, heptamethylene, octamethylene, nonamethylene, methylmethylene, ethylmethylene, methylethylene, methylpropylene, ethylethylene, dimethylmethylene, 1,2-dimethylethylene, 1,1-dimethylethylene, 1-ethylpropylene, 2-ethylpropylene, 1,2-dimethylpropylene, 2,2-dimethylpropylene, 1-propylpropylene, 2-propylpropylene, 1-methyl-1-ethylpropylene, 1-methyl-2-ethyl-propylene, 1-ethyl-2-methyl-propylene, 2-methyl-2-ethyl-propylene, 1-methylbutylene, 2-methylbutylene, 3-methylbutylene, 2-ethylbutylene, 1-methylpentylene, 2-ethylpentylene, and 1-methylhexylene.

[0071] In the present invention and the specification of this application, “C 1-20 A "perfluoroalkyl group" is a group in which all hydrogen atoms of an alkyl group having 1 to 20 carbon atoms are substituted with fluorine atoms. 1-20 Examples of perfluoroalkyl groups include perfluoromethyl, perfluoroethyl, perfluoropropyl, perfluoroisopropyl, perfluorobutyl, perfluoroisobutyl, perfluorosec-butyl, perfluorotert-butyl, perfluoropentyl, perfluoroisopentyl, perfluoroneopentyl, perfluorotert-pentyl, perfluorohexyl, perfluoroheptyl, perfluorooctyl, perfluorononyl, perfluorodecyl, perfluoroundecyl, perfluorododecyl, perfluorotridecyl, perfluorotetradecyl, perfluoropentadecyl, perfluorohexadecyl, perfluoroheptadecyl, perfluorooctadecyl, perfluorononadecyl, and perfluoroeicosyl.

[0072] In the present invention and the specification of the present application, "perfluoroalkylene" is a group in which all hydrogen atoms of an alkylene group are substituted with fluorine atoms. Examples of perfluoroalkylene include groups in which all hydrogen atoms of the above-mentioned alkylene groups are substituted with fluorine atoms.

[0073] In the present invention and the specification of this application, "ether-bonded oxygen atoms" refer to oxygen atoms connecting carbon atoms, and do not include oxygen atoms connected in series. The maximum number of ether-bonded oxygen atoms that an alkyl group having Nc carbon atoms (Nc is an integer greater than 2) can have is Nc-1. 2-10 "Alkyl" refers to 2-10An alkyl group having at least one oxygen atom with an ether bond between carbon atoms. Hereinafter, an "alkyl group having an oxygen atom with an ether bond between carbon atoms" may be referred to as an "alkyl group containing an ether bond".

[0074] In the present invention and the specification of this application, "C 2-10 "Perfluoroalkyl" refers to 2-10 The alkyl group has at least one ether-bonded oxygen atom between carbon atoms. 2-10 A group in which all hydrogen atoms of an alkyl group are substituted with fluorine atoms. Hereinafter, a "perfluoroalkyl group having an oxygen atom having an ether bond between carbon atoms" may be referred to as a "perfluoroalkyl group containing an ether bond".

[0075] In the present invention and the specification of this application, "halogen atom" refers to a fluorine atom, a chlorine atom, a bromine atom or an iodine atom. "Halogen atom other than fluorine atom" refers to a chlorine atom, a bromine atom or an iodine atom. As examples of "halogen atom other than fluorine atom", a chlorine atom or a bromine atom is preferred, and a chlorine atom is particularly preferred.

[0076] In the following, "compound (n)" means a compound represented by formula (n).

[0077] The nucleic acid for transfection involved in the present invention is a nucleic acid in which the target nucleic acid (introduction target nucleic acid) introduced into the cell is connected to a cell membrane permeable group. The cell membrane permeability of the introduced target nucleic acid is usually low, but by connecting with a cell membrane permeable group, the cell membrane permeability can be significantly improved. Therefore, the nucleic acid for transfection involved in the present invention can be introduced into the cell only by contacting the surface of the cell without using other transfection reagents.

[0078] In the present invention and the specification of this application, a "cell membrane permeable group" refers to a group that increases the cell membrane permeability of a nucleic acid by addition to the nucleic acid. Specifically, it has a structure represented by any one of the following general formulas (A1) to (A4). It should be noted that, hereinafter, "the structure represented by general formula (A1)" is sometimes referred to as "structure (A1)", "the structure represented by general formula (A2)" is sometimes referred to as "structure (A2)", "the structure represented by general formula (A3)" is sometimes referred to as "structure (A3)", and "the structure represented by general formula (A4)" is sometimes referred to as "structure (A4)".

[0079]

[0080] In the general formulas (A1) to (A3), R 0 is C substituted with at least one fluorine atom 1-30 Alkyl (C 1-30 fluoroalkyl), or C 10-30When the number of carbon atoms of the alkyl group is 2 or more, the alkyl group may have 1 to 5 oxygen atoms with ether bonds between the carbon atoms. 1-30 "Fluoroalkyl group (when the number of carbon atoms of the alkyl group is 2 or more, the alkyl group may have 1 to 5 oxygen atoms of ether bond nature between carbon atoms)" means "C 1-30 Fluoroalkyl, or in C 2-30 A fluoroalkyl group having 1 to 5 oxygen atoms with ether bonds between carbon atoms.

[0081] R 0 C 1-30 In the case of a fluoroalkyl group, one or more hydrogen atoms bonded to the carbon atom may be further substituted with a halogen atom other than a fluorine atom. 0 Preferably, C is substituted with at least two fluorine atoms. 1-30 Fluoroalkyl. 0 , preferably C 1-20 Fluoroalkyl, more preferably C 1-15 Fluoroalkyl, more preferably C 2-15 Fluoroalkyl, more preferably C 6-10 Fluoroalkyl. 0 C 1-30 In the case of a fluoroalkyl group, the number of hydrogen atoms substituted with fluorine atoms is not particularly limited as long as it is 1 or more, and is, for example, preferably 3 or more, more preferably 6 or more, and even more preferably 7 or more.

[0082] R 0 C 1-30 When fluoroalkyl is present, as R 0 Specifically, the group represented by the following general formula (f-1) or (f-2) is preferred. P For fully halogenated C 1-20 Alkyl (C 1-20 A group having one or more fluorine atoms in an alkyl group (a group in which all hydrogen atoms of the alkyl group are replaced by halogen atoms). P When the number of carbon atoms is 2 or more, it is completely halogenated. 2-20 In the case of an alkyl group, 1 to 5 oxygen atoms having ether bonds between carbon atoms may be present. In the present invention and the specification of this application, "a fully halogenated C 2-20 "Alkyl" refers to "fully halogenated C 2-20 Alkyl, or in the case of fully halogenated C 2-20 An alkyl group having 1 to 5 ether-bonded oxygen atoms between carbon atoms.

[0083] In the general formula (f-2), two Rf PThey may be the same type of groups or different types of groups. P , preferably C 1-20 Perfluoroalkyl (C 1-20 A group in which all hydrogen atoms of the alkyl group are replaced by fluorine atoms).

[0084] In the following general formula (f-1) or (f-2), n1 is an integer of 0 to 10, and n2 is an integer of 0 to 9. When n1 and n2 are 0, they both represent a single bond. That is, when n1 is 0, the group represented by the general formula (f-1) is -Rf P When n2 is 0, the group represented by the general formula (f-2) is -CH(Rf P )2.

[0085]

[0086] R 0 When it is a group represented by the general formula (f-1), R 0 Preferred Rf P is trifluoromethyl, pentafluoroethyl, heptafluoropropyl, nonafluorobutyl, perfluoropentyl, perfluorohexyl, perfluoroheptyl, perfluorooctyl, perfluorononyl or perfluorodecyl, and n1 is an integer of 0 to 4, and more preferably Rf P is trifluoromethyl, pentafluoroethyl, heptafluoropropyl, nonafluorobutyl, perfluoropentyl, perfluorohexyl, perfluoroheptyl, perfluorooctyl, perfluorononyl or perfluorodecyl, and n1 is an integer of 0 to 2, and Rf is more preferably P A group in which n1 is an integer of 0 to 2 (excluding groups in which n1 is 1 and Rf P is a trifluoromethyl group), and further preferably Rf P A group which is pentafluoroethyl, heptafluoropropyl, nonafluorobutyl, perfluoropentyl, perfluorohexyl, perfluoroheptyl, perfluorooctyl, perfluorononyl or perfluorodecyl, and n1 is 0.

[0087] R 0 When it is a group represented by the general formula (f-2), R 0 Preferred Rf P is trifluoromethyl, pentafluoroethyl, heptafluoropropyl, nonafluorobutyl, perfluoropentyl, perfluorohexyl, perfluoroheptyl, perfluorooctyl, perfluorononyl or perfluorodecyl, and n2 is an integer of 0 to 4, and more preferably Rf P is trifluoromethyl, pentafluoroethyl, heptafluoropropyl, nonafluorobutyl, perfluoropentyl, perfluorohexyl, perfluoroheptyl, perfluorooctyl, perfluorononyl or perfluorodecyl, and n2 is an integer of 0 to 2, and Rf is more preferably PA group in which n2 is an integer of 0 to 2 (excluding groups in which n2 is 0 or 1 and Rf P is a trifluoromethyl group), and further preferably Rf P The group is pentafluoroethyl, heptafluoropropyl, nonafluorobutyl, perfluoropentyl, perfluorohexyl, and n2 is 0.

[0088] R 0 C 1-30 When fluoroalkyl is present, as R 0 , trifluoromethyl, pentafluoroethyl, heptafluoropropyl, nonafluorobutyl, perfluoropentyl, perfluorohexyl, perfluoroheptyl, perfluorooctyl, perfluorononyl, perfluorodecyl, difluoromethyl, 1,1-difluoroethyl, 2,2-difluoroethyl, 1,1,2,2-tetrafluoroethyl, 1,1,2,2,3,3-hexafluoropropyl, 1,1,2,3,3,3-hexafluoropropyl, 1,1,2,2,3,3-hexafluorohexyl, 1,1,2,2,3,3-hexafluorooctyl, 1,1,2,2,3,3-hexafluorodecyl, 1,1,2,2,3,3-hexafluorooctadecyl, 1,1,2,2,3,3-hexafluorohexacosyl, etc. are mentioned. The nucleic acid for transfection involved in the present invention preferably has R in the general formula (A1), the general formula (A2) or the general formula (A3): 0 C 1-30 A nucleic acid having a perfluoroalkyl structure, more preferably having R in the general formula (A1)), the general formula (A2) or the general formula (A3) 0 C 1-20 A nucleic acid having a perfluoroalkyl structure, preferably having R in the general formula (A1), the general formula (A2) or the general formula (A3) 0 C 1-10 The structure of perfluoroalkyl nucleic acids.

[0089] R 0 C 10-30 When alkyl is structure (A1), structure (A2) or structure (A3), R 0 Preferably C 10-25 Alkyl, more preferably C 15-25 Alkyl, more preferably C 15-23 Alkyl group: A sufficiently long alkyl group has high hydrophobicity like a fluoroalkyl group, and contributes to the cell membrane permeability of the nucleic acid having structure (A1), structure (A2) or structure (A3).

[0090] In general formula (A3), B is a nucleic acid base. As a nucleic acid base, preferably a nucleic acid base possessed by a natural nucleic acid, a nucleic acid base similar to a natural nucleic acid base structure, and a modified base to which these bases are subjected to various modifications. As a modification of a base, alkylation, hydroxylation, alkoxylation, acylation, dihydrogenation, amination, formylation, halogenation, etc. can be enumerated. As a nucleic acid base similar to a natural nucleic acid base structure, triazole, imidazole, azapyrimidine, azapurine, etc. can be enumerated. Specific examples of the nucleic acid base of B include adenine, guanine, cytosine, thymine, uracil, 1-methyladenine, N6-methyladenine, 7-methylguanine, 5-methylcytosine, 1-methylthymine, 5-methyluracil, 5-hydroxymethylcytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, dihydrouracil, dihydrothymine, dihydrocytosine, 2,6-diaminoadenine, 2 , 6-diaminoguanine, 6-thioguanine, 2-thioadenine, 2-thiocytosine, 4-thiouracil, 5-fluorouracil, 5-iodouracil, 5-halocytosine, 5-fluorocytosine, 5-trihalomethyluracil, 5-trifluoromethyluracil, 5-azathymine, 5-azacytosine, 6-azauracil, 8-azaadenine, 7-deazaadenine, 7-deazaguanine, 3-deazauracil, etc. As the nucleic acid for transfection involved in the present invention, a nucleic acid having a structure in which B is adenine, guanine, cytosine, thymine or uracil in the general formula (A3) is preferred.

[0091] In the general formulas (A1) to (A3), n11, n12 and n13 are each independently an integer greater than 1. n11, n12 and n13 are the number of repetitions of each molecule of each structure, and the larger the number, the higher the hydrophobicity. As a result, the cell membrane permeability of the nucleic acid becomes better. As the nucleic acid for transfection involved in the present invention, n11, n12 and n13 are preferably greater than 2, and more preferably greater than 5. In addition, from the perspective of easily obtaining a structure similar to a natural double-stranded nucleic acid or single-stranded nucleic acid, n11, n12 and n13 are preferably less than 10, more preferably less than 8, and further preferably less than 6. When n11, n12 and n13 are greater than 2, the presence of multiple structures (A1), structures (A2) or structures (A3) may be the same as each other or may be different structures.

[0092] When the nucleic acid having structure (A1), structure (A2) or structure (A3) is introduced into a double helix structure of DNA, R 0 The base is exposed on the outside of the helical structure, which can form a stable double helical structure, and the exposed R 0The group improves cell membrane permeability. In addition, since the nucleic acid introduced with structure (A1), structure (A2) or structure (A3) does not contain a nitrogen atom in the chain composed of the phosphate group of the nucleic acid and the phosphodiester bond of the sugar, the intermediate during synthesis by the phosphoramidite method is relatively stable and the synthesis is also easy.

[0093]

[0094] In the general formula (A4), R FE C is an oxygen atom without an ether bond between carbon atoms. 1-10 A perfluoroalkyl group or a C having 1 to 5 oxygen atoms with ether bonds between carbon atoms 2-10 Perfluoroalkyl (C 2-10 In the general formula (A4), na is an integer of 1 to 10.

[0095] R FE C is an oxygen atom without an ether bond between carbon atoms. 1-10 In the case of a perfluoroalkyl group, the group may be linear or branched. 1-10 The perfluoroalkyl group can exert sufficient cell membrane permeability and can also suppress toxicity to cells. As the structure (A4) possessed by the nucleic acid for transfection involved in the present invention, a linear C 2-10 Perfluoroalkyl, preferably linear C 3-10 Perfluoroalkyl, preferably linear C 4-10 Perfluoroalkyl.

[0096] R FE C containing ether-bonded oxygen 2-10 In the case of a perfluoroalkyl group, the group is preferably a group represented by any one of the following general formulae (F1) to (F3), for example.

[0097] -R F1 -OR F2 (F1)

[0098] -R F3 -(O-CF2-CF2-)n1-0-R F4 (F2)

[0099] -R F5 -(O-CF2-CF2-CF2-)n2-OR F6 (F3)

[0100] In the general formula (F1), R F1 is a perfluoroalkylene group having q1 carbon atoms, R F2 The perfluoroalkyl group has q2 carbon atoms. The sum of q1 and q2 is a natural number of 2 to 10.

[0101] In the general formula (F2), R F3 is a perfluoroalkylene group having q3 carbon atoms, R F4 It is a perfluoroalkyl group having q4 carbon atoms. n1, q3 and q4 are natural numbers (2×n1+q3+q4) of 4 to 10.

[0102] In the general formula (F3), R F5 is a perfluoroalkylene group having q5 carbon atoms, R F6 It is a perfluoroalkyl group having q6 carbon atoms. n2, q5 and q6 are natural numbers of 5 to 10 (3×n2+q5+q6).

[0103] As R in the general formula (F1) F1 , R in the general formula (F2) F3 and R in the general formula (F3) F5 , may be a linear perfluoroalkylene group or a branched perfluoroalkylene group. F1 , R F3 and R F5 , preferably C 1-3 The perfluoroalkylene group is more preferably a group in which all the hydrogen atoms of a methylene group, an ethylene group, a methylmethylene group, an ethylmethylene group, a dimethylmethylene group or a methylethylene group are substituted with fluorine atoms; further preferably a group in which all the hydrogen atoms of a methylene group, a methylmethylene group, an ethylmethylene group or a dimethylmethylene group are substituted with fluorine atoms; further preferably a group in which all the hydrogen atoms of a methylene group or a methylmethylene group are substituted with fluorine atoms.

[0104] As R in the general formula (F1) F2 , R in the general formula (F2) F4 and R in the general formula (F3) F6 , may be a linear perfluoroalkyl group or a branched perfluoroalkyl group. F2 , R F4 and R F6 , preferably a linear or branched C 1-5 Perfluoroalkyl, more preferably linear C 1-5 Perfluoroalkyl, preferably linear C 2-4 Perfluoroalkyl.

[0105] In the present invention, as the perfluoroalkyl group containing an ether bond introduced into the nucleic acid, for example, the perfluoroalkyl group containing an ether bond possessed by the fluorine compound described together with the synthesis method thereof in Patent Document 5 or 6 can be used.

[0106] In the general formula (A4), n14 is an integer greater than 1. n14 is the number of repetitions of each molecule of structure (A4). The larger the number, the higher the hydrophobicity, and the better the cell membrane permeability of the nucleic acid. As the nucleic acid for transfection involved in the present invention, n14 is preferably greater than 2, and more preferably greater than 5. In addition, from the perspective of easily obtaining a structure similar to a natural double-stranded nucleic acid or single-stranded nucleic acid, n14 is preferably less than 10, more preferably less than 8, and further preferably less than 6. When n14 is greater than 2, multiple structures (A4) may be the same as each other or may be different structures.

[0107] When the nucleic acid for transfection involved in the present invention has two or more cell membrane permeable groups per molecule, the multiple cell membrane permeable groups may be groups of the same type or groups of different types. For example, the nucleic acid for transfection involved in the present invention may have structure (A1) and structure (A2), may have structure (A1) and structure (A3), may have structure (A1) and structure (A4), may have structure (A2) and structure (A3), may have structure (A2) and structure (A4), may have structure (A3) and structure (A4), may have structure (A1), structure (A3) and structure (A4), may have structure (A1), structure (A2) and structure (A4), may have structure (A1), structure (A3) and structure (A4), may have structure (A1), structure (A2) and structure (A4), may have structure (A1), structure (A3) and structure (A4), may have structure (A1), structure (A2) and structure (A3), may have structure (A2), structure (A3) and structure (A4).

[0108] In the general formulas (A1) to (A4), the black dots represent the bonding sites. As the nucleic acid for transfection involved in the present invention, any nucleic acid having any one of the structures (A1) to (A4) is sufficient. The position of introducing the structures (A1) to (A4) is not particularly limited, and can be introduced into any position within the range that does not impair the function of the nucleic acid. For example, the structures (A1) to (A4) can be directly or indirectly bonded to the 5' end or 3' end of the nucleic acid, or can be introduced between two nucleotides.

[0109] In the nucleic acid for transfection involved in the present invention, as a nucleic acid having structure (A1) or structure (A2) at the 5' end of the nucleic acid, it is preferred that the bonding site extending from the carbon atom at the end of structure (A1), structure (A2) or structure (A3) is bonded to the hydroxyl group, and the bonding site extending from the oxygen atom of the phosphate group at the end of structure (A1), structure (A2) or structure (A3) is bonded to the sugar at the 5' end of the nucleic acid. In the nucleic acid for transfection involved in the present invention, as a nucleic acid having structure (A1), structure (A2) or structure (A3) at the 3' end of the nucleic acid, it is preferred that the bonding site extending from the carbon atom at the end of structure (A1), structure (A2) or structure (A3) is bonded to the phosphate group at the 3' end of the nucleic acid, and the bonding site extending from the oxygen atom of the phosphate group at the end of structure (A1), structure (A2) or structure (A3) is bonded to the hydrogen atom.

[0110] In the nucleic acid for transfection involved in the present invention, as a nucleic acid in which structure (A1), structure (A2) or structure (A3) is introduced between two nucleotides, from the perspective of a structure closer to a natural nucleic acid, it is preferred that the bonding site extending from the carbon atom at the end of structure (A1), structure (A2) or structure (A3) is bonded to the phosphate group of another nucleotide, and the bonding site extending from the oxygen atom of the phosphate group at the end of structure (A1), structure (A2) or structure (A3) is bonded to the sugar of another nucleotide.

[0111] In the nucleic acid for transfection involved in the present invention, the cell membrane permeable group and the introduced nucleic acid can be directly connected or indirectly connected via a connecting group. As the connecting group, there is no particular limitation as long as it is a group that can connect the introduced nucleic acid and the cell membrane permeable group, and any divalent or trivalent organic group can be used. As the connecting group, for example, an alkylene group, an alkenylene group, a carbonyl group, an amino group, an ether bond, a thioether bond, an ester bond, an amide bond, a polyethylene glycol group (PEG: -(C2H4O)n-), a siloxane bond, a silyl ether bond, a sugar, a peptide, and a nucleotide chain can be cited. In addition, from a pyrrole ring, a pyrazole ring, an imidazole ring, a triazole ring, a pyridine ring, a pyrimidine ring, a pyrazine ring, A group obtained by removing two or three hydrogen atoms from a ring such as an azole ring, a thiazole ring, a furan ring, a thiophene ring, or a benzene ring can also be used as a linking group. These groups can also be used in combination as appropriate.

[0112] In the transfection nucleic acid involved in the present invention, structure (A1) to structure (A4) can be connected to the target nucleic acid through various coupling reactions. For example, by using a phosphoramidite containing structure (A1) as a raw material and performing the phosphoramidite method, structure (A1) can be easily introduced into the nucleic acid. Similarly, by using a phosphoramidite containing structure (A2), structure (A3) or structure (A4) as a raw material and performing the phosphoramidite method, structure (A2), structure (A3) or structure (A4) can be easily introduced into the nucleic acid. The general nucleic acid automatic synthesis device utilizes the phosphoramidite method. Therefore, by using a phosphoramidite containing any one of structures (A1) to (A4) as a raw material, it is possible to easily synthesize a nucleic acid of various base sequences by using an automatic synthesis device to introduce any one of structures (A1) to (A4) at the desired position.

[0113] Examples of phosphoramidites containing structure (A1), structure (A2) or structure (A3) include compounds in which a sugar and a phosphate group are linked via structure (A1) via phosphoramidites generally used for nucleic acid synthesis, or compounds in which a nucleoside portion is replaced with an organic group containing structure (A3).

[0114] Examples of the phosphoramidite having the structure (A4) include compounds represented by the following general formula (A4-0). FE and na are the same as those in the general formula (A4). i-Pr represents an isopropyl group, and DMTr represents a 4,4'-dimethoxytriphenylmethyl group.

[0115]

[0116] In addition, the cell membrane permeable group can also be introduced into the nucleic acid to be introduced by the methods described in Non-Patent Documents 3 to 6.

[0117] The synthesized target nucleic acid can be separated and purified by various methods such as ion chromatography, gel filtration chromatography, reverse phase chromatography, normal phase chromatography, etc.

[0118] As the nucleic acid for transfection involved in the present invention, there is no particular limitation as long as it is a nucleic acid for introduction into a cell. As the nucleic acid for introduction, it is preferably a functional nucleic acid that exhibits certain physiological activities by being taken into a target cell in a living body. Specifically, for example, nucleic acids for expressing proteins in cells, nucleic acids for inhibiting gene expression in cells, nucleic acids for genetic modification, nucleic acid aptamers that specifically bind to biological molecules as targets, functional nucleic acids that affect the physiological functions of cells, etc. can be cited. As nucleic acids for protein expression, for example, cDNA and mRNA encoding proteins can be cited, and expression plasmid vectors with regions encoding target proteins can be provided. As nucleic acids for gene expression inhibition, for example, functional nucleic acids for RNA interference such as siRNA, miRNA, shRNA, and antisense oligonucleotides can be cited, and RNAi vectors can be cited. As nucleic acids for genetic modification, fragments of genomic DNA can be cited. As functional nucleic acids that affect the physiological functions of cells, Decoy nucleic acids, CpG (cytosine-phosphate-guanine) oligonucleotides, etc. can be cited. In addition, the nucleic acid may be a substance obtained by linking a fluorescent substance or a functional molecule such as a functional peptide to a nucleic acid. For example, a nucleic acid molecule in which a fluorescent substance is linked to the end of a single-stranded nucleic acid having a guanine quadruplex (G-quadruplex) structure can be used as the nucleic acid to be introduced.

[0119] The nucleic acid to be introduced in the nucleic acid for transfection involved in the present invention is not particularly limited, and the nucleotides contained may be nucleic acids composed entirely of natural nucleotides, or nucleic acids composed partially or entirely of artificial nucleotides. In addition, it may be single-stranded nucleic acids, or double-stranded nucleic acids. It may be DNA, RNA, or a chimeric nucleic acid of DNA and RNA.

[0120] In the nucleic acid for transfection involved in the present invention, the position of introducing the cell membrane permeable group is not particularly limited, and it can be introduced at any position within the range that does not impair the function of the nucleic acid. For example, the cell membrane permeable group can be bonded to the 5' end or 3' end of the nucleic acid to be introduced, or it can be introduced between two nucleotides in the nucleic acid to be introduced.

[0121] The nucleic acid for transfection of the present invention may be modified in various ways as long as the cell membrane permeability brought about by the perfluoroalkyl group is not impaired and the function of the nucleic acid to be introduced is not impaired. Examples of such modifications include sugar chain modification, lipid modification, peptide modification, and the like.

[0122] The transfection nucleic acid involved in the present invention utilizes a cell membrane permeable group containing a perfluoroalkyl group, and has excellent cell membrane permeability compared to nucleic acids that do not contain the group. Therefore, the transfection nucleic acid involved in the present invention does not use a common transfection reagent such as Lipofectamine, and can be introduced into the cell only by contacting the cell. In the case of cultured cells, the target cell to which the transfection nucleic acid involved in the present invention is to be introduced can be introduced into the cell by simply adding the transfection nucleic acid to the culture medium for culturing. In addition, for animal tissues, for example, the transfection nucleic acid can be introduced into the cells constituting the tissue by spraying or applying a solution in which the transfection nucleic acid involved in the present invention is dissolved on the tissue surface. Therefore, for example, a functional nucleic acid that exhibits certain physiological activities by being taken into a target cell in a living body is used as an introduction target nucleic acid to manufacture the transfection nucleic acid involved in the present invention, which can improve the efficiency of the functional nucleic acid being taken into the target cell. That is, by using the transfection nucleic acid involved in the present invention, a drug delivery system that delivers nucleic acid medicines to cells can be easily constructed.

[0123] Structures (A1) to (A4) can improve cell membrane permeability without excessively damaging the double helical structure of the nucleic acid. Therefore, a molecule formed by linking a cell membrane permeable group composed of any of structures (A1) to (A4) to a nucleic acid for transfection, i.e., siRNA, of the present invention in which siRNA is the nucleic acid to be introduced is an siRNA with improved cell membrane permeability (siRNA that improves cell membrane permeability) to the extent that it can be introduced into target cells by transfection.

[0124] In the siRNA that improves cell membrane permeability, the siRNA and the cell membrane permeability group composed of any one of structures (A1) to (A4) can be directly connected or indirectly connected via a connecting group. The connecting group is not particularly limited, and the groups listed above can be appropriately used. The siRNA that improves cell membrane permeability can be manufactured, for example, by the phosphoramidite method using a phosphoramidite having any one of structures (A1) to (A4) as a raw material.

[0125] siRNA targeting oncogenes can be used as an effective ingredient of anticancer agents. Therefore, the molecule formed by directly or indirectly connecting a cell membrane permeable group consisting of any structure in structures (A1) to (A4) to siRNA targeting oncogenes has excellent efficiency in introducing into targeted cancer cells, and is preferably used as an effective ingredient of anticancer agents. As an oncogene, as long as it is a gene that produces abnormalities that can cause canceration of normal cells, it is not particularly limited, and Cyclin B1 gene, Src gene, ras gene, myc gene, etc. can be cited. siRNA targeting these genes can use known siRNA, or it can be designed by conventional methods from the genomic sequence of each gene.

[0126] For example, it is known that the Cyclin B1 gene is associated with esophageal squamous cell carcinoma, pharyngeal squamous cell carcinoma, colon cancer, head and neck cancer, non-small cell lung cancer, breast cancer, cervical cancer, etc., and siRNA targeting the Cyclin B1 gene can be used as an active ingredient of a pharmaceutical composition for treating or preventing these cancers. Therefore, by directly or indirectly linking a cell membrane permeable group consisting of any of structures (A1) to (A4) to siRNA targeting the Cyclin B1 gene, an anticancer agent with a better efficacy against these cancers can be produced.

[0127] Example

[0128] Hereinafter, the present invention will be described by way of examples, but the present invention is not limited to these examples.

[0129] <Cell culture>

[0130] In the following experiments, cell culture was performed as follows.

[0131] HeLa cells (Riken Cell Bank) were cultured in a humidified atmosphere (5% CO2) at 37°C using low-glucose Dulbecco's modified Eagle's medium (DMEM, manufactured by FUJIFILM Wako) supplemented with 10% FBS and a 0.5% penicillin-streptomycin mixed solution as a culture medium.

[0132] 24 hours before the introduction of nucleic acid into cells, the cells were plated at a concentration of 1.0×10 4 The cells were seeded in a 96-well culture plate (manufactured by VIOLAMO) in a cell / well format and allowed to adhere to the plate and grow (pre-culture).

[0133] <DNA synthesis>

[0134] DNA synthesis was performed using commercially available reagents, various phosphoramidites (acetonitrile solution, 0.1 M), and 5-ethylthio-1H-tetrazole (acetonitrile solution, 0.25 M) as an activator, using NTS H-8 DNA / RNA synthesizer (manufactured by NIHON TECHNO SERVICE).

[0135] [Synthesis example 1]

[0136] Synthesis of perfluoroalkyl groups containing 8 carbon atoms (C8F 17 -: hereinafter referred to as C8-PFC group), and using the phosphoramidite, a nucleic acid containing a C8-PFC group was produced by the phosphoramidite method.

[0137] <Synthesis of phosphoramidites containing C8-PFC groups>

[0138] The phosphoramidite containing a C8-PFC group (N[C8-PFC]phosphoramidite) represented by the following formula was synthesized by the method described in Non-Patent Document 5.

[0139]

[0140] [Synthesis example 2]

[0141] Synthetic R 0 In the group represented by the general formula (f-1), n1 is 2 and Rf P A nucleic acid of structure (A1) which is a perfluorohexyl group.

[0142] R 0 In the group represented by the general formula (f-1), n1 is 2 and Rf P The phosphoramidite of structure (A1) (D-aTNA-N[FC8]) which is a perfluorohexyl group was synthesized as follows.

[0143] (1) Phosphoramidite condensation

[0144]

[0145] Compound 1 (0.44 g, 0.82 mmol), PyBOP (0.43 g, 0.82 mmol) and DIPEA (0.4 mL, 2.2 equiv) dissolved in 10 mL of DMF were dissolved in 15 mL of DMF under argon, and 4,4,5,5,6,6,7,7,8,8,9,9,9-tridecafluorononanoic acid (0.23 g, 0.59 mmol, 0.7 equiv) was added to prepare a reaction solution. The obtained reaction solution was stirred at room temperature for 14 hours. Thereafter, the reaction mixture was quenched with water (45 mL) and extracted twice with hexane / ethyl acetate (4:1 (volume ratio)). The organic components were combined, washed with water, dried over Na2SO4, filtered, and the solvent was removed under vacuum. The obtained crude product was purified by silica gel column chromatography (hexane:ethyl acetate:Et3N=30:20:1 (volume ratio)) to obtain Compound 2 (0.17 g, 0.22 mmol, yield 38%).

[0146] Compound 2:

[0147] 1 H NMR (400MHz, CDCl3) δ7.39-7.21(m,9H),6.84(d,J=5.9Hz,4H),6.06(d,J=9.1Hz,1H),4.13-4.10(m,1H),3.92-3.90(m,1H),3 .78(s,6H),3.41(dd,J=11.2,5.7Hz,1H),3.33(dd,J=9.6,3.2Hz,1H),2.90(s,1H),2.53-2.44(m,4H),1.12(d,J=6.4Hz,3H).

[0148] 19 F NMR(376MHz, CDCl3)δ-80.7(s,3F),-114.4(s,2F),-121.8(s,2F),-122.8(s,2F),-123.4(s,2F),-126.0(s,2F).

[0149] (2)DMTr protection

[0150]

[0151] Under argon, compound 2 (160 mg, 0.20 mmol) dissolved in a mixed solvent of THF / acetonitrile (2 mL / 2 mL) was added dropwise to a solution of 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (93 mg, 0.31 mmol) and ETT (40 mg, 0.31 mmol) in dry acetonitrile (8 mL). After the reaction mixture was stirred at room temperature for 24 hours, the solvent was evaporated under reduced pressure. Under argon, the obtained crude product was purified by silica gel column chromatography with degassed hexane / ethyl acetate (3:1 (volume ratio)) as the mobile phase. Thus, compound 3 (DMTr-protected D-aTNA-N[FC8]) was isolated as a colorless oil (yield 38%).

[0152] Compound 3:

[0153] 1 H NMR (400MHz, CDCl3) δ7.41-7.20(m,9H),6.82-6.79(m,4H),5.94(d,9.1Hz,1H),4.37-4.32(m,1H),4.20 -4.14(m,1H),3.77(s,6H),3.55-3.45(m,4H),3.25-3.12(m,2H),2.59-2.31(m,6H),1.24-0.97(m,15H).

[0154] 19 F NMR(376MHz, CDCl3)δ-80.7(s,3F),-114.5(s,2F),-121.8(s,2F),-122.8(s,2F),-123.4(s,2F),-126.0(s,2F).

[0155] Using the synthesized D-aTNA-N[FC8], a nucleic acid having the structure shown below (D-aTNA-N1[FC8]: wherein black dots represent bonding sites) was synthesized by the phosphoramidite method in the same manner as in Synthesis Example 1.

[0156]

[0157] [Example 1]

[0158] The cellular uptake efficiency of the fluorescein-modified nucleic acids containing a C8-PFC group and the fluorescein-modified nucleic acids not containing a C8-PFC group was investigated by quantitative analysis using flow cytometry.

[0159] <Synthesis of Fluorescein-modified Nucleic Acid>

[0160] A fluorescein-modified nucleic acid (ssDNA-FAM) having fluorescein introduced into the 3' end of a single-stranded DNA (G-quadruplex DNA) consisting of sequence number 1 (5'-AGGGTTAGGGTTAGGGTT AGGG-3') was synthesized using a DNA synthesizer. Next, two molecules of the synthesized N[C8-PFC] phosphoramidite were linked to the 5' end of the obtained ssDNA-FAM by site-by-site synthesis in a glove box to obtain ssDNA-FAM (PFC-ssDNA-FAM) having a cell membrane permeable group containing two C8-PFC groups linked in series to the 5' end.

[0161]

[0162] <Preparation of sample solution>

[0163] ssDNA-FAM (control nucleic acid) and PFC-ssDNA-FAM (fluorine-added nucleic acid) were prepared in a DMEM medium (low glucose, 10% FBS, 1% penicillin-streptomycin mixed solution) at a concentration of 1.0 μM as sample solutions. A 1.0 μM solution of ssDNA-FAM was used as a negative control, and a mixture of ssDNA-FAM and a commercially available transfection reagent ("Lipofectamine LTX", manufactured by Thermo Fisher Scientific) was used as a positive control. The mixing ratio and amount of each reagent of Lipofectamine LTX followed the manufacturer's standard guidelines. The blank group was measured using a DMEM medium (low glucose, 10% FBS, 1% penicillin-streptomycin mixed solution) without the introduction of nucleic acid.

[0164] <Evaluation of cell membrane permeability using flow cytometry>

[0165] The culture medium of HeLa cells previously cultured at 37°C for 24 hours was replaced with the sample solution, and the cell membrane permeability after culture at 37°C for 1, 6 or 24 hours was evaluated. After each predetermined time of culture, the cell surface was washed three times with PBS (phosphate saline), and the cells were peeled and recovered with trypsin-EDTA 0.05% (Gibco). Next, the recovered cells were applied to flow cytometry (guava easyCyte (trademark) 8) to measure and detect the green fluorescence (488nm) of the fluorescent pigment fluorescein (FAM) introduced into the synthetic nucleic acid.

[0166] The cells without fluorescein-modified nucleic acid added to the culture medium were used as the blank group, the cells with only control nucleic acid (ssDNA-FAM) added to the culture medium were used as the negative control, and the cells with both control nucleic acid and Lipofectamine LTX added to the culture medium were used as the positive control.

[0167] The fluorescence intensity distribution of each cell at each culture time is shown in Figure 1 In the figure, "Blank" indicates the results of cells in which no fluorescein-modified nucleic acid was added to the culture medium, "Naked" indicates the results of cells in which only control nucleic acid (ssDNA-FAM) was added to the culture medium, "PFCs" indicates the results of cells in which only fluorine-added nucleic acid (PFC-ssDNA-FAM formed by linking ssDNA-FAM and two N[C8-PFC] phosphoramidite molecules) was added to the culture medium, and "Lipofectamine" indicates the results of cells in which both control nucleic acid and Lipofectamine LTX were added to the culture medium. Figure 1 As shown, at any time from 1 to 24 hours, cells to which only control nucleic acid was added to the culture medium (Naked) had the same degree of fluorescence intensity as cells to which fluorescein-modified nucleic acid was not added to the culture medium (Blank), and were almost not introduced into the cells. In addition, for cells to which control nucleic acid and Lipofectamine were added to the culture medium at the same time (Lipofectamine), introduction into the cells was confirmed, but the deviation of the fluorescence intensity of each cell was large. In contrast, the fluorescence intensity distribution of cells to which only fluorine-added nucleic acid was added to the culture medium showed a very sharp peak, and it was possible to confirm that it was efficiently introduced into almost all cells. According to these results, it is shown that nucleic acids introduced with cell membrane permeable groups containing perfluoroalkyl groups have better cell membrane permeability than general transfection reagents.

[0168] Lipofectamine is a widely used transfection reagent, but it has the following problems: the culture solution needs to be made serum-free, and the added culture medium needs to be replaced within a few hours. In addition, the solution mixture needs to be adjusted according to the number of experiments, and the permeability results caused by the experiment vary greatly. On the other hand, the transfection nucleic acid of the present invention containing a perfluoroalkyl group needs to be serum-free and does not require culture medium replacement, and it is known that it has excellent properties as a reagent for cell introduction of nucleic acids.

[0169] [Example 2]

[0170] The cell viability of the fluorine-added nucleic acid (PFC-ssDNA-FAM) synthesized using single-stranded DNA (5'-TTTTTCAGTTGACCATATA-3', sequence number 8) was determined by the MTT assay, and the cytotoxicity was determined by the LDH assay in the same manner as in Example 1. Cells to which no fluorescein-modified nucleic acid was added to the culture medium were used as a blank group, cells to which only a control nucleic acid (ssDNA-FAM) was added to the culture medium were used as a negative control, and cells to which both a control nucleic acid and Lipofectamine LTX were added to the culture medium were used as a positive control.

[0171] HeLa cells were cultured at a rate of 1.0×10 4 The cells / wells were inoculated in 96-well culture plates to adhere to the wall and propagate. After culturing for 24 hours, the fluorescein-modified nucleic acid (fluorine-added nucleic acid or control nucleic acid) was added to the culture medium in a final concentration of 1 μM and cultured for 24, 48 or 72 hours. For the cultured cells, the cell viability was determined by the MTT assay, and the cytotoxicity was determined by the LDH assay. The MTT assay uses a commercially available MTT cell count assay kit (manufactured by Nacalai Tesque) and is measured according to the guidelines. The LDH assay uses a commercially available cytotoxicity assay kit (manufactured by Dojindo) and is measured according to the guidelines.

[0172] The relative cell viability of the measurement results of the MTT assay (the cells of the blank group were set as 100%) is shown in Table 1, and the cell killing rate (%) of the measurement results of the LDH assay (([measured value of the measurement target cells] - [measured value of the blank group]) / ([measured value of the control for total cell death] - [measured value of the blank group]) × 100%) is shown in Table 2. In the table, "Blank" indicates the results of cells to which no fluorescein-modified nucleic acid was added to the culture medium, "Naked" indicates the results of cells to which only the control nucleic acid was added to the culture medium, "PFCs" indicates the results of cells to which only the fluorine-added nucleic acid was added to the culture medium, and "Lipofectamine" indicates the results of cells to which both the control nucleic acid and Lipofectamine LTX were added to the culture medium.

[0173] [Table 1]

[0174]

[0175] [Table 2]

[0176]

[0177] As shown in Table 1, in the results of the MTT assay, there was no significant difference in the relative cell viability of cells to which only fluorine-added nucleic acids were added and cells to which only control nucleic acids were added. On the other hand, as shown in Table 2, in the results of the LDH assay, when control nucleic acids and Lipofectamine LTX were added to the culture medium at the same time, the cell killing rate was about 35% in 24 and 48 hours of culture, and rose to about 55% in 72 hours of culture. In contrast, the cell killing rate of cells to which only fluorescein-modified nucleic acids were added to the culture medium was almost 0%. Based on these results, it was confirmed that the transfection nucleic acid involved in the present invention is different from the case of using Lipofectamine, and the cytotoxicity is very low.

[0178] [Example 3]

[0179] The phosphoramidite containing a C8-PFC group (N[C8-PFC] phosphoramidite) synthesized in Synthesis Example 1 was linked to siRNA targeting the CyclinB1 gene to prepare siRNA linked to structure (A4), and the knock-down efficiency was studied.

[0180] <Preparation of siRNA>

[0181] As siRNA targeting the Cyclin B1 gene, a sense strand and an antisense strand consisting of the base sequences shown in Table 3 were used (Non-Patent Document 7).

[0182] [Table 3]

[0183] Base sequence Serial Number Cyc-B1 sense GGCGAAGAUCAACAUGGCATT 2 Cyc-B1 antisense UGCCAUGUUGAUCUUCGCCTT 3

[0184] The fluorine-modified sense strand was synthesized by coupling two molecules of N[C8-PFC] phosphoramidite to the 5' end of the sense strand. The fluorine-modified sense strand and the unmodified antisense strand adjusted to 8 μM each were denatured at 95°C for 10 minutes using a buffer (0.1M NaHPO4, 0.1M NaH2PO4, 1.0M NaCl, pH 6.99), and then cooled by 5°C every 5 minutes to form a double strand, thereby obtaining fluorine-modified siRNA (C8-PFC-modified siRNA).

[0185] <Knockdown assay-1>

[0186] The culture medium of the pre-cultured HeLa cells was replaced with a siRNA solution, which was prepared by diluting the C8-PFC modified siRNA with a culture medium to a final concentration of 40 nM. As a control, the culture medium of the pre-cultured HeLa cells was replaced with a culture medium equal to the siRNA solution. After 48 hours of replacing the culture medium, RNA was extracted from each cell according to the instructions of the RNA extraction kit ("RNAiso Plus", manufactured by Takara Bio).

[0187] The total RNA obtained was used as a template, and real-time PCR was performed according to the instructions of the RT-PCR kit ("One Step SYBER PrimeScriptPLUS RT-PCR Kit", manufactured by Takara Bio) to measure the expression level (mRNA level) of the Cyclin B1 gene. As an internal standard, the expression level of the GAPDH gene, which is a housekeeping gene, was also measured. The primers were used at a final concentration of 0.2 μM, using a primer pair for Cyclin B1 gene amplification ("primer set ID CCNB1 (HA303687)", manufactured by Takara Bio) or a primer pair for GAPDH gene amplification ("primer set ID GAPDH (HA067812)", manufactured by Takara Bio).

[0188] The total RNA amount extracted from the control cells was used as a benchmark, and the knockdown efficiency was calculated based on the amount of mRNA of the Cyclin B1 gene amplified from the total RNA extracted from the siRNA-introduced cells. Specifically, the total RNA amount extracted from the control cells was graded diluted and real-time PCR was performed, and a calibration curve was prepared from the obtained amplification efficiency. The relative value of the mRNA of the Cyclin B1 gene in the siRNA-introduced cells was calculated based on the calibration curve ([the amount of mRNA of the Cyclin B1 gene in the siRNA-introduced cells] / [the amount of mRNA of the Cyclin B1 gene in the control cells]×100%). It should be noted that it was confirmed that there was no difference in the amplification efficiency of the mRNA amount of the GAPDH gene between the total RNA extracted from the control cells and the total RNA extracted from the siRNA-introduced cells.

[0189] [Table 4]

[0190] Relative value of Cyclin B1 gene mRNA [%] Control cells 100 <![CDATA[Introduction of C8-PFC modified siRNA into cells]]> 65

[0191] As shown in Table 4, it was confirmed that the expression level of Cyclin B1 gene was suppressed by more than 30% in the cells introduced with C8-PFC modified siRNA. C8-PFC modified siRNA was transfected into the target cells and functioned normally as siRNA in the cells to suppress the expression of Cyclin B1 gene.

[0192] <Knockdown assay-2>

[0193] The culture medium of the pre-cultured HeLa cells was replaced with a siRNA solution, which was prepared by diluting the C8-PFC modified siRNA with a culture medium to a final concentration of 100 nM. As a control, the culture medium of the pre-cultured HeLa cells was replaced with a culture medium equal to the siRNA solution. After 24 hours of replacing the culture medium, RNA was extracted from each cell according to the instructions of the RNA extraction kit ("RNAiso Plus", manufactured by Takara Bio).

[0194] In the same manner as in the above <Knockdown Detection Method-1>, real-time PCR was performed using the obtained total RNA as a template to measure the expression level (mRNA level) of the Cyclin B1 gene.

[0195] The total RNA amount extracted from the cells of the blank group (cells to which the fluorescein-modified nucleic acid was not added in the culture medium) was used as a benchmark, and the knockdown efficiency was calculated based on the amount of mRNA of the Cyclin B1 gene amplified from the total RNA extracted from the siRNA-introduced cells. Specifically, the total RNA amount extracted from the blank group cells was gradiently diluted and real-time PCR was performed, and a calibration curve was prepared from the obtained amplification efficiency, and the relative value of the mRNA of the Cyclin B1 gene in the siRNA-introduced cells was calculated based on the calibration curve ([the amount of mRNA of the Cyclin B1 gene in the siRNA-introduced cells] / [the amount of mRNA of the Cyclin B1 gene in the blank group cells]×100%). It should be noted that it was confirmed that there was no difference in the amplification efficiency of the mRNA amount of the GAPDH gene between the total RNA extracted from the blank group cells and the total RNA extracted from the siRNA-introduced cells.

[0196] As a control, C8-PFC modified siRNA consisting of the base sequences shown in Table 5 and not targeting siRNA and Cyclin B1 (scramble sequence) was introduced for comparison.

[0197] [Table 5]

[0198] Base sequence Serial Number scramble sense CGGAAGAGUAACUCACGGATT 4 scramble antisense UCCGUGAGUUACUCUUCCGTT 5

[0199] As shown in Table 6, in cells into which C8-PFC modified siRNA was introduced, the expression of Cyclin B1 gene was also suppressed by about 30% (n=3). Based on these results, it was confirmed that C8-PFC modified siRNA was transfected into target cells and functioned normally as siRNA in the cells to suppress the expression of Cyclin B1 gene.

[0200] [Table 6]

[0201]

[0202] [Example 4]

[0203] By performing the same nucleic acid synthesis reaction as in Example 1, except that the D-aTNA-N1[FC8] phosphoramidite synthesized in Synthesis Example 2 is used instead of the N[C8-PFC] phosphoramidite synthesized in Synthesis Example 1, a fluorescein-modified nucleic acid (A1-ssDNA-FAM) having a cell membrane permeable group containing structure (A1) connected in series can be synthesized.

[0204] <Evaluation of cell membrane permeability using flow cytometry>

[0205] In the same manner as in Example 1, HeLa cells cultured at 37°C for 24 hours were cultured in a medium containing A1-ssDNA-FAM and the recovered cells were used for flow cytometry. Figure 1 The cells to which PFC-ssDNA-FAM was added to the culture medium also obtained a fluorescence intensity distribution showing a very sharp peak. This fluorescence intensity distribution indicates that A1-ssDNA-FAM was efficiently introduced into the cells.

[0206] <Knockdown assay>

[0207] By performing the same nucleic acid synthesis reaction as in Example 2 except that D-aTNA-N1[FC8] phosphoramidite synthesized in Synthesis Example 2 was used instead of N[C8-PFC] phosphoramidite, a fluorine-modified siRNA (A1-modified siRNA) modified with a cell membrane permeable group containing structure (A1) was obtained. Cells introduced with A1-modified siRNA can suppress the expression of the Cyclin B1 gene in the same manner as cells introduced with C8-PFC-modified siRNA.

[0208] [Synthesis example 3]

[0209] Synthetic R 0 In the group represented by the general formula (f-1), n1 is 2 and Rf P A nucleic acid of structure (A2) which is a perfluorohexyl group.

[0210] R 0 In the group represented by the general formula (f-1), n1 is 2 and Rf P The phosphoramidite of structure (A2) which is a perfluorohexyl group (L-aTNA-N[FC8]) was synthesized as follows.

[0211] (1) Amide condensation

[0212]

[0213] DIPEA (1.2 mL, 2.2 equiv) and compound 4 (0.32 g, 3.0 mmol) were added to 4,4,5,5,6,6,7,7,8,8,9,9,9-tridecafluorononanoic acid (0.96 g, 2.4 mmol, 0.8 equiv) and PyBOP (1.6 g, 3.0 mmol) dissolved in 18 mL of DMF, and a reaction solution was prepared under argon. The resulting reaction solution was stirred at room temperature for 19 hours. Thereafter, the reaction mixture was quenched with water (45 mL) and extracted twice with hexane / ethyl acetate (3:7 (volume ratio)). The organic components were combined, washed with water, dried with Na2SO4, filtered, and the solvent was removed under vacuum. The crude product was purified by silica gel column chromatography (hexane: ethyl acetate = 20:30 (volume ratio)) to give compound 5 (0.85 g, 2.4 mmol, yield 60%).

[0214] Compound 5:

[0215] 1 H NMR(400MHz,ACETONE-D6)δ4.06(qd,J=6.4,2.7Hz,1H),3.81(tt,J=8.8,2.9Hz,1H),3.65-3.57(m,2H),2.69-2.50(m,4H),1.11(d,J=6.4Hz,3H)

[0216] 19 F NMR(376MHz,ACETONE-D6)δ-81.6(s,3F),-114.8(s,2F),-122.3(s,2F),-123.3(s,2F),-124.0(s,2F),-126.7(s,2F)

[0217] (2)DMTr protection

[0218]

[0219] Compound 5 (0.38 g, 0.79 mmol, 1.0 eq) was dissolved in 3.0 mL of anhydrous pyridine and stirred on ice for 10 minutes. DIPEA (0.3 mL, 1.6 mmol, 2.0 eq) was added, and 3.0 mL of a DCM solution in which DMTrCl (0.31 mg, 0.87 mmol, 1.1 eq) and DMAP (0.15 mg, 0.11 mmol, 0.2 eq) were dissolved was added and stirred for 24 hours. Thereafter, the reaction mixture was diluted with 20 mL of DCM, washed twice with 20 mL of saturated aqueous ammonium chloride solution, once with 20 mL of saturated aqueous sodium bicarbonate solution, once with 20 mL of water, and once with 20 mL of saturated brine. The organic component was dried over Na2SO4, filtered, and the solvent was removed under vacuum. The obtained crude product was purified by silica gel column chromatography (hexane:ethyl acetate=70:30 (volume ratio)) to obtain Compound 6 (0.49 g, 0.62 mmol, yield 79%).

[0220] Compound 6:

[0221] 1 H NMR(400MHz,ACETONE-D6)δ7.37-7.14(m,9H),6.87-6.80(m,4H),4.08-3.99(m,2H),3.75(s,6H), 3.21(dd,J=8.9,6.0Hz,1H),3.09(dd,J=8.9,6.0Hz,1H),2.65-2.47(m,4H),1.06(d,J=6.4Hz,3H).

[0222] 19 F NMR(376MHz,ACETONE-D6)δ-81.6(s,3F),-114.9(s,2F),-122.4(s,2F),-123.3(s,2F),-124.0(s,2F),-126.8(s,2F).

[0223] (3) Phosphoramidite

[0224]

[0225] Under argon, compound 6 (254 mg, 0.32 mmol, 1.0 equiv) dissolved in a mixed solvent of THF / acetonitrile (1 mL / 1 mL) was added dropwise to a solution of 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (0.2 mL, 0.67 mmol, 2.1 equiv) and ETT (92 mg, 0.67 mmol, 2.1 equiv) in dry acetonitrile (4 mL) under argon. After the reaction mixture was stirred at room temperature for 26 hours, the solvent was evaporated under reduced pressure. Under argon, the obtained crude product was purified by silica gel column chromatography using degassed hexane / ethyl acetate (2:1 (volume ratio)) as the mobile phase. Thus, compound 7 (DMTr-protected L-aTNA-N[FC8]) was isolated as a colorless oil (yield 79%).

[0226] Compound 7:

[0227] 1 H NMR(400MHz,ACETONE-D6)δ7.36-7.28(m,9H),6.91-6.87(m,4H),4.38-4.27(m,2H),3. 79(s,6H),3.62-3.53(m,4H),3.27-3.16(m,2H),2.62-2.52(m,6H),1.23-1.12(m,15H)

[0228] 19 F NMR(376MHz,ACETONE-D6)δ-81.6(s,3F),-114.8(s,2F),-122.3(s,2F),-123.3(s,2F),-124.0(s,2F),-126.7(s,2F).

[0229] Using the synthesized L-aTNA-N[FC8], a nucleic acid having the structure shown below (L-aTNA-N1[FC8]: wherein black dots represent bonding sites) was synthesized by the phosphoramidite method in the same manner as in Synthesis Example 1.

[0230]

[0231] [Example 5]

[0232] The L-aTNA-N1[FC8] phosphoramidite synthesized in Synthesis Example 3 was linked to siRNA targeting the luciferase gene to prepare siRNA linked to structure (A2).

[0233] <Preparation of siRNA>

[0234] As siRNA targeting the luciferase gene, a sense strand (Lucsense) and an antisense strand (Luc antisense) consisting of the base sequences shown in Table 7 were used.

[0235] [Table 7]

[0236] Base sequence Serial Number Luc sense CUUACGCUGAGUACUUCGAAAUU 6 Luc antisense UUUCGAAGUACUCAGCGUAAGUU 7

[0237] Two molecules of L-aTNA-N1[FC8] phosphoramidite were coupled to the 5' end of the sense chain to synthesize a fluorine-modified sense chain (A2-modified sense chain) modified with a cell membrane permeable group containing structure (A2). A FAM / A2-modified sense chain in which fluorescein was introduced into the 3' end of the A2-modified sense chain was also synthesized.

[0238] RNA synthesis was performed using NTS H-8 DNA / RNA synthesizer (manufactured by NIHON TECHNO SERVICE) using commercially available reagents, various phosphoramidites (acetonitrile solution, 0.1 M), and 5-ethylthio-1H-tetrazole (acetonitrile solution, 0.25 M) as an activator.

[0239] Each synthesized RNA was mixed with an aqueous solution of diammonium citrate and a solution of 3-hydroxypicolinic acid and identified by matrix-assisted laser desorption ionization mass spectrometry. In Table 8, "L" represents L-aTNA-N1[FC8] phosphoramidite, and "FAM" represents fluorescein. In addition, "A2-Luc sense" represents A2-modified sense strand, and "FAM / A2-Luc sense" represents FAM / A2-modified sense strand.

[0240] [Table 8]

[0241]

[0242] The unmodified sense chain, A2 modified sense chain or FAM / A2 modified sense chain and the unmodified antisense chain, each adjusted to 8 μM, were denatured at 95°C for 10 minutes in a buffer solution (0.1M NaHPO4, 0.1M NaH2PO4, 1.0M NaCl, pH 6.99), and then cooled by 5°C every 5 minutes to form a double strand to obtain siRNA targeting the luciferase gene.

[0243] <Cell culture>

[0244] HeLa cells were cultured in the same manner as above except that the concentration of the penicillin-streptomycin mixed solution in the culture medium was changed to 1.0%.

[0245] <Knockdown assay>

[0246] The culture medium of the pre-cultured HeLa cells was replaced with an siRNA solution, which was prepared by diluting the D-aTNA[FC8] modified siRNA with a culture medium to a final concentration of 40 nM. As a control, the culture medium of the pre-cultured HeLa cells was replaced with a culture medium equal to the siRNA solution. After 24 hours of replacing the culture medium, a prescribed amount of luciferase assay reagent was added according to the guidelines, and the chemiluminescence was measured using a plate reader. The chemiluminescence is an indicator of luciferase expression.

[0247] The results of the relative luciferase expression of each cell are shown in Table 9, when the luciferase expression level (chemiluminescence level) of the cells to which only PBS was added was set to 100%. The relative luciferase expression level of the cells to which D-aTNA[FC8]-modified siRNA was added was 97%. In the cells to which only siRNA was added as a control, the relative luciferase expression level was 90%.

[0248] On the other hand, the relative luciferase expression level of cells to which D-aTNA[FC8]-modified siRNA was added in addition to commercially available Lipofectamine was 26%.

[0249] [Table 9]

[0250] Luciferase expression PBS treatment only 100％ siRNA 90％ D-aTNA[FC8] modified siRNA 97％ D-aTNA[FC8] modified siRNA+Lipofectamine 26％

[0251] [Synthesis Example 4]

[0252] In a nucleic acid having structure (A1), synthesis of: R 0 is a nucleic acid having an alkyl group having 10 carbon atoms substituted with one or more fluorine atoms, R 0 is a nucleic acid having an alkyl group having 6 carbon atoms substituted with one or more fluorine atoms, R 0 is a nucleic acid having an alkyl group having 8 carbon atoms which is not substituted by a fluorine atom, and R 0 It is a nucleic acid of an alkyl group having 12 carbon atoms which is not substituted by a fluorine atom.

[0253]

[0254]

[0255] <Synthesis of phosphoramidite D-aTNA-N[FC10]>

[0256] In structure (A1), R 0 In the group represented by the general formula (f-1), n1 is 2 and Rf PThe phosphoramidite having a perfluorooctyl structure (D-aTNA-N[FC10]) was synthesized as follows.

[0257] (1) Amide condensation

[0258] D-threonine alcohol (2.01 g, 19.02 mmol) and 4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-tridecafluorononanoic acid (11.5 g, 22.8 mmol, 1.2 equivalents) were dissolved in 63 mL of DMF under nitrogen, triethylamine (17 mL, 5.0 equivalents) and DMT-MM (6.4 g, 1.2 equivalents) were added, and the resulting reaction solution was stirred at room temperature for 23 hours. Thereafter, the reaction mixture was diluted with DCM (100 mL), washed twice with water, dried over Na2SO4, filtered, and the solvent was removed under vacuum to obtain compound 8a (9.2 g, 15.8 mmol, yield 83%).

[0259] Compound 8a:

[0260] 1 H-NMR(400MHz,ACETONE-D6)δ7.07(d,J=7.7Hz,1H),4.08(dd,J=6.4,2.7Hz,1H),3.81 (tt,J=8.7,2.9Hz,1H),3.62(t,J=4.9Hz,2H),2.68-2.53(m,4H),1.12(t,J=6.2Hz,3H)

[0261] 19 F NMR (376MHz, CDCl3) δ-82.8--80.0(3F),-116.8--111.8(2F),-125.3--121.3(10F),-128.7--125.0(2F).

[0262] (2)DMTr protection

[0263] In a 300 mL 2-necked round-bottom flask, diol 8a (5.75 g, 9.92 mmol) was dissolved in 25 mL of dry pyridine and cooled to 0 ° C. Next, diisopropylethylamine (3.6 mL, 20.7 mmol) was added to the mixture, and 4,4'-dimethoxytrityl chloride (3.7 g, 11.0 mmol) and 4-dimethylaminopyridine (0.19 g, 1.54 mmol) dissolved in 16 mL of dry dichloromethane were further added dropwise over 20 minutes. After the mixture was warmed to room temperature, it was stirred for 17 hours, and then the solvent was further removed under vacuum. The crude material was purified by silica gel column chromatography using a mixed solvent of methanol / dichloromethane (1 / 50 (volume ratio)), and after vacuum drying, compound 9a (8.29 g, 9.40 mmol, yield 74%) was obtained.

[0264] Compound 9a:

[0265] 1 H-NMR (400MHz, CHLOROFORM-D) δ7.38-7.21(m,9H),6.85-6.77(m,4H),6.09(d,J=8.8Hz,1H),4.12(d,J=6.2Hz,1H),3 .97-3.87(m,1H),3.86-3.72(m,6H),3.44-3.32(m,2H),2.91(d,J=22.9Hz,1H),2.60-2.38(m,4H),1.25-1.08(m,3H).

[0266] 19 F NMR (376MHz, CDCl3) δ-80.6 (t, J=9.8Hz, 3F), -114.5 (s, 2F), -121.5--123.4 (m, 10F), -126.0 (s, 2F).

[0267] (3) Phosphoramidite

[0268] Under argon, compound 9a (3.52 g, 3.99 mmol) dissolved in acetonitrile (9 mL) was added dropwise to a solution of 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (1.9 mL, 5.99 mmol) and ETT (762 mg, 5.85 mmol) dissolved in dry acetonitrile (8 mL). The reaction mixture was stirred at room temperature for 24 hours, and then the solvent was evaporated under reduced pressure. The crude product was purified by silica gel column chromatography using degassed hexane / ethyl acetate (3:1 (volume ratio)) as the mobile phase under argon. Thus, compound 10a (DMTr-protected D-aTNA-N[FC10]) was isolated as a white solid (yield 71%).

[0269] Compound 10a:

[0270] 1 H-NMR(400MHz,CHLOROFORM-D)δ7.41-7.15(m,9H),6.82-6.76(m,4H),4.38-4.08(m,2H),3.83-3.67(m ,6H),3.56-3.40(m,3H),3.25-3.03(m,2H),2.62-2.29(m,6H),1.29-1.08(m,12H),1.02-0.97(m,3H).

[0271] 19 F-NMR (376MHz, CHLOROFORM-D) δ-80.6(t,J=9.8Hz,3F),-114.5(d,J=13.0Hz,2F),-121.6--123.4(m,10F),-126.0(s,2F). 31 P-NMR(162MHz,CHLOROFORM-D)δ148.9,148.4.

[0272] <Synthesis of phosphoramidite D-aTNA-N[C8]>

[0273] In structure (A1), R 0 The phosphoramidite having an octyl structure (D-aTNA-N[C10]) was synthesized as follows.

[0274] (1) Amide condensation

[0275] As the condensed carboxylic acid, octanoic acid was used instead of 4,4,5,5,6,6,7,7,8,8,9,9,9-tridecafluorononanoic acid, and amidation was performed in the same manner. The reaction solution was diluted with dichloromethane, washed once with a saturated aqueous ammonium chloride solution, a saturated aqueous sodium bicarbonate solution, and brine, dried over Na2SO4, filtered, and the solvent was removed under vacuum. The crude product was purified by silica gel column chromatography with ethyl acetate as the mobile phase to obtain compound 8b (yield 60%).

[0276] Compound 8b:

[0277] 1H-NMR(400MHz,CHLOROFORM-D)δ6.30-6.22(m,1H),4.24-4.04(m,1H),3.88-3.76(m,3H),3. 04-2.95(m,1H),2.31-2.18(m,2H),1.73-1.57(m,3H),1.33-1.14(m,9H),0.88-0.70(m,3H).

[0278] (2)DMTr protection

[0279] Instead of having a C8F side chain 17 The diol 8a has C6H 13 The diol 8b of the side chain was also DMTr-formed by the same method to synthesize compound 9b as a colorless oil.

[0280] Compound 9b:

[0281] 1 H-NMR(400MHz,CHLOROFORM-D)δ7.40-7.12(m,9H),6.82-6.76(m,4H),4.06-3.88(m,2H),3.81-3.74(m,6H),3.43-3.24(m,2H),3.08 (d,J=1.6Hz,1H),2.21(t,J=7.7Hz,2H),2.01(d,J=13.5Hz,2H),1.30-1.23(m,12H),1.13(dd,J=20.8,6.2Hz,3H),0.87-0.79(m,3H).

[0282] (3) Phosphoramidite

[0283] Instead of having a C8F side chain 17 The DMTr protected form 9a has C6H 13 The DMTr-protected form 9b of the side chain was also DMTr-converted by the same method, and the phosphoramidite compound 10b (DMTr-protected D-aTNA-N[C8]) was isolated as a white solid (yield 55%).

[0284] Compound 10b:

[0285] 1H-NMR(400MHz,CHLOROFORM-D)δ7.47-7.07(m,9H),6.83-6.71(m,4H),4.38-4.16(m,1H),3.83-3.74(m,6H),3.59-3.41(m ,3H),3.26-3.04(m,2H),2.49-2.29(m,1H),2.23-2.10(m,2H),1.26-1.07(m,24H),1.02-0.97(m,1H),0.87-0.78(m,3H).

[0286] <Synthesis of phosphoramidite D-aTNA-N[C12]>

[0287] In structure (A1), R 0 The phosphoramidite having a dodecyl structure (D-aTNA-N[C12]) was synthesized as follows.

[0288] (1) Amide condensation

[0289] As the condensed carboxylic acid, dodecanoic acid was used instead of 4,4,5,5,6,6,7,7,8,8,9,9,9-tridecafluorononanoic acid, and amidation was performed in the same manner. The reaction solution was diluted with dichloromethane, washed once with a saturated aqueous ammonium chloride solution, a saturated aqueous sodium bicarbonate solution, and brine, dried over Na2SO4, filtered, and the solvent was removed under vacuum. The crude product was purified by silica gel column chromatography with hexane / ethyl acetate (1 / 1 (volume ratio)) as the mobile phase to obtain compound 8c (yield 76%).

[0290] Compound 8c:

[0291] 1 H-NMR(400MHz,CHLOROFORM-D)δ6.16(d,J=5.0Hz,1H),4.19(q,J=6.4Hz,1H),3.86(dd,J=10.3,2.1Hz,3H),2.54(d,J=39 .3Hz,2H),2.26(t,J=7.5Hz,2H),1.67(q,J=7.5Hz,2H),1.37-1.26(m,20H),1.21(d,J=6.4Hz,3H),0.88(t,J=6.9Hz,3H).

[0292] (2)DMTr protection

[0293] Instead of having a C8F side chain 17 The diol 8a has C 10 H 21The diol 8c of the side chain was also DMTr-converted by the same method to isolate compound 9c as a colorless oil (yield 73%).

[0294] Compound 9c:

[0295] 1 H-NMR(400MHz,CHLOROFORM-D)δ7.31-7.20(m,9H),6.83(dd,J=8.9,1.1Hz,4H),6.0 7(d,J=8.7Hz,1H),4.10-4.05(m,1H),3.97-3.90(m,1H),3.83-3.75(m,6H),3.43(q, J=4.6Hz,1H),3.27(dd,J=9.6,3.7Hz,1H),3.08(d,J=2.3Hz,1H),2.24-2.17(m,2H), 1.69-1.61(m,2H),1.31-1.20(m,18H),1.12(d,J=6.4Hz,3H),0.88(t,J=6.9Hz,3H).

[0296] (3) Phosphoramidite

[0297] Instead of having a C8F side chain 17 DMTr protected body 9a, with C 10 H 21 The DMTr-protected form 9c of the side chain was also phosphoramiditated by the same method to isolate compound 10c (DMTr-protected D-aTNA-N[C12]) as a white solid (yield 61%).

[0298] Compound 10c:

[0299] 1 H-NMR (400MHz, CHLOROFORM-D) δ7.41(dd,J=8.6,1.3Hz,2H),7.31-7.19(m,7H),6.83-6.79(m,4H),4.39-4.31(m,1H),4.26-4.17(m,1H),3.80(t,J=4 .2Hz,6H),3.56-3.42(m,4H),3.24-3.05(m,2H),2.44-2.30(m,2H),2.19-2 .15(m,2H),1.29-1.19(m,25H),1.16-1.10(m,12H),0.87(t,J=7.0Hz,3H).

[0300] 31P-NMR(162MHz,CHLOROFORM-D)δ148.9,148.7,148.6.

[0301] <Synthesis of phosphoramidite D-aTNA-N[FC6]>

[0302] In structure (A1), R 0 In the group represented by the general formula (f-1), n1 is 2 and Rf P The phosphoramidite having a perfluorobutyl structure (D-aTNA-N[FC6]) was synthesized as follows.

[0303] (3) Phosphoramidite

[0304] Instead of having a C8F side chain 17 The DMTr protected form 9a having a C4F9 side chain was phosphoramiditized by the same method to synthesize the phosphoramidite compound 10d (DMTr-protected D-aTNA-N[FC6]) as a white solid.

[0305] Compound 10d:

[0306] 1 H-NMR(400MHz,CHLOROFORM-D)δ7.49-7.17(m,9H),6.89-6.75(m,4H),6.03-5.97(m,1H),4.42-4.07(m,2H),3.97-3.61(m, 6H),3.73-3.61(m,1H),3.59-3.36(m,3H),3.30-3.11(m,2H),2.72-2.25(m,6H),1.30-1.09(m,12H),0.97(q,J=7.1Hz,3H).

[0307] 19 F-NMR (376MHz, CHLOROFORM-D) δ-80.7--81.1(m,3F),-114.5--115.2(m,2F),-124.2--124.4(m,2F),-125.6--126.4(m,2F).

[0308] 31 P-NMR(162MHz,CHLOROFORM-D)δ148.9,148.8,148.4.

[0309] <DNA synthesis>

[0310] Using the synthesized 4 phosphoramidites and the phosphoramidite (L-aTNA-N[FC8]) synthesized in Synthesis Example 3, a nucleic acid having the structure shown below (wherein a black dot represents a bonding site) was synthesized by the phosphoramidite method in the same manner as in Synthesis Example 1.

[0311]

[0312]

[0313] [Example 6]

[0314] The fluorescein modified nucleic acid having any one of structures (A1) to (A4) and the fluorescein modified nucleic acid having none of structures (A1) to (A4) were examined for their efficiency of uptake into cells by quantitative analysis using flow cytometry. The fluorescein modified nucleic acid having any one of structures (A1) to (A4) used the phosphoramidites having a cell membrane permeable group synthesized in the above-mentioned synthesis examples (D-aTNA-N[C8], L-aTNA-N[FC8], D-aTNA-N[FC8], D-aTNA-N[FC10], and D-aTNA-N[C12]).

[0315] <Synthesis of Fluorescein-modified Nucleic Acid>

[0316] A fluorescein-modified nucleic acid (ssDNA-FAM) in which single-stranded DNA is modified with fluorescein, and a nucleic acid (AM-ssDNA-FAM) in which a phosphoramidite having a cell membrane permeable group is linked to the end of the nucleic acid portion or in the nucleic acid portion of the fluorescein-modified nucleic acid (ssDNA-FAM) are synthesized.

[0317] Specifically, a fluorescein-modified nucleic acid (ssDNA-FAM) in which fluorescein is introduced into the 3' end of a single-stranded DNA (SEQ ID NO: 8) is synthesized using a DNA synthesizer. Next, two or five molecules of each phosphoramidite synthesized in the above synthesis example are linked to the 5' end of the obtained ssDNA-FAM using a DNA synthesizer to obtain AM-ssDNA-FAM in which two or five phosphoramidites of the same type are linked in series at the 5' end.

[0318] Separately, two single-stranded DNA molecules (5'-TTTTTCAGTR) were synthesized by inserting a phosphoramidite having a fluoroalkyl group between the 9th and 10th thymines of the single-stranded DNA (SEQ ID NO: 8) using a DNA synthesizer. F R F TGACCATATA-3', R FA fluorescein-modified nucleic acid (AM-ssDNA-FAM) in which fluorescein was introduced into the 3' end of the obtained single-stranded DNA was also synthesized.

[0319] The schematic diagram of the structure of ssDNA-FAM (control nucleic acid) and AM-ssDNA-FAM having a cell membrane permeable group at the 5' end is shown in Figure 2 In the structure of AM-ssDNA-FAM, “R 100 " and "n100" are shown in Table 10 described later.

[0320] Specifically, eight AM-ssDNA-FAMs listed in Table 10 were synthesized, namely, D-aTNA-N[FC6], D-aTNA-N[C8], L-aTNA-N[FC8], D-aTNA-N[FC8], D-aTNA-N[FC10], and D-aTNA-N[C12], each of which had two molecules of D-aTNA-N[FC6], D-aTNA-N[C8], L-aTNA-N[FC8], D-aTNA-N[FC10], and D-aTNA-N[C12] connected in series at the 5' end of the ssDNA-FAM. ], L-aTNA-N2[FC8], D-aTNA-N2[FC8], D-aTNA-N2[C12] and D-aTNA-N2[FC10]; D-aTNA-N5[FC8] in which five molecules of D-aTNA-N[FC8] are connected in series at the 5' end of ssDNA-FAM; and D-aTNA-midN2[FC8] in which two molecules of D-aTNA-N[FC8] are inserted in series near the center of ssDNA-FAM.

[0321] <Evaluation of physical properties of fluorescein-modified nucleic acids>

[0322] The hydrodynamic diameter of each fluorescein-modified nucleic acid in a PBS solution, the zeta potential in an aqueous solution, and the critical micelle concentration (CMC) (μM) in a PBS solution are shown in Table 10. In the table, "Control" represents ssDNA-FAM (control nucleic acid).

[0323] The hydrodynamic diameter (nm) of each fluorescein-modified nucleic acid is measured using a dynamic light scattering (DLS) measuring device using a solution obtained by dissolving the sample (fluorescein-modified nucleic acid) in PBS at a concentration of 2 μM as a test sample. In DLS, a dilute suspension is irradiated with laser light, and the backscattered light obtained from the particles in the suspension is detected to measure the fluctuation of the scattered light within a certain period of time. The particles in the liquid undergo Brownian motion due to the thermal motion of the solvent molecules, and the fluctuation of the scattered light depends on the speed of the Brownian motion of the particles, and has the property that the smaller the particles, the faster the Brownian motion. In the DLS measurement, the change in the fluctuation of the scattered light over a certain period of time (correlation time) is detected and correlated to obtain a decay curve called an autocorrelation function. The diffusion coefficient of the Stokes-Einstein equation is calculated from the autocorrelation function and converted into a particle size. Specifically, a sample was prepared in a small quartz batch cuvette (12 μL volume, ZEN2112, manufactured by Malvern Panalytical) and measured at 37° C. using a 630 nm wavelength DLS measurement system (Zetasizer Advance Series Pro (Red Label), manufactured by Malvern Panalytical). The same sample was measured three or more times, and the average particle size was calculated based on the results.

[0324] The zeta potential (mV) of each fluorescein-modified nucleic acid is a solution obtained by dissolving the sample (fluorescein-modified nucleic acid) in ultrapure water in a manner of 10 μM as a test sample, and the solution is measured using a DLS measuring device. The electrophoretic mobility of the particles dispersed in the liquid depends on the zeta potential of the particles. The particles are irradiated with a laser, and the electrophoretic mobility is obtained by the change in the frequency of the scattered light, and the zeta potential is calculated using Henry's law. The zeta potential is an indicator of the electrostatic repulsion of the particles, and is widely used as a method for simply inferring the stability evaluation of the dispersion and the surface state of the particles. Specifically, the test sample is prepared in a disposable cuvette (DTS1070, manufactured by Malvern Panalytical) for zeta potential and measured at 37°C using a DLS measuring system (Zetasizer Advance Series Pro (Red Label), manufactured by Malvern Panalytical).

[0325] The critical micelle concentration (CMC) of each fluorescein-modified nucleic acid is measured using a DLS measurement system (Zetasizer AdvanceSeries Pro (Red Label), manufactured by Malvern Panalytical) using a solution obtained by dissolving the sample (fluorescein-modified nucleic acid) in PBS at various concentrations as a test sample. The count rate of the test sample under a wide range of concentrations is calculated using the DLS measurement system. The test sample is measured at 37°C using a DLS measurement system with a wavelength of 630nm, and the count rate under a wide range of concentrations is calculated from the obtained measured values. When micelles begin to form, the count rate begins to increase. Therefore, in the present invention and the specification of this application, the concentration at which the count rate begins to increase is referred to as the CMC.

[0326] [Table 10]

[0327]

[0328] <Preparation of sample solution>

[0329] ssDNA-FAM (control nucleic acid) and AM-ssDNA-FAM were prepared in DMEM culture medium at a concentration of 2.0 μM as sample solutions. A 2.0 μM solution of ssDNA-FAM was used as a negative control. DMEM liquid culture medium was used for blank group measurement.

[0330] <Evaluation of cell membrane permeability using flow cytometry>

[0331] The culture medium of HeLa cells previously cultured at 37°C for 24 hours was replaced with the sample solution, and the cell membrane permeability after culturing at 37°C for 4 hours was evaluated. After each predetermined time of culture, the cell surface was washed three times with PBS (phosphate saline), and the cells were peeled and recovered with trypsin-EDTA 0.05% (Gibco). Next, the recovered cells were applied to flow cytometry (guava easyCyte (trademark) 8) to measure and detect the green fluorescence (488nm) of the fluorescent pigment fluorescein (FAM) introduced into the synthetic nucleic acid.

[0332] The cells to which the fluorescein-modified nucleic acid was not added to the culture medium were used as a blank control, and the cells to which only the control nucleic acid (ssDNA-FAM) was added to the culture medium were used as a negative control.

[0333] The fluorescence intensity of each cell was measured, and the relative fluorescence intensity was determined, with the fluorescence intensity of cells to which only the control nucleic acid was added to the culture medium being set to 1.0. The results are shown in Figure 3 .like Figure 3 As shown, it is confirmed that R 100The average relative fluorescence intensity of cells incorporating fluorescein-modified nucleic acids containing perfluoroalkyl or alkyl groups having 10 or more carbon atoms was 1.5 or more, which was significantly stronger than that of cells incorporating control nucleic acids. These fluorescein-modified nucleic acids have better cell membrane permeability than control nucleic acids. 100 The relative fluorescence intensity of the cells containing the fluorescein-modified nucleic acid having an alkyl group with 9 or less carbon atoms and no fluorine atom was 1.0, which was equivalent to that of the control nucleic acid.

[0334] <Confirmation of energy-dependent intracellular delivery>

[0335] The medium of HeLa cells previously cultured at 37°C for 24 hours was replaced with DMEM liquid medium, and cultured at 4°C for 0.5 hours. Thereafter, the medium was replaced with the sample solution, and the cell membrane permeability was evaluated after culture at 4°C or 37°C for 1.5 hours. The evaluation of cell membrane permeability was performed in the same manner as the evaluation of cell membrane permeability by flow cytometry described above.

[0336] The cells to which the fluorescein-modified nucleic acid was not added to the culture medium were used as a blank control, and the cells to which only the control nucleic acid (ssDNA-FAM) was added to the culture medium were used as a negative control.

[0337] The fluorescence intensity of each cell was measured, and the relative fluorescence intensity was determined, with the fluorescence intensity of cells cultured at 37°C and the control nucleic acid alone added to the culture medium being set as 1.0. The results are shown in Figure 4 In the figure, “Control”, “R 100 ” and “n100” are the same as those in Table 10. Figure 4 As shown, compared with the case of incubation at 37°C, the uptake of R 100 The relative fluorescence intensity of cells containing fluorescein-modified nucleic acids that are perfluoroalkyl or alkyl groups with 10 or more carbon atoms was significantly reduced, and culturing at 4°C reduced the amount of fluorescein-modified nucleic acids taken up into cells. These results indicate that the uptake of nucleic acids having structures (A1) to (A4) into cells is based on energy-dependent intracellular delivery (endocytosis).

[0338] [Synthesis example 5]

[0339] In the nucleic acid having structure (A4), R FE A perfluoroalkyl group with 6 carbon atoms (C6F 13 -: hereinafter referred to as C6-PFC group) and na is 1, and a nucleic acid containing a C6-PFC group is produced by the phosphoramidite method.

[0340] <Synthesis of phosphoramidite having C6-PFC group>

[0341] The phosphoramidite containing a C6-PFC group represented by the following formula (N[C6-PFC]phosphoramidite) was synthesized by the same method as in Synthesis Example 1.

[0342]

[0343] 1 H-NMR(400MHz,CHLOROFORM-D)δ7.45-7.39(m,2H),7.35-7.26(m,6H),7.23-7.17(m,1H),6.85-6.79(m,4H),3.83-3.52(m,6H),3.79(s ,6H),3.79(t,J=16.6Hz,2H),3.20(t,J=5.7Hz,2H),2.94(dt,J=15.6,5.9Hz,4H),2.57(t,J=6.5Hz,2H),1.16(dd,J=15.3,6.8Hz,12H).

[0344] 19 F-NMR(376MHz,CHLOROFORM-D)δ-80.64(t,J=10.1Hz,3F),-117.31--117.72(m,2F),-121.86- -121.91(m,2F),-122.55--122.94(m,2F),-123.32--123.40(m,2F),-125.93--126.06(m,2F).

[0345] 31 P-NMR(162MHz,CHLOROFORM-D)δ148.35.

[0346] [Synthesis example 6]

[0347] In the nucleic acid having structure (A4), R FE A phosphoramidite having a structure of a perfluoropolyether group (CF3-(OCF2)4-: hereinafter referred to as a C5-PFPE group) having 5 carbon atoms and na being 1 is used to produce a nucleic acid containing a C5-PFPE group by a phosphoramidite method.

[0348] <Synthesis of phosphoramidite having C5-PFPE group>

[0349] The phosphoramidite containing a C5-PFPE group represented by the following formula (N[C5-PFPE]phosphoramidite) was synthesized by the same method as in Synthesis Example 1.

[0350]

[0351] 1 H-NMR(400MHz,CHLOROFORM-D)δ7.44-7.39(m,2H),7.35-7.27(m,6H),7.23-7.17(m,1H),6.89-6.75(m,4H),3.82-3.45(m,6H),3.79(s,6H ),3.27(t,J=11.1Hz,2H),3.18(t,J=5.8Hz,2H),2.93(dt,J=14.2,6.0Hz,4H),2.57(tt,J=6.5,0.9Hz,2H),1.15(dd,J=15.4,6.8Hz,12H).

[0352] 19 F-NMR(376MHz,CHLOROFORM-D)δ-52.93(p,J=10.8Hz,2F),-54.85(p,J=10.1Hz,2F),-55 .36(qt,J=9.4,9.3Hz,2F),-56.76(t,J=8.8Hz,3F),-77.18(td,J=11.40,11.39Hz,2F).

[0353] 31 P-NMR(162MHz,CHLOROFORM-D)δ148.40.

[0354] [Example 7]

[0355] The efficiency of fluorescein-modified nucleic acids containing a C8-PFC group into cells was studied by quantitative analysis using flow cytometry.

[0356] <Synthesis of Fluorescein-modified Nucleic Acid>

[0357] A fluorescein-modified nucleic acid (ssDNA-FAM) in which fluorescein is introduced into the 3' end of a single-stranded DNA consisting of sequence number 8 was synthesized in the same manner as in Example 1. In the same manner as in Example 1, 1, 2, 3, 4 or 5 molecules of N[C8-PFC]phosphoramidite synthesized in Synthesis Example 1 were linked to the 5' end of the obtained ssDNA-FAM to obtain ssDNA-FAM (PFC-ssDNA-FAM) in which 1, 2, 3, 4 or 5 cell membrane permeable groups containing a C8-PFC group were linked in series to the 5' end.

[0358]

[0359] <Preparation of sample solution>

[0360] ssDNA-FAM (control nucleic acid) and PFC-ssDNA-FAM (fluorine-added nucleic acid) were prepared in a DMEM medium (low glucose, 10% FBS, 1% penicillin-streptomycin mixed solution) at a concentration of 1.0 μM as sample solutions. DMEM medium (low glucose, 10% FBS, 1% penicillin-streptomycin mixed solution) was also used for blank group measurement.

[0361] <Evaluation of cell membrane permeability using flow cytometry>

[0362] The cell membrane permeability of HeLa cells cultured with each sample solution was evaluated in the same manner as in Example 1. Cells to which no fluorescein-modified nucleic acid was added to the culture medium were used as a blank control.

[0363] The mean fluorescence intensity (MFI) of each cell at each culture time is shown in Table 11. In the table, "Blank" indicates the result of cells in which no fluorescein-modified nucleic acid was added to the culture medium, and "N[PFC]n-DNA" indicates the result of cells in which ssDNA-FAM to which n molecules of fluorine-added nucleic acid were added to the culture medium. As shown in Table 11, the mean fluorescence intensity of fluorine-added nucleic acid (PFC-ssDNA-FAM) reached a maximum value after 1 hour, that is, when n=2. These results indicate that in the case of the C8-PFC group, excellent cell membrane permeability is achieved by performing two-molecule modification.

[0364] [Table 11]

[0365]

[0366] [Example 8]

[0367] The phosphoramidite containing a C6-PFC group (N[C6-PFC] phosphoramidite) synthesized in Synthesis Example 5 was linked to siRNA targeting the CyclinB1 gene to prepare siRNA linked to structure (A4), and the knockdown efficiency was studied.

[0368] <Preparation of siRNA>

[0369] As siRNA targeting the Cyclin B1 gene, a sense strand and an antisense strand consisting of the base sequences shown in Table 3 were used.

[0370] In the same manner as in Example 3, 1, 2, 3, 4 or 5 molecules of N[C6-PFC] phosphoramidite are coupled to the 5' end of the sense chain to synthesize a fluorine-modified sense chain, which is then double-stranded with an unmodified antisense chain or an antisense chain coupled with 1 molecule of N[C6-PFC] phosphoramidite to obtain a fluorine-modified siRNA (C6-PFC-modified siRNA).

[0371] <Knockdown assay>

[0372] The culture medium of the pre-cultured HeLa cells was replaced with a siRNA solution, which was prepared by diluting the C6-PFC modified siRNA with a culture medium to a final concentration of 10 nM or 100 nM. As a control, the culture medium of the pre-cultured HeLa cells was replaced with a culture medium equal to the siRNA solution. After 48 hours of replacing the culture medium, RNA was extracted from each cell in the same manner as in Example 3, and the total RNA obtained was used as a template to perform RT-PCR to measure the expression level (mRNA level) of the Cyclin B1 gene.

[0373] As in Example 3, the total RNA amount extracted from the control cells was used as a reference, and the knockdown efficiency was calculated from the amount of mRNA of the Cyclin B1 gene amplified from the total RNA extracted from the siRNA-introduced cells. When the expression level of the Cyclin B1 gene of the blank group (cells added with only DMEM medium (low glucose, 10% FBS, 1% penicillin-streptomycin mixed solution)) was set to 100, the relative value (%) of the expression level of the Cyclin B1 gene of each cell is shown in Table 12. In the table, "n" represents the number of N[C6-PFC] phosphoramidites coupled to each chain.

[0374] [Table 12]

[0375] Meaning (n) 10nM antisense n=0 100nM antisense n=0 10nM antisense n=1 100nM antisense n=1 0 142.5 122.5 - - 1 110.0 75.5 81.5 34.3 2 141.0 15.1 109.0 79.5 3 140.0 40.5 108.5 43.3 4 133.5 92.5 159.5 84.5 5 84.5 77.0 88.5 37.0

[0376] As shown in Table 12, when the final concentration of siRNA was 100 nM, the relative expression of Cyclin B1 gene in cells introduced with C6-PFC modified siRNA was lower than that in cells introduced with unmodified siRNA. In particular, in cells introduced with 2 molecules of C6-PFC modified siRNA 100 nM, the expression of Cyclin B1 gene was also suppressed by about 85% compared with the blank control. Based on these results, it was confirmed that C6-PFC modified siRNA was transfected into target cells and functioned normally as siRNA in the cells to suppress the expression of Cyclin B1 gene.

[0377] [Example 9]

[0378] The efficiency of fluorescein-modified nucleic acids containing a C5-PFPE group incorporating into cells was investigated by quantitative analysis using flow cytometry.

[0379] <Synthesis of Fluorescein-modified Nucleic Acid>

[0380] In the same manner as in Example 1, a fluorescein-modified nucleic acid (ssDNA-FAM) was synthesized in which fluorescein was introduced into the 3' end of the single-stranded DNA consisting of Sequence No. 1. In the same manner as in Example 1, two molecules of N[C5-PFPE] phosphoramidite synthesized in Synthesis Example 6 were linked to the 5' end of the obtained ssDNA-FAM to obtain ssDNA-FAM (PFPE-ssDNA-FAM) in which two cell membrane permeable groups containing a C5-PFPE group were linked in series at the 5' end.

[0381]

[0382] <Preparation of sample solution>

[0383] PFPE-ssDNA-FAM (fluorine-added nucleic acid) was prepared in a DMEM medium (low glucose, 10% FBS, 1% penicillin-streptomycin mixed solution) at a concentration of 1.0 μM as a sample solution. DMEM medium (low glucose, 10% FBS, 1% penicillin-streptomycin mixed solution) was also used for blank group measurement.

[0384] <Evaluation of cell membrane permeability using flow cytometry>

[0385] The cell membrane permeability of HeLa cells cultured with each sample solution at 37° C. for 28 hours was evaluated in the same manner as in Example 1. Cells to which no fluorescein-modified nucleic acid was added to the culture medium were used as a blank control.

[0386] The average fluorescence intensity of each cell at each culture time is shown in Table 13. In the table, "Blank" indicates the results of cells in which no fluorescein-modified nucleic acid was added to the culture medium, and "C5-PFPE" indicates the results of cells in which ssDNA-FAM to which two molecules of fluorine-added nucleic acid were added was added to the culture medium. As shown in Table 13, the average fluorescence intensity of the fluorine-added nucleic acid (PFPE-ssDNA-FAM) was about twice that of the blank group, indicating that excellent cell membrane permeability can be exerted by modification with the C5-PFPE group.

[0387] [Table 13]

[0388] Blank <![CDATA[C5-PFPE]]> Mean fluorescence intensity (MFI) 44 94

[0389] [Example 10]

[0390] The phosphoramidite containing a C5-PFPE group (N[C5-PFPE] phosphoramidite) synthesized in Synthesis Example 6 was linked to siRNA targeting the CyclinB1 gene to prepare siRNA linked to structure (A4), and the knockdown efficiency was studied.

[0391] <Preparation of siRNA>

[0392] As siRNA targeting the Cyclin B1 gene, a sense strand and an antisense strand consisting of the base sequences shown in Table 3 were used.

[0393] In the same manner as in Example 3, two molecules of N[C5-PFPE] phosphoramidite were coupled to the 5' end of the sense strand to synthesize a fluorine-modified sense strand, which was then double-stranded with the unmodified antisense strand to obtain a fluorine-modified siRNA (C5-PFPE-modified siRNA).

[0394] <Knockdown assay>

[0395] The culture medium of the pre-cultured HeLa cells was replaced with a siRNA solution, which was prepared by diluting the C5-PFPE-modified siRNA with a culture medium to a final concentration of 100 nM. As a control, the culture medium of the pre-cultured HeLa cells was replaced with a culture medium equal to the siRNA solution. After 48 hours of replacing the culture medium, RNA was extracted from each cell in the same manner as in Example 3, and the total RNA obtained was used as a template to perform RT-PCR to measure the expression level (mRNA level) of the Cyclin B1 gene.

[0396] The knockdown efficiency was calculated based on the amount of Cyclin B1 gene mRNA amplified from the total RNA extracted from the siRNA-introduced cells, using the total RNA amount extracted from the control cells as a reference, as in Example 3. When the expression level of Cyclin B1 gene in the blank group (cells added with only DMEM medium (low glucose, 10% FBS, 1% penicillin-streptomycin mixed solution)) was set to 100, the relative value (%) of the expression level of Cyclin B1 gene in each cell is shown in Table 14.

[0397] [Table 14]

[0398] Blank C5-PFPE Relative value (%) 100 52

[0399] As shown in Table 14, the expression of Cyclin B1 gene in cells into which C5-PFPE modified siRNA was introduced was also suppressed by about 50% compared with the blank control. These results confirmed that C5-PFPE modified siRNA was transfected into target cells and functioned normally as siRNA in the cells to suppress the expression of Cyclin B1 gene.

[0400] [Example 11]

[0401] The D-aTNA-N[FC10] phosphoramidite synthesized in Synthesis Example 4 was linked to siRNA targeting the luciferase gene to prepare siRNA linked to structure (A2).

[0402] <Preparation of siRNA>

[0403] As siRNA targeting the luciferase gene, a sense strand (Lucsense) and an antisense strand (Luc antisense) consisting of the base sequences shown in Table 7 were used. RNA synthesis and identification of each synthesized RNA were performed in the same manner as in Example 5.

[0404] Two molecules of D-aTNA-N[FC10] phosphoramidite were coupled to the 5' end of the sense strand to synthesize an A2-modified sense strand (D-aTNA-N2[FC10]-Luc sense).

[0405] Similarly, four molecules of D-aTNA-N[FC10] phosphoramidite were coupled to the 5' end of the sense chain to synthesize an A2-modified sense chain (D-aTNA-N4[FC10]-Luc sense). A FAM / A2-modified sense chain (D-aTNA-N4[FC10]-Luc sense-FAM) in which fluorescein was introduced to the 3' end of the A2-modified sense chain was also synthesized.

[0406] Four molecules of D-aTNA-N[FC10] phosphoramidite were coupled to the 3' end of the sense strand to synthesize an A2-modified sense strand (Luc sense-D-aTNA-N4[FC10]).

[0407] In addition, a FAM-modified sense strand (Luc sense-FAM) in which fluorescein was introduced at the 3' end of the sense strand was synthesized.

[0408] In addition, siRNA targeting the GFP gene was obtained using the sense strand (GFP sense) and antisense strand (GFP antisense) shown in Table 16. RNA synthesis and identification of each synthesized RNA were performed in the same manner as in Example 5. The fluorine-free modified siRNA was obtained from a sense strand (GFPsence-T) in which the two uracil bases at the 3' end of the base sequence targeting the GFP gene were thymidine bases and an antisense strand (GFP antisence-T) in which the two uracil bases at the 3' end of the base sequence targeting the GFP gene were thymidine bases. The A2-modified siRNA was obtained from an A2-modified sense strand (D-aTNA-N2[FC10]-GFP sense-T) and GFP antisence-T synthesized by coupling two molecules of D-aTNA-N[FC10] phosphoramidite to the 5' end of GFP sense-T.

[0409] [Table 15]

[0410]

[0411] [Table 16]

[0412] Base sequence Serial Number GFP antisense-T 5'-UGCGCUCCUGGACGUAGCdT*dT-3' 9 GFP sense-T 5'-GGCUACGUCCAGGAGCGCAdT*dT-3' 10 D-aTNA-N2[FC10]-GFPsense-T 5'-DD-GGCUACGUCCAGGAGCGCAdT*dT-3'

[0413] In Tables 15 and 16, "D" represents D-aTNA-N1[FC10] phosphoramidite, "FAM" represents fluorescein, "*" represents a phosphorothioate bond, and "dT" represents a thymidine base.

[0414] The unmodified sense chain, A2 modified sense chain or FAM / A2 modified sense chain and the unmodified antisense chain, each adjusted to 8 μM, were denatured at 95°C for 10 minutes in a buffer solution (0.1M NaHPO4, 0.1M NaH2PO4, 1.0M NaCl, pH 6.99), and then cooled by 5°C every 5 minutes to form a double strand to obtain siRNA targeting the luciferase gene.

[0415] The hydrodynamic diameter (nm) of each siRNA was measured in a PBS solution. The measurement was performed in the same manner as in Example 6 using a dynamic light scattering (DLS) measuring apparatus.

[0416] <Evaluation of cell membrane permeability using flow cytometry>

[0417] The cell membrane permeability of siRNA (A2-ssRNA-FAM) containing a FAM / A2 modified sense strand (D-aTNA-N4[FC10]-Luc sense-FAM) was evaluated, and siRNA (ssRNA-FAM) containing a FAM modified sense strand (Luc sense-FAM) was used as a comparison.

[0418] First, the sample solutions of each siRNA were prepared in the same manner as in Example 1. Next, the culture medium of HeLa cells previously cultured at 37°C for 24 hours was replaced with the sample solution in the same manner as in Example 1, and after culture at 37°C for 1.5 hours, the recovered cells were applied to flow cytometry to measure the green fluorescence (488 nm) of the detection fluorescein (FAM). Cells to which the fluorescein-modified nucleic acid was not added to the culture medium were used as a blank group.

[0419] The results of measuring the fluorescence intensity of cells cultured in the medium to which each siRNA was added are shown in FIG. Figure 5For the fluorescence intensity, the fluorescence intensity of the cells to which the control nucleic acid (ssRNA-FAM) was added to the culture medium was set to 1, and the relative fluorescence intensity was calculated. As a result, the fluorescence intensity of the cells to which A2-ssRNA-FAM was added to the culture medium was much stronger than that of the cells to which the control nucleic acid was added to the culture medium, confirming that A2-ssRNA-FAM was efficiently introduced into the cells.

[0420] <Confirmation of energy-dependent intracellular delivery>

[0421] The medium of HeLa cells previously cultured at 37°C for 24 hours was replaced with DMEM liquid medium, and cultured at 4°C for 0.5 hours. Thereafter, the medium was replaced with the sample solution, and the cell membrane permeability was evaluated after culturing at 4°C or 37°C for 1.5 hours. The evaluation of cell membrane permeability was performed in the same manner as the evaluation of cell membrane permeability by flow cytometry described above.

[0422] <Cell culture>

[0423] HeLa cells were cultured in the same manner as above except that the concentration of the penicillin-streptomycin mixed solution in the culture medium was changed to 1.0%.

[0424] <Knockdown assay>

[0425] The knockdown activity was investigated for siRNA comprising A2-Luc sense (A2-modified sense chain formed by coupling two molecules of D-aTNA-N[FC8] phosphoramidite to the 5' end of the sense chain) prepared in Example 5, siRNA comprising D-aTNA-N2[FC10]-Luc sense listed in Table 15, siRNA comprising D-aTNA-N4[FC10]-Luc sense, and siRNA comprising Luc sense-D-aTNA-N4[FC10].

[0426] The culture medium of the pre-cultured HeLa cells was replaced with a siRNA solution, which was diluted with a culture medium to a final concentration of 0.1 μM or 2 μM. As a control, the culture medium of the pre-cultured HeLa cells was replaced with a culture medium equal to the above-mentioned siRNA solution. After 24 hours of replacing the culture medium, a specified amount of luciferase detection reagent was added according to the guidelines, and the chemiluminescence was measured with a plate reader. The chemiluminescence amount is used as an indicator of luciferase expression.

[0427] When the luciferase expression level (chemiluminescence level) of the control cells was set to 1, the results of the relative luciferase expression level of each cell are shown in Figure 6 . Figure 6 In the figure, "N2[FC8]", "N2[FC10]", "N4[FC10]" and "3'-N4[FC10]" respectively represent cells cultured with solutions containing siRNA comprising A2-Luc sense, siRNA comprising D-aTNA-N2[FC10]-Luc sense, siRNA comprising D-aTNA-N4[FC10]-Luc sense and siRNA comprising Luc sense-D-aTNA-N4[FC10]. Figure 6 As shown, no knockdown was observed in cells into which either siRNA was introduced.

[0428] <Knockdown assay 2>

[0429] siRNA targeting the GFP gene was introduced into HeLa cells constitutively expressing GFP (GFP-HeLa cells) and knockdown assay was performed (Rietz et al., NATURE COMMUNICATIONS,<https: / / doi.org / 10.1038 / s41467-020-15300-1> ). As siRNA, siRNA (A2 modified siRNA) composed of D-aTNA-N2[FC10]-GFP sense-T and GFP antisense-T listed in Table 16 was used. As siRNA for comparison, siRNA (unmodified siRNA) composed of GFPsense-T and GFP antisense-T, and siRNA (cholesterol modified siRNA) composed of GFP sense-T and GFP antisense-T were used.

[0430] Specifically, GFP-HeLa cells cultured at 37°C for 24 hours were replaced with siRNA solutions, wherein each siRNA was diluted with a culture medium to a final concentration of 0.1 μM or 2 μM. After 24 hours of replacing the culture medium, the fluorescence of GFP was measured using a plate reader. The fluorescence was used as an indicator of the expression of GFP. In addition, q-PCR was used to quantify mRNA related to GFP expression.

[0431] <Knockdown assay in the presence of chloroquine>

[0432] Chloroquine, a compound known to destroy endosomes, was added to perform a knockdown assay. Specifically, the culture medium of HeLa cells cultured at 37°C for 24 hours was replaced with an siRNA solution, in which siRNA was diluted with a culture medium to a final concentration of 0.1 μM or 2 μM, and cultured at 37°C for 6 hours. Subsequently, 100 μM of chloroquine solution was added to the siRNA solution, and the luciferase expression level after 18 hours of culture at 37°C was evaluated.

[0433] When the luciferase expression level (chemiluminescence level) of the control cells was set to 1, the results of the relative luciferase expression level of each cell are shown in Figure 7 . Figure 7 In the example, "N2[FC8]" and "N4[FC10]" are Figure 6 Same. Figure 7 As shown, no knockdown was observed in siRNA modified with D-aTNA-N4[FC10] and siRNA modified with D-aTNA-N2[FC8].

[0434] <Knockdown efficiency when using transfection reagent>

[0435] The medium of HeLa cells previously cultured at 37°C for 24 hours was replaced with a DMEM liquid medium containing a mixed solution of a transfection reagent (Lipofectamine) and a sample (siRNA), and the cell membrane permeability was evaluated after culturing at 37°C for 1.5 hours. The evaluation of cell membrane permeability was performed in the same manner as the evaluation of cell membrane permeability by flow cytometry described above.

[0436] [Example 12]

[0437] In the same manner as in Example 6, the fluorescein-modified nucleic acid having any one of structures (A1) to (A4) and the fluorescein-modified nucleic acid not having any of structures (A1) to (A4) were examined for their efficiency of uptake into cells by quantitative analysis using flow cytometry. The fluorescein-modified nucleic acid having any one of structures (A1) to (A4) was synthesized in the same manner as in Example 6 using the phosphoramidites (D-aTNA-N[C8], L-aTNA-N[FC8], D-aTNA-N[FC8], D-aTNA-N[FC10], and D-aTNA-N[C12]) having a cell membrane permeable group synthesized in the above-mentioned synthesis examples.

[0438] <Evaluation of physical properties of fluorescein-modified nucleic acids>

[0439] The hydrodynamic diameter (nm) of each fluorescein-modified nucleic acid in PBS solution, the zeta potential (mV) in 0.2×PBS solution, and the critical micelle concentration (CMC) (μM) in PBS solution were measured. The hydrodynamic diameter (nm) and the critical micelle concentration (CMC) (μM) were measured in the same manner as in Example 6.

[0440] The zeta potential (mV) of each fluorescein-modified nucleic acid in 0.2×PBS solution was measured using a DLS measuring apparatus using a solution prepared by dissolving the sample (fluorescein-modified nucleic acid) in 0.2×PBS solution to a concentration of 10 μM as a test sample. The measurement using the DLS measuring apparatus was performed in the same manner as in Example 6.

[0441] Table 17 shows the results of measuring the zeta potential (mV) of each fluorescein-modified nucleic acid in a 0.2×PBS solution.

[0442] [Table 17]

[0443] Fluorescently modified nucleic acid Zeta potential [mV] Control -33±2 D-aTNA-N2[C8] -42±3 D-aTNA-midN2[FC8] -45±1 L-aTNA-N2[FC8] -42±3 D-aTNA-N2[FC8] -50±2 D-aTNA-N2[C12] -48±3 D-aTNA-N2[FC10] -53±2

[0444] <Evaluation of cell membrane permeability in the presence of inhibitors>

[0445] The medium of HeLa cells previously cultured at 37°C for 24 hours was replaced with a DMEM liquid medium to which the inhibitor was added, and cultured at 37°C for 1 hour. Thereafter, the medium was replaced with a DMEM solution containing D-aTNA-N2[FC10], and the cell membrane permeability was evaluated after culture at 37°C for 1.5 hours. The evaluation of cell membrane permeability was performed in the same manner as the evaluation of cell membrane permeability using flow cytometry described above. The various inhibitors used here are as follows: deoxyglucose (dG; 50 mM) as an inhibitor of endocytosis, fucoidan (Fuc; 0.5 mg / mL) as an inhibitor of scavenger receptors, sucrose (Suc; 0.3 mM) as an inhibitor of clathrin-dependent endocytosis, and genistein (Gen; 700 μM) as an inhibitor of caveolae-dependent endocytosis.

[0446] The fluorescence intensity of each cell was measured, and the relative fluorescence intensity was determined, with the fluorescence intensity of cells cultured at 37°C and the control nucleic acid alone added to the culture medium being set as 1.0. The results are shown in Figure 8 In the presence of sucrose, deoxyglucose or fucoidan, the intake of R 100 The relative fluorescence intensity of cells with perfluoroalkyl fluorescently modified nucleic acids was compared with that of cells without inhibitors (in the figure, "C8F 17”) was reduced compared to the control group. These results suggest that the uptake of D-aTNA-N2[FC10] into cells is based on clathrin-dependent endocytosis. In addition, it also suggests that it is dependent on the intracellular delivery of scavenger receptor inhibitors.

[0447] <Determination of DNA density per particle>

[0448] The weight average molecular weight (Mw) of each fluorescein-modified nucleic acid is measured by using a static light scattering (SLS) measuring device, in which a solution obtained by dissolving the sample (fluorescein-modified nucleic acid) in PBS at 2 μM is used as a test sample. The DNA density of each particle is calculated by dividing the apparent molecular weight of each particle obtained by SLS by the molecular weight of each molecule. SLS is a technique for determining absolute molecular weight according to the Rayleigh theory based on the relationship between the intensity of light scattered by a molecule and the molecular weight and size of the molecule. The measurement uses the same machine as that for the measurement of the hydrodynamic diameter (nm) of each fluorescein-modified nucleic acid in Example 6 to measure light scattering at different DNA concentrations. The same sample is measured more than 3 times, the results are made into a Debye Plot and the weight average molecular weight is calculated.

[0449] [Table 18]

[0450] Fluorescently modified nucleic acid DNA density per particle D-aTNA-N2[C6] 149±19 D-aTNA-N2[FC8] 561±33 D-aTNA-N2[FC10] 208±17

[0451] <Measurement of fluorine distribution in particles>

[0452] Small-angle X-ray scattering (SAXS) is an analytical method that evaluates the structure of a substance by irradiating it with X-rays and measuring the substances that appear in the low-angle region below 2θ < 10° in the scattered X-rays. It can evaluate the shape and electron density of particles. By using this method to study the electron density state of particles formed by fluorine-modified nucleic acids in water, it is possible to clarify whether a core-shell structure is formed or the distribution of fluorine atoms in micelles.

[0453] Industrial Applicability

[0454] The present invention provides a transfection nucleic acid having cell membrane permeability brought by a perfluoroalkyl group and a method for producing the same. Since the transfection nucleic acid involved in the present invention has excellent cell membrane permeability, even siRNA can be introduced into cells without using a transfection reagent, so it is expected to be used in the medical field and the bioengineering field.

Claims

1. A nucleic acid for transfection, wherein the target nucleic acid to be introduced into a cell is linked to a cell membrane permeable group, The cell membrane permeable group is a structure represented by any one of the following general formulae (A1) to (A4), In formulas (A1) to (A3), R 0 is an alkyl group having 1 to 30 carbon atoms substituted with one or more fluorine atoms, a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of an alkyl group having 2 to 30 carbon atoms substituted with one or more fluorine atoms, an alkyl group having 10 to 30 carbon atoms not substituted with fluorine atoms, or a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of an alkyl group having 10 to 30 carbon atoms not substituted with fluorine atoms, n11, n12 and n13 are each independently an integer greater than 1, B is a nucleic acid base, and a black dot represents a bonding site, In formula (A4), R FE It is a perfluoroalkyl group having 1 to 10 carbon atoms and no oxygen atoms having ether bonds between carbon atoms, or a perfluoroalkyl group having 2 to 10 carbon atoms and 1 to 5 oxygen atoms having ether bonds between carbon atoms, na is an integer of 1 to 10, n14 is an integer greater than 1, and black dots represent bonding sites.

2. The nucleic acid for transfection according to claim 1, wherein The target nucleic acid introduced into the cell is siRNA.

3. The nucleic acid for transfection according to claim 1 or 2, wherein The R 0 It is an alkyl group having 1 to 30 carbon atoms substituted with at least 2 fluorine atoms.

4. The nucleic acid for transfection according to claim 1 or 2, wherein The R 0 It is a perfluoroalkyl group having 1 to 10 carbon atoms, or a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of a perfluoroalkyl group having 1 to 10 carbon atoms.

5. The nucleic acid for transfection according to claim 1 or 2, wherein The R 0 It is an alkyl group having 10 to 30 carbon atoms which is not substituted by a fluorine atom, or a group having 1 to 5 oxygen atoms in an ether-bonded state between carbon atoms of an alkyl group having 10 to 30 carbon atoms which is not substituted by a fluorine atom.

6. The nucleic acid for transfection according to claim 1 or 2, wherein The n11 is 2 or more, the n12 is 2 or more, the n13 is 2 or more, and the n14 is 2 or more.

7. A method for nucleic acid transfection, comprising contacting the nucleic acid for transfection according to claim 1 or 2 with cells and introducing the nucleic acid into cells.

8. A method for producing siRNA that improves cell membrane permeability, comprising: linking a cell membrane permeable group to siRNA to produce siRNA that improves cell membrane permeability. The cell membrane permeable group is a structure of the following general formula (A1), (A2) or (A3), In formulas (A1) to (A3), R 0 is an alkyl group having 1 to 30 carbon atoms substituted with one or more fluorine atoms, a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of an alkyl group having 2 to 30 carbon atoms substituted with one or more fluorine atoms, an alkyl group having 10 to 30 carbon atoms not substituted with fluorine atoms, or a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of an alkyl group having 10 to 30 carbon atoms not substituted with fluorine atoms, n11, n12 and n13 are each independently an integer greater than 1, B is a nucleic acid base, and a black dot represents a bonding site, The production method comprises the step of directly or indirectly linking the cell membrane permeable group to the sense strand of the siRNA by a phosphoramidite method using a phosphoramidite having the cell membrane permeable group as a raw material.

9. An anticancer agent comprising as an active ingredient a molecule in which a siRNA targeting an oncogene is directly or indirectly linked to a cell membrane permeable group, The cell membrane permeable group is a structure represented by any one of the following general formulae (A1) to (A4), In formulas (A1) to (A3), R 0 is an alkyl group having 1 to 30 carbon atoms substituted with one or more fluorine atoms, a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of an alkyl group having 2 to 30 carbon atoms substituted with one or more fluorine atoms, an alkyl group having 10 to 30 carbon atoms not substituted with fluorine atoms, or a group having 1 to 5 oxygen atoms with ether bonds between carbon atoms of an alkyl group having 10 to 30 carbon atoms not substituted with fluorine atoms, n11, n12 and n13 are each independently an integer greater than 1, B is a nucleic acid base, and a black dot represents a bonding site, In formula (A4), R FE It is a perfluoroalkyl group having 1 to 10 carbon atoms and no oxygen atoms having ether bonds between carbon atoms, or a perfluoroalkyl group having 2 to 10 carbon atoms and 1 to 5 oxygen atoms having ether bonds between carbon atoms, na is an integer of 1 to 10, n14 is an integer greater than 1, and black dots represent bonding sites.

Images