A siRNA nanoliposome and its application in preparing a drug for treating non-alcoholic fatty liver disease
By preparing siRNA nanoliposomes targeting ACC, various problems of ACC small molecule inhibitors in the treatment of NAFLD were solved, precise silencing and long-term inhibition of ACC were achieved, NAFLD-related indicators were reduced, and the treatment effect and safety were improved.
Patent Information
- Application Number
- CN202411979227.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2044-12-31
AI Technical Summary
Existing ACC small molecule inhibitors have problems in the treatment of non-alcoholic fatty liver disease (NAFLD), such as the inability to achieve multi-gene coordinated regulation, increased serum triglyceride levels, immunogenicity and toxic side effects, and limited efficacy and pharmacokinetic properties. In addition, siRNA delivery faces problems of poor delivery barriers and stability.
siRNA nanoliposomes that specifically target acetyl-CoA carboxylase (ACC) are prepared by microfluidics. Nanoliposomes composed of phospholipids and cholesterol are used to protect siRNA, achieving precise delivery and long-term inhibition of ACC expression.
It achieves specific silencing of ACC, reduces off-target effects and immunogenicity, improves treatment efficiency, reduces toxic side effects, has long-term effectiveness and high compliance, and significantly inhibits the levels of NAFLD-related indicators such as TG and TC.
Smart Images

Figure BDA0005221136070000101 
Figure BDA0005221136070000102 
Figure HDA0005221136080000011
Abstract
Description
(1) Technical field
[0001] The present invention belongs to the field of biomedical materials, and in particular relates to a siRNA nanoliposome and an application thereof in preparing a drug for treating non-alcoholic fatty liver disease. (2) Background technology
[0002] Non-alcoholic fatty liver disease (NAFLD) is a global epidemic closely related to metabolic disorders. Its incidence rate has been increasing year by year, and it has become one of the most common chronic liver diseases in adults and children worldwide. The disease spectrum ranges from simple hepatic steatosis to non-alcoholic steatohepatitis (NASH), cirrhosis and hepatocellular carcinoma (HCC). The pathogenesis of NAFLD is complex, involving the interaction of multiple factors such as insulin resistance, genetic susceptibility, environmental factors and lifestyle. Due to the diversity of its etiology and the complexity of its pathological process, the treatment of NAFLD faces major challenges, and there is currently no specific drug available for treatment. In addition, NAFLD is closely related to a variety of metabolic diseases such as type 2 diabetes and cardiovascular disease, which increases the complexity of treatment. Therefore, NAFLD has a wide audience, is difficult to treat, has a complex pathological mechanism, and currently lacks a radical cure.
[0003] Disrupted lipid metabolism is a key link in the pathophysiology of NAFLD. ACC (acetyl-CoA carboxylase) is located at the starting point of fatty acid synthesis and is the rate-limiting enzyme for fatty acid synthesis. Compared to other targets, it directly controls de novo fatty acid synthesis in the liver. For example, targets such as fatty acid transporters (FATPs) primarily regulate fatty acid uptake, while ACC regulates fatty acid production at the source. Targeting ACC not only reduces fatty acid synthesis but also has a comprehensive regulatory effect on metabolism. When ACC is inhibited, malonyl-CoA synthesis decreases, which relieves the inhibition of carnitine palmitoyltransferase-1 (CPT-1). CPT-1 is a key enzyme in fatty acid β-oxidation. This relief of inhibition allows more fatty acids to enter the mitochondria for oxidative breakdown. This dual regulatory effect on both fatty acid synthesis and oxidation is a unique advantage of the ACC target. In contrast, oxidative stress targets such as superoxide dismutase (SOD) primarily focus on mitigating oxidative stress-induced liver damage and have relatively weak regulatory effects on fatty acid metabolism. During the progression of NAFLD, from simple fatty liver to non-alcoholic steatohepatitis (NASH) to liver fibrosis, abnormal lipid accumulation is a persistent problem. Intervention of the ACC target can effectively regulate lipid metabolism in the early stages, thereby potentially blocking the progression of the disease to more severe stages. For example, inflammation-related targets such as nuclear factor-κB (NF-κB) mainly play a role in reducing inflammation after inflammation has occurred, while the ACC target can play a role in the early stages of liver fat accumulation, reducing fat accumulation before inflammation is initiated, preventing the occurrence of inflammation and the subsequent initiation of fibrosis. In summary, as a target for NAFLD, ACC shows significant advantages over other targets due to its core role in fatty acid synthesis, specific targeting, and improvement of liver pathology.
[0004] In the treatment of NAFLD, although small molecule inhibitors of ACC have shown the potential to improve liver steatosis, inflammation, and fibrosis, they also have some disadvantages and side effects. These disadvantages are mainly reflected in the following aspects:
[0005] (1) It is impossible to achieve multi-gene coordinated regulation; NAFLD is a complex disease involving multiple genes, involving genes related to multiple biological processes such as inflammatory response, lipid metabolism, and insulin resistance. Small molecule inhibitors have different pharmacokinetic and pharmacodynamic properties, making it difficult to achieve an appropriate concentration and duration of action in vivo. Secondly, the combined use of multiple small molecule inhibitors may increase the risk of drug interactions and lead to an increased incidence of adverse reactions.
[0006] (2) Increased serum triglyceride (TG) levels: In some clinical studies, an increase in serum triglyceride (TG) levels was observed after the use of ACC inhibitors, especially in patients with higher baseline TG levels. This side effect may be related to the reduction of polyunsaturated fatty acids (PUFA) caused by ACC inhibition, which in turn activates SREBP-1c, induces GPAT1 expression and increases in VLDL secretion. It is speculated that this may be due to the complex structure of biotin proteins such as ACC, which may have multiple similar fatty acid binding sites or other functional domains. Small molecule inhibitors are difficult to specifically inhibit its fatty acid uptake function.
[0007] (3) Immunogenicity and toxic side effects of small molecule inhibitors: ACC small molecule inhibitors have low specificity and may have certain off-target effects, which may have potential toxic side effects on the body. Moreover, as foreign substances, small molecule inhibitors may be immunogenic, thereby reducing efficacy.
[0008] (4) Limitations of efficacy and pharmacokinetics: Some small molecule inhibitors may be unable to effectively and continuously inhibit the activity of ACC due to their rapid drug metabolism, resulting in a short maintenance time of effective concentration in the body.
[0009] Therefore, in response to the shortcomings and side effects of small molecule inhibitors of ACC, researchers are exploring new treatment methods, such as using siRNA to silence ACC. siRNA technology uses the RNA interference (RNAi) mechanism to silence the expression of target genes at the post-transcriptional level, thereby playing a role in treating diseases. This method may provide a more accurate and specific treatment method, reduce side effects, and improve treatment effects. siRNA sequences can be designed for multiple key genes to intervene in the occurrence and development of diseases from multiple aspects. It can silence target gene expression through sequence specificity that is completely complementary to the target gene mRNA, and ensure drug safety and efficacy with its own high specificity. It can also use nanomaterials such as liposomes to deliver nucleic acids into cells to reduce immune response side effects, and its long-term effect reduces the frequency of administration, improves patient compliance, and achieves a long-term inhibitory effect.
[0010] As a biomacromolecule, siRNA offers significant advantages. It can target specific genes with high specificity, precisely regulating gene expression by interfering with mRNA translation. This specificity acts like a precision-guided weapon, effectively targeting disease-causing genes and demonstrating enormous potential in disease treatment. Furthermore, its mechanism of action, based on the genetic level, can address the root causes of diseases caused by abnormal gene expression. The advantages of siRNA over small molecule compounds in terms of safety and efficacy can be summarized as follows: 1) gene-specific silencing (siRNA specifically silences target gene expression through the RNAi pathway); 2) reduced off-target effects (siRNA's high specificity can reduce the silencing of non-target genes); 3) long-lasting efficacy (siRNA has a long half-life in the body and can provide long-lasting efficacy); 4) low immunogenicity (siRNA, as a nucleic acid molecule, may have lower immunogenicity than some small molecule compounds, reducing side effects caused by immune responses); 5) long-term effect and compliance (the long-term effect of siRNA reduces the frequency of dosing and improves patient compliance); 6) chemical modification and delivery system (siRNA can be improved through chemical modification and specific delivery systems (such as GalNAc conjugation) to improve its stability and targeting, reduce side effects and enhance efficacy); 7) easy detection of therapeutic effects (siRNA has a simple mechanism of action and directly degrades the mRNA of the target gene to achieve the effect of reducing target gene expression, and its effect is easily detected). These advantages make siRNA show great potential in disease treatment, especially in the precision medicine and personalized treatment of NAFLD.
[0011] However, siRNA faces numerous challenges in its application. Among them, delivery barriers are a major challenge, hindering its entry into cells and preventing it from reaching its target site. Furthermore, siRNA is susceptible to degradation by nucleases in the body, exhibits poor stability, is easily cleared from the bloodstream by the kidneys, and cannot effectively cross cell membranes. These issues limit its clinical application.
[0012] Against this backdrop, liposomes emerged as an important delivery vehicle. Liposomes are synthetic lipid bilayer microcapsules with a history dating back decades. After years of research and development, they have become a mature drug delivery system. They offer unique advantages. Firstly, their structural similarity to biological membranes allows them to fuse better with cell membranes, effectively breaking through delivery barriers and enabling siRNA to enter cells. Secondly, liposomes provide a relatively stable protective environment for siRNA, resisting degradation by nucleases, significantly improving its stability and creating more favorable conditions for siRNA to exert its therapeutic effects.
[0013] Currently, liposome-delivered siRNA drugs have been clinically approved in the field of lipid metabolism, such as Novartis's Inksilane sodium injection, a siRNA drug that effectively lowers low-density lipoprotein cholesterol (LDL-C) levels in the human body by targeting and inhibiting the PCSK9 protein, becoming the first small interfering RNA (siRNA) drug to be marketed in China. However, there are currently only a handful of siRNA drugs marketed for lipid metabolism using liposome delivery technology, especially in the field of ACC-targeted liposome siRNA delivery and disease treatment, which has not yet been achieved. This shows that there is still significant room for development in the research and development and application of siRNA drugs in the field of lipid metabolism.
[0014] Currently, liposomal siRNA delivery and disease treatment targeting acetyl-CoA carboxylase (ACC) has not yet been achieved. This is due to numerous challenges. On the one hand, to achieve precise silencing of the specific target gene ACC, it is necessary to optimize the liposome design and delivery strategy to ensure that the siRNA is effectively delivered to the target cells and exerts its effect. On the other hand, further research is needed into the pathological mechanisms of ACC-related diseases to clarify the optimal timing and method of siRNA intervention. However, with the continuous advancement of technology and the deepening of understanding of the disease, breakthroughs in liposomal siRNA delivery and disease treatment targeting ACC are expected in the future, bringing new hope for the treatment of related diseases. (3) Summary of the invention
[0015] The present invention aims to provide a siRNA nanoliposome and its use in the preparation of a drug for treating non-alcoholic fatty liver disease. The siRNA nanoliposome targeting acetyl-CoA carboxylase obtained by screening can specifically silence the ACC gene, reduce off-target effects, have long-lasting efficacy, reduce immunogenicity, have significant long-term effect and compliance, can improve treatment efficiency and reduce toxic side effects.
[0016] The technical solution adopted in the present invention is:
[0017] The present invention provides a siRNA nanoliposome, which is prepared by the following method:
[0018] (1) Lipid-ethanol solution: Dissolve lipid DLin-MC3-DMA, phosphorylcholine DSPC, plant-derived cholesterol, and DMG-PEG2000 in ethanol to prepare a lipid-ethanol solution;
[0019] (2) siRNA-citrate buffer: siRNA is added to 50 mM citric acid buffer at pH 4 to prepare siRNA-citrate buffer; the siRNA targets acetyl-CoA carboxylase;
[0020] (3) siRNA nanoliposomes: The lipid-ethanol solution in step (1) and the siRNA-citrate buffer in step (2) were filtered through a 0.22 μm filter membrane, and siRNA-encapsulated liposome nanoparticles were prepared by microfluidic mixing method, which were labeled as LNP@siACC.
[0021] Furthermore, in step (1), the molar ratio of lipid DLin-MC3-DMA, phosphorylcholine DSPC, plant-derived cholesterol, and DMG-PEG2000 is 50:10:1.5:38.5. The total concentration of solutes in the lipid-ethanol solution is 10-20 mM, preferably 12 mM.
[0022] Furthermore, the sense strand of the siRNA in step (2) is: GAGUCAAGUAUGUACUUAATT (SEQ ID NO. 1); and the antisense strand is: UUAAGUACAUACUUGACUCTT (SEQ ID NO. 2).
[0023] Furthermore, in step (2), the citric acid buffer solution was prepared as follows: 50 mL of 100 mM citric acid solution and 50 mL of sodium citrate solution were prepared using ultrapure water; 33.0 mL of citric acid solution and 17.0 mL of sodium citrate solution were taken, mixed, and sterile enzyme-free water (DEPC water) was added to make up the final volume to 50 mL to obtain a 50 mM citric acid buffer solution with a pH of 4.
[0024] Furthermore, in step (2), the final concentration of siRNA in the siRNA-citrate buffer is 0.1-1 μg / μL, preferably 0.108 μg / μL.
[0025] Furthermore, in step (3), the flow rate ratio of the lipid-ethanol solution to the siRNA-citrate buffer solution is 1:3.
[0026] Furthermore, step (3) uses a microfluidic mixing method to prepare siRNA-encapsulated liposome nanoparticles, comprising: passing the filtered lipid-ethanol solution and siRNA-citrate buffer into a micromixer at flow rates of 0.6 mL / min and 1.8 mL / min, respectively; ultrafiltration and centrifugation of the mixed effluent; and collecting the precipitate to obtain the siRNA-encapsulated liposome nanoparticles. The amount of the lipid-ethanol solution is calculated based on the molar amount of lipid, the amount of the siRNA-citrate buffer is calculated based on the molar amount of siRNA, and the lipid to siRNA molar ratio is 6:1.
[0027] The present invention also provides an application of the siRNA nanoliposome in preparing an acetyl-CoA carboxylase inhibitor.
[0028] The present invention also provides an application of siRNA nanoliposomes in the preparation of a drug for treating non-alcoholic fatty liver disease. The drug can target intracellular acetyl-CoA carboxylase, inhibit the expression of acetyl-CoA carboxylase, and reduce lipid synthesis, TG, and TC content.
[0029] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:
[0030] (1) The siRNA screened by the present invention can target acetyl-CoA carboxylase in cells, inhibit the expression of acetyl-CoA carboxylase, and reduce the levels of TG and TC.
[0031] (2) The siRNA nanoliposomes prepared by the present invention have little toxicity and side effects and good stability.
[0032] The siRNA nanoliposomes prepared by the present invention are primarily composed of components such as phospholipids and cholesterol. In the body, phospholipids are broken down by phospholipases into products such as fatty acids and lysophospholipids, which can be absorbed to provide energy or participate in cell membrane synthesis. Cholesterol is metabolized in the liver and converted into bile acids, which can also be taken up by cells to maintain normal physiological functions or synthesize steroid hormones. Therefore, the components of the liposomes can be metabolized in the body, avoiding the toxic side effects of small molecule inhibitors. Before contacting the cell membrane, the siRNA nanoliposomes prepared by the present invention, thanks to the vesicular structure of the phospholipid bilayer and the regulatory effect of cholesterol on membrane fluidity, can maintain a relatively intact morphology and a certain degree of physical stability in environments such as aqueous solutions, protecting the encapsulated siRNA from degradation.
[0033] (3) The preparation process of the siRNA nanoliposomes of the present invention is efficient and reproducible, and can achieve continuous and automated production.
[0034] The present invention uses a microfluidic method to prepare siRNA nanoliposomes, which can accurately control the size, morphology, and lipid composition of the liposomes, have good monodispersity, and the preparation process is efficient and reproducible, enabling continuous and automated production. The microfluidic equipment and its chip are from Suzhou Zhongxin Qiheng Scientific Instrument Co., Ltd. The instrument is Zhongxin Qiheng Cchippump-02 dual-channel split injection pump, and the chip is Zhongxin Qiheng micro-hybrid liposome chip ZX-LS-31
[0035] (4) The siRNA nanoliposomes of the present invention can specifically silence intracellular acetyl-CoA carboxylase, reduce off-target effects, have long-lasting efficacy, reduce immunogenicity, and have significant long-term efficacy and compliance, thereby improving treatment efficiency and reducing toxic side effects.
[0036] The siRNA nanoliposomes of the present invention were incubated with HepG2 cells in vitro and were able to significantly inhibit the growth of intracellular lipid droplets. NAFLD is characterized by changes in lipid droplet content in in vitro experiments, so it is believed that the drug can play a role in alleviating NAFLD. Compared with the small molecule inhibitors, traditional Chinese medicine and other drugs currently used in clinical practice, the present invention highlights the advantage of efficient inhibition. (IV) Description of the accompanying drawings
[0037] Figure 1 , Zeta potential diagram of LNP@siNC.
[0038] Figure 2 , particle size distribution of LNP@siNC.
[0039] Figure 3 , nucleic acid release curves of LNP@siNC changing with time in different pH environments.
[0040] Figure 4 , LNP@siNC particle size and potential change curves under different storage temperatures; A and C represent the particle size and potential changes under freeze-drying conditions; B and D represent the particle size and potential changes at 25, 4, -20, and -80℃.
[0041] Figure 5 , Confocal micrographs of LNP@siNC uptake by HepG2 cells at different incubation times.
[0042] Figure 6 , Bar graphs of ACC mRNA (A) and FASN mRNA expression levels (B) after HepG2 cells were incubated with LNP@siRNA of different sequences.
[0043] Figure 7 , Bar graphs of ACC mRNA (A) and FASN mRNA expression levels (B) after HepG2 cells were incubated with different concentrations of LNP@siACC2.
[0044] Figure 8 , Western blot images (A) and bar graph of ACC protein expression (B) after HepG2 cells were incubated with different concentrations of LNP@siACC2.
[0045] Figure 9 , Western blot image (A) and ACC / GAPDH content ratio curve (B) after HepG2 cells were incubated with 50nM concentration of LNP@siACC2 for different times.
[0046] Figure 10 , Confocal microscopy images of HepG2 cells after incubation with different concentrations of LNP@siACC2.
[0047] Figure 11 , Oil Red staining micrographs of HepG2 cells after incubation with different concentrations of LNP@siACC2 and bar graph of relative content of red oil.
[0048] Figure 12 , bar graphs of TG (A) and TC (B) contents of HepG2 cells after incubation with different concentrations of LNP@siACC2. (V) Specific implementation methods
[0049] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:
[0050] The materials for preparing lipid nanoparticles in the embodiment of the present invention were purchased from Source Leaf Biotechnology; DLin-MC3-DMA is chemically named 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester, and its molecular formula is: 43 H 79 NO 2,, CAS No.: 1224606-06-7; DSPC chemical name is distearoylphosphatidylcholine, molecular formula C 44 H 88 NO8P, CAS No.: 816-94-4;, molecular formula C 27 H 46 O, CAS number: 57-88-5; DMG-PEG2000 chemical name 1,2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol 2000, molecular formula: C 122 H 242 O 50, CAS number: 160743-62-4.
[0051] Example 1. Design of siRNA
[0052] To ensure the reliability of experimental results and eliminate the possibility of accidental siRNA knockdown, we designed three siRNAs to identify the most effective one. The principles of siRNA design are as follows: 1. siRNAs are designed to target specific regions, often within the 3' untranslated region (3'UTR) and the coding region (CDS). The 3'UTR region is often rich in siRNA recognition sequences and is less prone to repetitive or excessive secondary structure. 2. Ensure that the target sequence does not contain common single-nucleotide polymorphisms (SNPs). 3. Ideally, the siRNA sequence should have a GC content of 40%-60%. 4. The selected siRNA sequence should be highly specific for the target gene. The BLAST tool can be used to check the specificity of the siRNA sequence. 5. Avoid regions with repetitive sequences, as these may lead to nonspecific silencing or induce an immune response. Based on this, the three designed siRNAs are designated siACC1, siACC2, and siACC3. A non-target siRNA was also designed as a negative control, designated NCRNA. siRNA can silence target genes to varying degrees, while ncRNA does not have silencing function.
[0053] siACC1
[0054] Sense strand: CCCUCCGAGAAGAGAAUAATT (SEQ ID NO. 3);
[0055] Antisense strand: UUAUUCUCUUCUCGGAGGGTT (SEQ ID NO. 4).
[0056] siACC2
[0057] Sense chain: GAGUCAAGUAUGUACUUAATT (SEQ ID NO. 1);
[0058] Antisense strand: UUAAGUACAUACUUGACUCTT (SEQ ID NO. 2).
[0059] siACC3
[0060] Sense strand: GGGCUUAUAUUGCCUAUGATT (SEQ ID NO. 5);
[0061] Antisense strand: UCAUAGGCAAUAUAAGCCCTT (SEQ ID NO. 6).
[0062] NCRNA
[0063] Sense strand: UUUGUGCAAUCCUUUCUCUCCU (SEQ ID NO. 7);
[0064] Antisense strand: AGAAGAAAG GAUUUGGCUACAAA (SEQ ID NO. 8).
[0065] Example 2: Preparation of siRNA-encapsulated nanoliposomes
[0066] (1) Lipid-ethanol solution
[0067] DLin-MC3-DMA, DSPC, plant-derived cholesterol, and DMG-PEG2000 were dissolved in ethanol at a molar ratio of 50:10:38.5:1.5 to prepare a lipid-ethanol solution with a solute concentration of 12 mM (about 7.5 mg / mL), which was filtered before use.
[0068] (2) siRNA-citrate buffer
[0069] Prepare 50 mL each of 100 mM citric acid solution and sodium citrate solution using ultrapure water. Mix 33.0 mL of citric acid solution and 17.0 mL of sodium citrate solution, add sterile enzyme-free water (DEPC water) to a final volume of 50 mL. Let stand at room temperature for 30 minutes, then autoclave to remove DEPC. After sterilization, dilute to 100 mL with DEPC water to obtain 50 mM citric acid buffer, pH 4.
[0070] siRNA1, siRNA2, siRNA3, and NCRNA synthesized in Example 1 were added to 50 mM citric acid buffer at pH 4 to prepare 0.108 μg / μL siRNA-citric acid buffer.
[0071] (3) Liposomal nanoparticles encapsulating siRNA
[0072] The lipid-ethanol solution in step (1) was filtered through a 0.22 μm filter membrane, 0.8 mL of the filtrate was drawn into a 1 mL syringe, and the air in the syringe was expelled to prepare the lipid-ethanol solution sample.
[0073] The RNA-citrate buffer solution prepared in step (2) was filtered through a 0.22 μm filter membrane, 2.4 mL was drawn into a 3 mL syringe, and the air in the syringe was expelled to prepare the RNA-citrate buffer solution sample.
[0074] A lipid-ethanol solution sample was passed through a micromixer at a flow rate of 0.6 mL / min, and an RNA-citrate buffer sample was passed through a micromixer at a flow rate of 1.8 mL / min (total phospholipid concentration and siRNA were in a ratio of N:P = 6:1). As the lipid solution and aqueous solution mixed and emulsified, the lipid molecules spontaneously formed a bilayer structure at the aqueous interface, encapsulating the aqueous phase to form liposomes. The effluent was collected and ultrafiltered using a Milipore 30KD ultrafiltration tube. The filtrate was centrifuged at 3000 g for 20 minutes to remove impurities such as unencapsulated drug and organic solvent. The precipitate was purified siRNA-encapsulated liposomal nanoparticles, designated LNP@siACC1, LNP@siACC2, LNP@siACC3, and LNP@siNC, respectively.
[0075] Example 3: Measurement of particle size, potential, and encapsulation efficiency of siRNA-encapsulated liposome nanoparticles
[0076] For cost-saving considerations, before verifying the silencing effect, LNP@siNC was uniformly used to measure the particle size, potential, and encapsulation efficiency to evaluate the siRNA-encapsulated liposome nanoparticles prepared in Example 2.
[0077] 1. Zeta potential and particle size
[0078] 1 mL of 1 μM LNP@siNC prepared in Example 2 was dispersed in 1 mL of ultrapure water to ensure particle stability during measurement. The sample was then added to the sample cell of a dynamic light scattering instrument (Malvern Panalytical, model ZS30). Care was taken to avoid bubbles and ensure uniform sample distribution. The sample cell was placed in the measurement position of the dynamic light scattering instrument. After the instrument stabilized, particle size and zeta potential were measured. These measurements provide key data for evaluating the physical properties and stability of liposomes, as well as their performance in applications such as drug delivery. Specific instrument parameters are as follows: measurement temperature 25°C, dispersion medium water, Dispersant RI 1.330, Viscosity (cP) 0.8872, and Measurement Position (mm) 4.65. Three parallel measurements were performed to ensure data reliability.
[0079] Zeta potential Figure 1 As shown, the particle size Figure 2 As shown, the average zeta potential of LNP@siNC is -0.213 mV and the average particle size is 218 nm, which meets the requirements of liposomes (potential range is 0±40 mV and particle size range is 30-300 nm).
[0080] 2. Encapsulation efficiency
[0081] The liposome encapsulation efficiency was measured by fluorescent dye detection using Quant-iT TM The RNA kit was used for detection, and the QuantiT TM Reagen is an ultrasensitive fluorescent nucleic acid stain that can detect 1-200 ng of nucleic acid in solution. This nucleic acid dye is impermeable to LNPs, so only free nucleic acid not encapsulated by the LNPs can be bound. Triton-100, a surfactant commonly used as a demulsifier, is used to treat the LNP-siNCs with 1% Triton-100, which releases the encapsulated nucleic acid and determines the total nucleic acid content. The encapsulation efficiency is calculated by calculating the difference in nucleic acid content before and after demulsification and dividing it by the total nucleic acid content.
[0082] Nucleic acid standard curve: According to the kit instructions, dilute 20×TE with DEPC water to 1×TE; dilute Quant-iT TM The RNA standard in the RNA kit was diluted to two final concentrations: 2 μg / mL and 100 ng / mL. The QuantiT TM Reagen was diluted to 200-fold and 2000-fold final concentrations. A standard curve with and without Triton-100 was also prepared. Reagents were added to CellCarrier-96 UltraMicroplates according to Tables 1 and 2. Fluorescence intensity was measured using a Biotek Synergy H1 Microplate Reader (multi-function microplate reader) with excitation set to 480 nm and emission set to 520 nm. A standard curve was plotted with RNA concentration as the horizontal axis and absorbance as the vertical axis.
[0083] Table 1
[0084]
[0085] Table 2
[0086]
[0087] Liposome encapsulation efficiency detection:
[0088] LNP demulsification: Triton-100 was diluted to 2% with 1×TE, 100 μL was added to CellCarrier-96 UltraMicroplates, and then 1 μL of LNP-siNC prepared in Example 1 was added. The mixture was treated for 5 minutes, and 100 μL of 200-fold diluted quant-iTRiboGreen Reagent was added.
[0089] LNP free nucleic acid assay: 100 μL of 1×TE was added to the CellCarrier-96 Ultra Microplates, along with 1 μL of the prepared LNP demulsification solution. The mixture was then mixed and 100 μL of 12000-fold diluted quant-iTRiboGreen Reagent was added. Fluorescence intensity was read using a Biotek Synergy H1 Microplate Reader (multi-function microplate reader) with the excitation set at 480 nm and the emission set at 520 nm. The encapsulation efficiency of the prepared siRNA-encapsulated liposome nanoparticles was calculated to be 82.09% based on the standard curve.
[0090] Example 4: Release of siRNA from liposome nanoparticles encapsulating siRNA at different pH values
[0091] 1. PBS, pH 7.0
[0092] A sterile centrifuge tube was used as a release container. 1 mL of 1 μM LNP@siNC prepared according to the method of Example 2 and 1 mL of pH 7.0 PBS were added to simulate the physiological environment of pH 7.0. The pH value was maintained with hydrochloric acid or sodium hydroxide. 100 μL samples were taken at 0 h, 0.5 h, 1 h, 2 h, 4 h, 8 h, 12 h, and 24 h, respectively. Five parallel samples were set up at each time point. The samples were added to CellCarrier-96Ultra Microplates, and the free nucleic acid content was detected using the method of Example 3. The curve of the nucleic acid release amount over time was plotted. The results are shown in the figure. Figure 3 shown.
[0093] 2. PBS, pH 5.0
[0094] In step 1, replace the pH 7.0 in PBS with pH 5.0. Other operations remain the same.
[0095] Nucleic acid release curves Figure 3As time goes by, the release of LNP@siNC in pH 7.0 and pH 5.0 buffers gradually increases. The release at pH 7.0 increases from 0.56% of the total nucleic acid amount in the first 0.5h to 9.24% in the final 24h; the release at pH 5.0 increases from 0.72% of the total nucleic acid amount in the first 0.5h to 17.36% in the final 24h. Although their release gradually increases, it is still a small amount compared to the release amount of liposomes endocytosed by the cell membrane.
[0096] Small amounts of nucleic acids were released under physiological conditions (pH 7.0) and slightly acidic conditions (pH 5.0), indicating that the bilayer structure of liposomes can effectively maintain its integrity under these conditions. This provides an important advantage for liposomes as drug carriers, namely, they can effectively transport drugs to target sites within cells. Before fusing with the cell membrane, liposomes can protect drugs from premature release, reduce drug loss in non-target sites, and thus improve drug delivery efficiency.
[0097] Example 5: Stability of siRNA-encapsulated liposome nanoparticles
[0098] 1 mL, 1 μM LNP@siNC prepared according to the method of Example 2 was dispersed in 1 mL of PBS at pH 7.0 and divided into five groups. The samples were placed under different temperature conditions (-80°C, -20°C, 4°C, 25°C, and freeze-dried). Freeze-drying refers to the use of a vacuum freeze dryer (Kewanda ZLGJ-18). Samples were taken from each group on the first, second, third, fourth, fifth, and sixth days. After the samples were taken, they were allowed to stand at room temperature for 15 minutes to allow the samples to adapt to the external environment and avoid the impact of rapid temperature changes on the measurement results. The particle size and zeta potential were measured using the method of Example 3. The curves of particle size and potential change over time were plotted with time as the horizontal axis and particle size and potential as the vertical axis. The decay of particle size and zeta potential at different temperatures was analyzed.
[0099] like Figure 4 As shown, it can be seen that the particle size and potential of LNP@siNC at -80°C remain basically unchanged. The higher the temperature, the smaller the particle size of the liposomes and the larger the charge fluctuation. Therefore, it is believed that low temperature conditions (such as -80°C and -20°C) are generally beneficial to maintaining the stability of liposomes, because low temperature can slow down the aggregation and fusion of liposomes and reduce drug leakage. Higher temperatures (such as 25°C) may accelerate the degradation of liposomes and drug leakage, affecting their stability. By comprehensively considering the changes in particle size and potential at different temperatures, the most stable storage conditions for liposomes are determined: short-term storage can be stored at -20° to avoid repeated freezing and thawing. For long-term storage, freeze-drying is recommended to maintain the encapsulation effect to the greatest extent.
[0100] Example 6: Confocal microscopy observation of HepG2 cells' uptake of siRNA-encapsulated liposome nanoparticles
[0101] 1. LNP@siNC complex labeled with CY3 fluorescent tag
[0102] NCRNA is labeled with CY3 fluorescent tags. CY3 is a commonly used fluorescent dye with good fluorescence properties and photostability. They are complexed with specific groups on siRNA to form CY3-labeled siRNA, which is recorded as LNP@siNC-CY3.
[0103] 2. Uptake of LNP@siNC by HepG2 cells
[0104] HepG2 cells in the logarithmic growth phase were taken and the cells were plated at an appropriate density (1×10 4 ) were inoculated into confocal glass-bottom cell culture dishes containing DMEM high-glucose culture medium (purchased from Zhejiang Senrui Biotechnology Co., Ltd., product number CR-12800, hereinafter referred to as DMEM culture medium). The confocal cell culture dish was then placed in a cell culture incubator and cultured at 37°C and 5% CO2 for 12 hours to allow the cells to adhere and grow to an appropriate density. The old culture medium in the culture dish was discarded, and 1 mL of DMEM culture medium containing 50 nM LNP@siNC-CY3 was added. The cell culture dish was then returned to the cell culture incubator and samples were taken at different time points (0.5 h, 4 h, 12 h, and 24 h). The cells were gently washed three times with PBS (pH 7.0) preheated at 37°C to remove unabsorbed complexes. 4% PFA (4% paraformaldehyde solution) was added and the cells were fixed at room temperature for 15-20 minutes. During the fixation process, ensure that the 4% PFA completely covers the cells. The 4% PFA was aspirated and the cells were washed three times with PBS for 5 minutes each to remove residual PFA. Add DAPI staining solution to stain the cell nuclei for 10 minutes at 25°C. The working concentration of DAPI is determined according to the product instructions, generally 1-5 μg / mL. Aspirate the DAPI staining solution and wash the cells three times with PBS for 5 minutes each. Then, add an appropriate amount of PBS to keep the cells moist. Observe using a Leica laser scanning confocal microscope, setting the excitation wavelength to 550 nm and the emission wavelength to 570 nm.
[0105] The results are as follows Figure 5Over time, the red color of the CY3 labeling gradually increased. Compared with the control group (not transfected with LNP@siRNA), the experimental group (transfected with LNP@siRNA) was essentially taken up by all cells in the field of view after 24 hours, as evidenced by the red surrounding the blue nuclei labeled with DAPI. These experimental results demonstrate that the delivered liposomal LNP@siNC was almost completely taken up by HepG2 cells within 24 hours.
[0106] Example 7: Effect of siRNA sequence on ACC knockout
[0107] HepG2 cells were cultured at 5×10 4 Cells were seeded at a density of 10 cells / well in a 12-well plate supplemented with 1 mL of DMEM medium and cultured in a 37°C, 5% CO2 incubator for 12 hours. Once the cells reached a density of 60-70%, five groups were set up: untreated control (Control), experimental group 1 (LNP@siACC1), experimental group 2 (LNP@siACC2), experimental group 3 (LNP@siACC3), and a negative control group (LNP@siNC). Three replicates were set up for each group.
[0108] The three experimental groups were each added with 1 mL of DMEM medium containing 100 nM LNP@siACC1, LNP@siACC2, and LNP@siACC 3 prepared according to the method of Example 2. The negative control group was added with 1 mL of DMEM medium containing 100 nM LNP@siNC.
[0109] After culturing each culture plate in an incubator at 37°C and 5% CO2 for 24 hours, cells from each group were collected and total RNA was extracted using an RNA extraction kit to ensure the purity and integrity of the RNA. TM The extracted total RNA was reverse transcribed into cDNA using the PCR amplification kit (from Biotech Co., Ltd., catalog number D7168S). GAPDH was used as the endogenous gene, and the Ct values of ACC mRNA, FASN mRNA, the downstream gene of ACC, and endogenous gene GAPDH in each group were detected by RT-qPCR using primers for ACC mRNA detection and primers for FASN mRNA detection and GAPDH detection.
[0110] RT-qPCR reaction system: HRbio TMqPCR SYBR Green Master Mix 5μL, Forward Primer 0.2μL, Reverse Primer 0.2μL, template DNA 2μL (product from Fujian Herui Biotechnology Co., Ltd., product number HRF0051), and then add sterile and enzyme-free water to 10μL.
[0111] RT-qPCR assay procedure: Pre-denaturation at 95°C for 5 minutes fully denatures the template DNA and activates the Taq enzyme. Denaturation at 95°C for 10-30 seconds melts the double-stranded DNA into single strands. Annealing at 55°C-60°C for 20 seconds allows primers to bind specifically to the template. Extension at 72°C for 20 seconds allows the Taq enzyme to synthesize new DNA strands using dNTPs. Each cycle consists of denaturation, annealing, and extension, and 40 cycles are repeated.
[0112] Primers for ACC mRNA detection:
[0113] Forward 5'-GCAAAGACCATTAGAGGTAGCC-3'
[0114] Reverse 5'-TTGCTGTAGAAACCCGAACC-3'.
[0115] Primers for FASN mRNA detection:
[0116] Forward 5'-TACGATGGTCACCCTCAATG-3'
[0117] Reverse 5'-TGCTGCCGTGTCCTTCTACT-3'.
[0118] Primers for GAPDH detection:
[0119] Forward 5'-GCAAATTCCATGGCACCGT-3'
[0120] Reverse 5'-GCAAATTCCATGGCACCGT-3'
[0121] The relative gene expression changes were determined by the ΔΔCT method. The ACC gene expression levels in the experimental group and the control group were compared, and the mean values of each group were taken. The results are shown in Figure 6 shown.
[0122] ΔCt=Ct(target gene)-Ct(reference gene)
[0123] ΔΔCt=ΔCt(experimental group)-ΔCt(control group)
[0124] Figure 6 As can be seen, at the mRNA level, LNP@siACC1 knocked down ACC by 39.07% and FASN by 28.76%. LNP@siACC2 knocked down ACC by 65.33% and FASN by 59.33%. LNP@siACC3 knocked down ACC by 47.12% and FASN by 30.7%. This demonstrates that among the three siRNAs we designed, siRNA2 was the most effective in knocking down the adipogenesis-related gene ACC and the downstream gene FASN. Therefore, we used siRNA2 as the default sequence for subsequent experiments.
[0125] Example 8: Effect of LNP@siACC2 concentration on knockdown of target gene ACC and downstream gene FASN
[0126] HepG2 cells were cultured at 5×10 4 Cells were seeded at a density of 10 cells / well in 12-well plates supplemented with 1 mL of DMEM medium and cultured in a 37°C, 5% CO2 incubator for 12 hours. Once cells reached a density of 60-70%, the culture medium was discarded. Five groups were set up: untreated control (Control), 25 nM experimental group, 50 nM experimental group, 100 nM experimental group, and negative control (NC). Three replicates were set up for each group.
[0127] The untreated control group received 1 mL of DMEM medium, while the experimental groups received 1 mL of DMEM medium containing LNP@siACC2 prepared according to Example 2 at final concentrations of 25, 50, and 100 nM, respectively. The negative control group received 1 mL of DMEM medium containing LNP@siNC prepared according to Example 2 at a final concentration of 100 nM. The Ct value assay for each group was performed using the same method as in Example 7.
[0128] Figure 7 It can be seen that at 25nM, intracellular ACC was knocked down by 56.38% at the mRNA level, at 50nM, intracellular ACC was knocked down by 68.45%, and at 100nM, intracellular ACC was knocked down by 77.49%. FASN, a downstream gene of ACC, was knocked down by 38.91% at the mRNA level at 25nM, 46.24% at 50nM, and 38.57% at 100nM. This demonstrates that the LNP@siACC2 prepared in Example 2 successfully knocked down ACC and its downstream FASN genes, and that the effect of inhibiting adipogenesis-related genes by knocking down the ACC gene was significant.
[0129] Example 9: Western blotting observation of the lipid deposition inhibitory effect of LNP@siACC2
[0130] In order to further clarify the effect of LNP@siACC2 on lipid synthesis induced by DMEM medium containing 1mM free fatty acids (FFA medium for short), we detected the expression of related proteins in HepG2 cells. In the study of in vitro NAFLD (non-alcoholic fatty liver disease) models, we often use FFA (free fatty acid) medium to simulate the disease type. Palmitic acid (PA) and oleic acid (OA) were selected for combined induction to mimic the mixed state of fatty acids in the human body. They can induce fat accumulation in hepatocytes and simulate the occurrence and progression of NAFLD. That is, HepG2 cells were cultured in the presence of 1mM free fatty acids (FFA, containing oleic acid and palmitic acid, with a volume ratio of 2:1) and then used for specified assays. FFA medium refers to DMEM medium containing 1mM free fatty acids.
[0131] HepG2 cells were cultured at 5×10 4 Cells were seeded at a density of 10 cells / well in a 12-well plate containing 1 mL of DMEM medium and cultured in a 37°C, 5% CO2 incubator for 12 hours. Once the cells reached a density of 60-70%, the plate was divided into five groups: an untreated control group (Control), a 25 nM experimental group, a 50 nM experimental group, a 100 nM experimental group, and a negative control group (NC). Three replicates were set up for each group.
[0132] The old DMEM medium was discarded from each culture well. 1 mL of FFA medium was added to the untreated control group, and 1 mL of FFA medium containing LNP@siACC2 prepared by the method of Example 2 was added to each experimental group, resulting in final LNP@siACC2 concentrations of 25 nM, 50 nM, and 100 nM, respectively. The negative control group was added with 1 mL of FFA medium containing LNP@siNC prepared by the method of Example 2, resulting in a final LNP@siNC concentration of 100 nM.
[0133] Each group of culture plates was cultured in an incubator at 37°C and 5% CO2 for 48 h.
[0134] The total cellular protein of each sample was extracted using RIPA lysis buffer (Biyuntian Biotechnology Co., Ltd., catalog number P0013B) and quantified using a BCA protein kit (from Sangon Biotechnology Co., Ltd., catalog number C503051-0500). Equal amounts of protein from each group of total cellular proteins were separated using 6% SDS-PAGE, then transferred to the membrane at 250 mA for 3 hours, and blocked with TBST buffer containing 5% skim milk powder for 2 hours. The membrane was then probed with primary antibodies against GAPDH (1:1000) and ACC (1:1000), respectively. The membrane was incubated with the primary antibody at 4°C overnight, washed with TBST, and incubated with the secondary antibody at room temperature for 2 hours. The secondary antibody was mouse secondary antibody labeled GAPDH (1:1000) and rabbit secondary antibody labeled ACC (1:1000). Using ChemiDoc TM Imaging system (from Bio-Rad product number 12018025) was used to detect and quantify protein signals. Figure 8 A and B.
[0135] Figure 8 The results showed that when the LNP@siACC2 concentration in the experimental group was 25nM, the expression level of ACC protein decreased to 43.16% of the normal level; when the LNP@siACC2 concentration was 50nM, the expression level of ACC protein decreased to 31.74% of the normal level; and when the LNP@siACC2 concentration was 100nM, the expression level of ACC protein decreased to 26.79% of the normal level. These results are basically consistent with the results observed at the mRNA level, indicating that LNP@siACC2 can knock down ACC gene expression, inhibit lipid synthesis, and thus can be used to alleviate and reduce lipid accumulation in hepatocytes.
[0136] Example 10: Western blotting observation of the time-effect of LNP@siACC2's inhibitory effect on ACC protein levels
[0137] Based on the previous experimental results and the experimental cost, we finally selected 50nM LNP@siACC2 to verify the inhibitory effect of siRNA.
[0138] HepG2 cells were cultured at 5×10 4Cells were seeded at a density of 10 cells / well in a 12-well plate with 1 mL of DMEM medium and cultured in a 37°C, 5% CO2 incubator for 12 hours. Once the cells reached a density of 60-70%, the old DMEM medium was discarded and three groups were set up: an untreated control group (Control), a 50 nM experimental group, and a negative control group (NC). Three replicates were performed in each group. The untreated control group was treated with 1 mL of DMEM medium, while the 50 nM experimental group was treated with 1 mL of DMEM medium containing LNP@siACC2 prepared according to Example 2 at a final concentration of 50 nM. The negative control group was treated with 1 mL of DMEM medium containing LNP@siNC prepared according to Example 2 at a final concentration of 100 nM.
[0139] Each group of culture plates were cultured in an incubator at 37°C and 5% CO2 for 1-8 days. Samples were taken from the control and NC groups on the first day, and from the experimental group every day. Western blotting was performed using the method of Example 8. The results are shown in Table 1. Figure 9 A, while the experimental group used the method of Example 8 to quantify protein content, the ACC / GAPDH content ratio is shown in Figure 9 Middle B.
[0140] Figure 9 It can be seen that the expression level of ACC protein did not decrease significantly on the first day of transfection in the experimental group, but dropped sharply on the second day and maintained until the eighth day. The effect was most obvious on the fifth day, when the protein level dropped to 18%, and then began to recover slowly, indicating that LNP@siACC can maintain the gene silencing of ACC for one week.
[0141] Example 11: Confocal Observation of the Inhibitory Effect of LNP@siACC2 on FFA-Induced Lipid Droplet Growth in HepG2 Cells
[0142] HepG2 cells were cultured at 5×10 4 Cells were seeded at a density of 10 cells / well in a 12-well plate supplemented with 1 mL of DMEM medium. Cultured for 12 hours in a 37°C, 5% CO2 incubator. Once cells reached 60-70% density, the old DMEM medium was discarded. Five groups were set up: untreated control (Control), 25 nM experimental group, 50 nM experimental group, 100 nM experimental group, and model group (Model). Three replicates were set up for each group.
[0143] The untreated control group was added with 1 mL of DMEM medium. The experimental groups were respectively added with 1 mL of DMEM medium containing different concentrations of LNP@siACC2, so that the final concentrations of LNP@siACC2 were 25 nM, 50 nM, and 100 nM, respectively. The model group (Model) was added with 1 mL of FFA medium. After each group was cultured for 24 hours, the untreated control group was replaced with 1 mL of fresh DMEM medium, and the 25 nM experimental group, 50 nM experimental group, 100 nM experimental group, and model group were all replaced with 1 mL of FFA medium (same as in Example 9) to verify the induction of new lipid droplets by FFA medium after knocking down the ACC gene.
[0144] After incubating each culture plate in a 37°C, 5% CO2 incubator for 24 hours, the original culture medium was discarded and the Bodipy staining solution in the lipid droplet green fluorescence detection kit (BODIPY 493 / 503) was added to cover the sample. The sample was stained in the dark for 20 minutes, the Bodipy staining solution was removed by aspiration, and the sample was washed 2-3 times with PBS and observed directly under a confocal microscope. Figure 10 As shown, cells in the control group exhibited faint green fluorescence, indicating a lower fat content. Cells in the model group exhibited stronger green fluorescence, indicating a high level of lipid accumulation. Compared to the model group, the experimental groups, treated with LNP@siACC, displayed varying intensities of green fluorescence, indicating varying degrees of lipid droplet inhibition. LNP@siACC2 knockdown of the ACC gene effectively inhibited lipid deposition in hepatocytes.
[0145] Example 12: Oil Red staining to observe the inhibitory effect of LNP@siACC2 on lipid deposition
[0146] HepG2 cells were cultured at 5×10 4 Cells were seeded at a density of 10 cells / well in a 12-well plate supplemented with 1 mL of DMEM medium. Cultured for 12 hours in a 37°C, 5% CO2 incubator. Once cells reached 60-70% density, the old DMEM medium was discarded. Five groups were set up: untreated control (Control), 25 nM experimental group, 50 nM experimental group, 100 nM experimental group, and model group (Model). Three replicates were set up for each group.
[0147] The untreated control group was added with 1 mL of DMEM culture medium. The experimental groups were respectively added with 1 mL of DMEM culture medium containing different concentrations of LNP@siACC2, so that the final concentrations of LNP@siACC2 were 25 nM, 50 nM, and 100 nM. The model group (Model) was added with 1 mL of FFA culture medium (same as Example 9). After each group continued to culture for 24 hours, the untreated control group was replaced with 1 mL of fresh DMEM culture medium, and the 25 nM experimental group, 50 nM experimental group, 100 nM experimental group, and model group were all replaced with 1 mL of FFA culture medium.
[0148] Oil Red staining was used to verify the effect of FFA culture medium on lipid deposition in hepatocytes after knockdown of the ACC gene.
[0149] After incubating each culture plate in a 37°C, 5% CO2 incubator for 24 hours, the original culture medium was discarded, and the cells were rinsed three times with PBS. The cells were fixed with a universal tissue fixative (from Sewell Biotech, catalog number G1101-500ML) for 15 minutes. The fixative was discarded and Oil Red O working solution (purchased from Sigma, catalog number O0625-25g) was added. The cells were stained in the dark for 15 minutes. The Oil Red O working solution was discarded, and the cells were differentiated with 75% alcohol for 2 seconds. The cells were rinsed with tap water for 1 minute, observed under a microscope, and photographed. The results are shown in the figure. Figure 11 .
[0150] After imaging, discard the liquid to minimize residual liquid. Add an equal volume of 60% isopropanol solution to each well of the culture plate and shake for 5-10 minutes to fully dissolve the Oil Red O in the cells. Aspirate a predetermined volume of the Oil Red O solution into a 96-well plate and use the 60% isopropanol solution as a blank to zero the plate. Measure the absorbance of each well at 520 nm and calculate the Oil Red O content in each well.
[0151] like Figure 11 As shown, the cells in the control group showed minimal Oil Red O staining in the staining images, but cells in the model group showed significant Oil Red O staining, with significant accumulation of Oil Red O dye, indicating significant lipid accumulation within the cells of the model group. Compared with the model group, the degree of Oil Red O staining in the experimental group gradually decreased with increasing LNP@siACC2 concentration. Quantitative analysis of Oil Red O revealed that Oil Red O content in the model group increased approximately twofold compared with the control group. However, Oil Red O content in the experimental group decreased significantly compared with the model group, with a significant decrease of 24.16% at 25 nM, 48.19% at 50 nM, and 55.23% at 100 nM. These results demonstrate that knocking down the ACC gene ameliorates free fatty acid-induced lipid deposition in hepatocytes.
[0152] Example 13: Determination of intracellular TG and TC content to verify the inhibitory effect of LNP@siACC on lipid deposition
[0153] HepG2 cells were cultured at 5×10 4 Cells were seeded at a density of 10 cells / well in a 12-well plate supplemented with 1 mL of DMEM medium. After incubation at 37°C, 5% CO₂ for 12 hours, the old DMEM medium was discarded when the cells reached 60-70% density. Seven groups were set up: untreated control group (Control), 25 nM experimental group, 50 nM experimental group, 100 nM experimental group, model group (Model), and positive control drug group. Three replicates were set up for each group.
[0154] Untreated control group adds 1mL DMEM culture medium.Experimental group adds the DMEM culture medium of 1mL containing variable concentrations LNP@siACC2 respectively, makes LNP@siACC2 final concentration be respectively 25nM, 50nM, 100nM.Model group (Model) adds 1mL FFA culture medium (same as embodiment 9).Positive control drug group adds the DMEM culture medium of 1mL containing final concentration 1.8 μM positive drug (positive drug is a kind of known acetyl-CoA carboxylase (ACC) inhibitor, purchased from MCE, CAS number is 591778-68-6).Each group continues to cultivate after 24 hours, and untreated control group changes 1mL fresh DMEM culture medium, and 25nM experimental group, 50nM experimental group, 100nM experimental group, model group and positive control drug group all replace with 1mL FFA culture medium.
[0155] After culturing each group of culture plates in an incubator at 37°C and 5% CO2 for 24 hours, the original culture medium was discarded and rinsed three times with PBS. The residual liquid was aspirated and a cell homogenate medium containing 2% Triton X-100 (purchased from Sangon Biotech Co., Ltd., CAS No. 9002-93-1) was added. Ultrasonic dissolution was performed for about half an hour to fully dissolve the intracellular TG. The triglyceride (TG) and total cholesterol (TC) contents in the test samples were determined according to the instructions of the triglyceride kit and the total cholesterol kit, and the protein concentration in the test samples was determined by the BCA method for correction. Figure 12 Compared with the control group, the TG and TC levels in the model group (FFA modeling) increased by approximately 1.7 times, a significant difference. The positive drug results showed that 1.8μM of the positive drug effectively inhibited the FFA-induced increase in TG content, reducing it by 55%. However, it was also found that a lower concentration of 50nM LNP@siACC achieved the same effect. That is, after LNP@siACC drug delivery, there was a significant decrease in TC and TG levels, and as the concentration increased, the inhibition was obvious. This experimental result proves that knocking down the ACC gene reduces lipid deposition in hepatocytes.
Claims
1. A siRNA nanoliposome, characterized in that The siRNA nanoliposomes were prepared as follows: (1) Lipid-ethanol solution: Dissolve lipid DLin-MC3-DMA, phosphorylcholine DSPC, plant-derived cholesterol, and DMG-PEG2000 in ethanol to prepare a lipid-ethanol solution; (2) siRNA-citrate buffer: siRNA was added to 50 mM citric acid buffer at pH 4 to prepare siRNA-citrate buffer; the siRNA targeted acetyl-CoA carboxylase; the sense strand of the siRNA was: GAGUCAAGUAUGUACUUAATT; the antisense strand was: UUAAGUACAUACUUGACUCTT; (3) siRNA nanoliposomes: The lipid-ethanol solution in step (1) and the siRNA-citrate buffer in step (2) were filtered through a 0.22 μm filter membrane, and siRNA-encapsulated liposome nanoparticles were prepared by a microfluidic mixing method.
2. The siRNA nanoliposome according to claim 1, wherein In step (1), the molar ratio of lipid DLin-MC3-DMA, phosphorylcholine DSPC, plant-derived cholesterol, and DMG-PEG2000 is 50:10:1.5:38.
5.
3. The siRNA nanoliposome according to claim 2, wherein The total solute concentration in the lipid-ethanol solution in step (1) is 10-20 mM.
4. The siRNA nanoliposome according to claim 1, wherein Step (2) The final concentration of siRNA in the siRNA-citrate buffer is 0.1-1 μg / μL.
5. The siRNA nanoliposome according to claim 1, wherein In step (3), the flow rate ratio of the lipid-ethanol solution and the siRNA-citrate buffer solution is 1:
3.
6. The siRNA nanoliposome according to claim 1, wherein Step (3) is a method for preparing siRNA-encapsulated liposome nanoparticles by using a microfluidic mixing method: the filtered lipid-ethanol solution and siRNA-citrate buffer are introduced into a micromixer at flow rates of 0.6 mL / min and 1.8 mL / min, respectively, the mixed effluent is ultrafiltered and centrifuged, and the precipitate is collected to obtain the siRNA-encapsulated liposome nanoparticles.
7. Use of the siRNA nanoliposome according to claim 1 in preparing a drug for treating non-alcoholic fatty liver disease.
8. The use according to claim 7, characterized in that The drug can target and inhibit the expression of acetyl-CoA carboxylase in cells.
Citation Information
Patent Citations
Therapeutic agent for liver diseases comprising sirna of NIK gene
KR1020090048098A
mRNAS FOR TREATMENT OR PROPHYLAXIS OF LIVER DISEASES
US20240342206A1