Application of ackermann kwangsiensis in preparation of medicine for preventing and / or treating intestinal barrier injury

Abstract

The invention provides an application of Akkermansiaguangxiensis in preparation of a medicine for preventing and / or treating intestinal barrier injury, and belongs to the field of biological medicine manufacturing. The invention further provides an application of the Akkermansiaguangxiensis in preparation of the medicine for preventing and / or treating intestinal barrier injury. The invention relates to application of ackermann kwangsiensis or a probiotic agent containing the ackermann kwangsiensis in preparation of a product for improving the intestinal barrier function. The ackermann kwangsiensis comprises an ackermann kwangsiensis strain N21116 and / or an ackermann kwangsiensis strain N21169. Test results show that the strains N21116 and N21169 can effectively recover normal structures and functions of intestinal tissues no matter in a survival state or an inactivated state, and a new way is provided for intestinal barrier injury treatment and intestinal barrier protection.

Description

Technical Field

[0001] The invention belongs to the manufacture of biological medicines, and specifically relates to the use of Akkermansia guangxiensis in the preparation of medicines for preventing and / or treating intestinal barrier damage. Background Art

[0002] The gastrointestinal tract is a special organ that, in addition to its food digestion function, also has complex dynamic interactions with other organs in the body. The upper layer cells act as a chemical barrier together with the mucosal layer and the cellular immune system. At the same time, the upper layer cells also act as the first physical barrier to resist external factors. In addition, the upper layer cells maintain a symbiotic relationship with commensal bacteria. Tight junction proteins in the upper layer cells include occludens, tight junction proteins, and zonula occludens, which play a vital role in maintaining the integrity of the epithelial barrier. Defects in barrier integrity can strongly activate immune cells and lead to chronic inflammation of intestinal tissue. Damage to the intestinal barrier is also known as "leaky gut" or leaky gut syndrome. This state is mainly caused by bacterial infection, oxidative stress, alcohol or chronic allergen exposure and dysbiosis, and usually leads to obesity, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), cirrhosis, neurodegeneration, cardiovascular disease, inflammatory bowel disease, celiac disease, irritable bowel syndrome, type 1 diabetes (T1D) and several autoimmune diseases. Therefore, maintaining the integrity of the intestinal barrier has a comprehensive impact on human health.

[0003] At present, drugs commonly used to prevent and treat intestinal barrier damage include chemical drugs, such as lidocaine derivatives (CN115364083), ferulic acid (CN112691098A), lycopene (CN115606802A), and chenodeoxycholic acid (CN109010347A). Long-term use of these compounds may cause drug dependence. Probiotics are intestinal colonization bacteria with good drug safety and avoid repeated administration. The probiotics currently reported to repair intestinal barrier damage are mainly lactobacilli, specifically including plant lactobacillus (CN107412272A), rhamnosus lactobacillus (CN118319958A), and rumen lactobacillus (CN112592865). Akkermansia is a "star" strain, but there is currently no report on Akkermansia for protecting and repairing intestinal barrier damage. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide an application of Akkermansia guangxiensis in the preparation of drugs for preventing and / or treating intestinal barrier damage, expand the scope of probiotics for repairing intestinal barrier damage, and provide a new means for the clinical treatment of intestinal barrier damage.

[0005] The present invention provides an application of Guangxi Akkermansia or a probiotic containing Guangxi Akkermansia in preparing a product for improving intestinal barrier function.

[0006] Preferably, the Guangxi Akkermansia includes Guangxi Akkermansia strain N21116 and / or Guangxi Akkermansia strain N21169;

[0007] The deposit number of the Guangxi Akkermansia strain N21116 is GDMCC No: 62888;

[0008] The deposit number of the Guangxi Akkermansia strain N21169 is GDMCC No: 62889.

[0009] Preferably, the improving the intestinal barrier function includes treating intestinal barrier damage or protecting the intestinal barrier function.

[0010] Preferably, the intestinal barrier damage includes at least one of the following damage types: mechanical barrier damage, chemical barrier damage, microbial barrier damage, immune barrier damage, inflammatory factor barrier damage, oxidative stress damage and cell apoptosis damage.

[0011] Preferably, the intestinal barrier damage includes down-regulation of tight junction protein expression level and / or intestinal tissue morphological changes.

[0012] Preferably, the tight junction proteins include Claudin gene and / or ZO-1 gene;

[0013] The intestinal tissue morphological changes include intestinal gland necrosis, partial shedding and necrosis of columnar cells, and a decrease in the number of goblet cells.

[0014] Preferably, the Guangxi Akkermansia bacteria include live bacteria and / or inactivated bacteria.

[0015] Preferably, the dosage form of the probiotic containing Akkermansia guangxiensis includes at least one of the following: powder, aqueous solution and drops.

[0016] Preferably, the effective live bacterial concentration of Akkermansia guangxiensis in the probiotic containing Akkermansia guangxiensis is not less than 1×10 8 CFU / g or 1×10 8 CFU / mL.

[0017] Preferably, the product includes at least one of the following: medicine, food, food additives, health products, feed and feed additives.

[0018] The present invention provides an application of Guangxi Akkermansia or a probiotic containing the Guangxi Akkermansia in preparing a product for improving intestinal barrier function. The experiment shows that the efficacy verification of Guangxi Akkermansia strains N21116 and N21169 was carried out with the intestinal barrier damage mouse model induced by D-galactose (D-gal) as the object, and the results show that the strains N21116 and N21169 can both upregulate the expression of tight junction proteins (Claudin and ZO-1) in mouse intestinal epithelial cells, which is beneficial to enhancing the cell barrier function; at the same time, the HE staining results show that compared with the intestinal gland necrosis, the formation of open crypts, the necrosis and shedding of some columnar cells, and the significant reduction of goblet cells in the intestinal tissue sections of the model group, whether it is live bacteria or pasteurized bacteria, the strains N21116 and N21169 have only a few columnar cells necrosis and shedding, and the columnar cells and goblet cells are normal in morphology. This indicates that the strains N21116 and N21169, whether in a living state or an inactivated state, can effectively restore the normal structure and function of intestinal tissue, providing a new approach for the treatment and protection of intestinal barrier damage. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The results of the detection of intestinal tight junction protein ZO-1 gene expression in mice with D-gal-induced intestinal barrier damage after intervention with Guangxi Akkermansia strains N21116 and N21169;

[0020] Figure 2 The results of the detection of Claudin gene expression in intestinal epithelial cells of mice with D-gal-induced intestinal barrier damage after intervention with pasteurized Guangxi Akkermansia strains N21116 and N21169;

[0021] Figure 3 HE staining results of intestinal tissue of mice restored D-gal-induced intestinal barrier damage by Guangxi Akkermansia strains N21116 and N21169. DETAILED DESCRIPTION

[0022] The present invention provides an application of Guangxi Akkermansia or a probiotic containing Guangxi Akkermansia in preparing a product for improving intestinal barrier function.

[0023] In the present invention, the Guangxi Akkermansia preferably includes Guangxi Akkermansia strain N21116 and / or Guangxi Akkermansia strain N21169; the deposit number of the Guangxi Akkermansia strain N21116 is GDMCC No: 62888; the deposit number of the Guangxi Akkermansia strain N21169 is GDMCC No: 62889. The strain N21116 or N21169 is disclosed and deposited in the patent with publication number 2023118474389 and patent name "Application of Guangxi Akkermansia strain or its probiotic agent in the preparation of products for prolonging life, anti-aging and delaying Parkinson's disease".

[0024] In the present invention, the improvement of intestinal barrier function preferably includes treating intestinal barrier damage or protecting intestinal barrier function. The intestinal barrier damage preferably includes at least one of the following types of damage: mechanical barrier damage, chemical barrier damage, microbial barrier damage, immune barrier damage, inflammatory factor barrier damage, oxidative stress damage and cell apoptosis damage. The intestinal barrier damage preferably includes down-regulation of tight junction protein expression level and / or intestinal tissue morphological changes. The tight junction protein preferably includes Claudin gene and / or ZO-1 gene. The intestinal tissue morphological changes preferably include intestinal gland necrosis of intestinal tissue, partial shedding and necrosis of columnar cells and a decrease in the number of goblet cells.

[0025] In the present invention, the Guangxi Akkermansia preferably includes live bacteria and / or inactivated bacteria. The method for preparing live bacteria of the Guangxi Akkermansia preferably inoculates activated Guangxi Akkermansia into a BHI culture solution containing hydrochloric acid-L-cysteine ​​at a volume concentration of 0.05%, isolates the bacteria, and obtains live bacteria. The culture is preferably anaerobic culture at 37°C for 48 to 72 hours. The isolated bacteria are preferably centrifuged. The speed of the centrifugation is preferably 7500 to 8500 rpm, more preferably 8000 rpm, and the centrifugation time is preferably 8 to 12 minutes, more preferably 10 minutes. The temperature of the centrifugation is preferably 4°C. The inactivated bacteria include bacteria obtained by pasteurization. In a specific embodiment of the present invention, the pasteurization conditions are preferably inactivated at 65°C for 30 minutes.

[0026] In the present invention, the dosage form of the probiotic containing Akkermansia guangxiensis preferably includes at least one of the following: powder, aqueous solution and drops. The effective live bacterial concentration of Akkermansia guangxiensis in the probiotic containing Akkermansia guangxiensis is preferably not less than 1×10 8 CFU / g or 1×10 8CFU / mL. In an embodiment of the present invention, the method for preparing the powder preferably comprises mixing the live bacteria and / or inactivated bacteria prepared by the above technical scheme with a lyophilization protective agent, and vacuum freeze-drying to obtain a powder. The mass ratio of the live bacteria or inactivated bacteria to the lyophilization protective agent is preferably 1:0.5-3, more preferably 1:1.3. The lyophilization protective agent preferably comprises 10% skim milk by volume, 10% trehalose by mass, 1% sorbitol by volume, and 5% vitamin C by mass.

[0027] In the present invention, the product preferably includes at least one of the following: medicine, food, food additives, health products, feed and feed additives. The present invention has no special restrictions on the preparation method of the medicine, food additives, feed additives, food, feed and health products, and the preparation method known in the art can be used.

[0028] In one embodiment of the present invention, in order to prove that the Guangxi Akkermansia has the effect of treating intestinal barrier damage, a mouse model of intestinal barrier damage induced by D-galactose was used as an experimental subject ([1] Gao Y, Liu Y, Ma F, et al. Lactobacillus plantarum Y44 alleviates oxidative stress by regulating gutmicrobiota and colonic barrier function in Balb / C mice with subcutaneous d-galactose injection[J]. Food Funct, 2021, 12(1): 373-386. [2] Jia X, Liu H, Yin G, et al. Arctium lappa L. polysaccharides alleviate oxidative stress and inflammation in the liver and kidney of aging mice by regulating intestinal homeostasis[J]. Int J Biol Macromol, 2024, 280(Pt 2):135802.); the single dose of D-galactose is 200 mg / kg.bw, injected once a day, and continuously injected for 8 weeks. First, in order to verify whether the intestinal barrier injury mouse model was successfully constructed, the expression of tight junction proteins in the intestinal epithelial cells of mice was detected. Compared with the blank control group, the expression levels of Claudin gene and ZO-1 gene in the model group mice were downregulated, indicating that the intestinal barrier structure had changed. At the same time, the HE staining results showed that the blank control group section showed that the crypt surface was neat, the columnar cells did not fall off and necrotize, and the goblet cells were arranged neatly and orderly. In the model group, part of the intestinal glands were necrotic, forming open crypts, part of the columnar cells were necrotic and fell off, and the goblet cells were greatly reduced. Based on the above two results, it can be seen that the present invention uses D-galactose to induce mice to successfully obtain a mouse disease model of intestinal barrier injury.

[0029] In the embodiment of the present invention, the Guangxi Akkermansia N21116 and N21169 are used as the only active ingredients. Compared with the model group, mice in both live bacteria and pasteurized bacteria treatment groups can restore the expression of intestinal barrier ZO-1 gene and improve the intestinal barrier damage induced by D-galactose. At the same time, the Guangxi Akkermansia N21116 and N21169 are used as the only active ingredients, which can significantly improve the necrosis and shedding of intestinal columnar cells induced by D-galactose, while maintaining the normal morphology of columnar cells and goblet cells.

[0030] The application of Akkermansia guangxiensis provided by the present invention in the preparation of a drug for preventing and / or treating intestinal barrier damage is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0031] Example 1

[0032] Preparation method of Guangxi Akkermansia freeze-dried powder

[0033] Guangxi Akkermansia strains N21116 and N21169 stored in a glycerol tube frozen at -80°C were streaked and cultured respectively, and pure single colonies were picked and inoculated in BHI culture solution containing hydrochloric acid-L-cysteine ​​(0.05%, v / v) for activation culture. The culture solution was inoculated into BHI culture solution containing hydrochloric acid-L-cysteine ​​(0.05%, v / v) according to an inoculum amount of 10% (v / v) for expansion culture, and cultured at 37°C anaerobic environment for 48 hours. The obtained culture solution was centrifuged at 10000×g for 10 minutes to collect live bacteria.

[0034] The collected live bacteria of strains N21116 and N21169 were mixed with freeze-drying protectants (formula: 10% skim milk, 10% trehalose, 1% sorbitol, 5% vitamin C) in a volume ratio of 1:1 and placed in a vacuum freeze-drying equipment for freeze-drying. The procedure was as follows: pre-freezing temperature of 50°C, time maintained for 4 hours, primary drying temperature of -30°C, time for 18 hours, secondary drying temperature of 25°C, time for 10 hours, and finally freeze-dried bacterial powder was obtained.

[0035] The plate count method was used to count the number of cells. The freeze-dried bacterial powder was resuspended in physiological saline and the effective bacterial count was adjusted to 1×10 8 CFU / mL, obtain live bacteria N21116 or N21169 for use.

[0036] The prepared N21116 or N21169 live bacteria were placed in a 65°C oven and inactivated for 30 minutes to obtain pasteurized N21116 / N21169 bacteria for later use.

[0037] Example 2

[0038] Construction method of D-gal-induced intestinal barrier injury model and drug intervention experiment

[0039] 1. Construction of D-gal-induced intestinal barrier injury model

[0040] A total of 60 SPF-grade 6-8-week-old female C57BL / 6J mice were randomly divided into 6 groups after adaptive feeding for 1 week, with 10 mice in each group. During the feeding period, a 12h / 12h light-dark cycle was maintained, the ambient temperature was 22-25°C, and the relative humidity was 40%-60%. The specific groups are as follows:

[0041] Normal group: basal maintenance feed and daily intragastric administration of normal saline;

[0042] Modeling group: basal diet, daily subcutaneous injection of D-gal (200 mg / kg) and daily intragastric administration of normal saline;

[0043] N21116 or N21169 live bacteria intervention group (LP): basal diet, daily subcutaneous injection of D-galactose (200 mg / kg) and daily intragastric administration of 200 mL N21116 or N21169 live bacteria (1×10 8 CFU / mL);

[0044] N21116 or N21169 pasteurized intervention group (PS): basal diet, daily subcutaneous injection of D-galactose (200 mg / kg) and daily oral gavage of 200 mL N21116 or N21169 pasteurized bacteria (1×10 8 CFU / mL).

[0045] 2. Quantitative Analysis of Mouse Intestinal Barrier Genes

[0046] The experiment lasted for 8 weeks. After the last oral gavage, the mice were fasted for 24 hours and anesthetized with 1% sodium pentobarbital. The intestinal tissues of mice in each group were collected, immediately frozen in liquid nitrogen, and then transferred to -80°C for storage. 0.02g of tissue was weighed, and the total RNA of the intestinal tissue was extracted using the Trizol method according to the instructions of R001 BetterZol Reagent (Beijing Jinbaite Biotechnology Co., Ltd.). RNA was converted into cDNA according to the reverse transcription kit (Tiangen Biochemical Technology Co., Ltd.) as a template for qPCR. According to the sequence information of genes related to the intestinal barrier pathway (ZO-1, claudin), specific primers (Table 1) and reaction systems (Table 2) were designed and synthesized. The qPCR reaction was carried out in the QuantStudioTM System, and the fluorescence quantification program was as follows: amplification curve: 94°C 30s, 94°C 15s, 58°C 30s, for 40 cycles; melting curve: 95°C 15s, 60°C 1min, 95°C 15s. The gene B-actin was used as the internal reference, and 2 ﹣△△Ct The target gene was quantitatively analyzed.

[0047] Table 1 Fluorescence quantitative PCR primers

[0048] Primer pairs Sequence (5'-3') Claudin-F GCCATCTACGAGGGACTGTG(SEQ ID NO:1) Claudin-R CCCCAGCAGGATGCCAATTA(SEQ ID NO:2) ZO-1-F CTGATGGTGCTCTGCCTAAT(SEQ ID NO:3) ZO-1-R TAGTCGCAAACCCACACTATC(SEQ ID NO:4) B-actin-F GGCTGTATTCCCCTCCATCG(SEQ ID NO:5) B-actin-R CCAGTTGGTAACAATGCCATGT(SEQ ID NO:6)

[0049] Table 2 PCR reaction system

[0050] 2×LunaUniversalqPCRMasterMix 10μL Forward primer (10 μM) 1μL Reverse primer (10 μM) 1μL Template DNA 1μL <![CDATA[ddH2O]]> appropriate total 20μL

[0051] The results of Claudin gene expression were shown in Figure 1 . Compared with the normal group, the expression of Claudin gene in the intestinal tissue of D-gal model mice was reduced. The Claudin gene of mice treated with N21116 or N21169 pasteurized bacteria was significantly increased compared with the model group. This indicates that the pasteurized bacteria strains N21116 or N21169 have the effect of upregulating the expression of Claudin gene in the intestinal barrier.

[0052] The results of ZO-1 gene expression were shown in Figure 2 . Compared with the normal group, the expression of ZO-1 gene in the intestinal tissue of D-gal model mice was reduced. The ZO-1 gene of mice in the N21116 or N21169 live bacteria treatment group and the N21116 or N21169 pasteurized bacteria treatment group was significantly increased compared with the model group. This indicates that N21116 or N21169 live bacteria and pasteurized bacteria have the effect of upregulating the expression of ZO-1 gene in the intestinal barrier.

[0053] 3. Mouse Intestinal Histopathological Analysis

[0054] The experiment lasted for 8 weeks. After the last oral gavage, the mice were fasted for 24 hours and anesthetized with 1% sodium pentobarbital. The mice were killed by dislocating the cervical vertebra, and the intestinal tissue was quickly removed, fixed with 10% formalin, dehydrated, embedded, and sliced. The slice thickness was 3 to 5 μm, and then stained with hematoxylin-eosin to make stained slices, which were placed under an optical microscope to observe their structure and morphology.

[0055] Depend on Figure 3 It can be seen that the blank control group (Blank) showed a neat crypt surface, no columnar cells falling off or necrosis, and the goblet cells were neatly arranged. In the D-gal model group, some intestinal glands were necrotic, forming open crypts, some columnar cells were necrotic and fell off, and the goblet cells were greatly reduced. For strains N21116 and N21169, only a few columnar cells were necrotic and fell off, and the columnar cells and goblet cells were normal in morphology, whether they were live bacteria or pasteurized bacteria. This shows that strains N21116 and N21169 have a protective effect on intestinal cells and barriers, whether they are live bacteria or pasteurized bacteria.

[0056] It can be seen from the results of the above examples that Akkermansia guangxiensis has certain probiotic potential and has potential in the development of functional products for repairing intestinal barrier damage.

[0057] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of Akkermansia guangxiensis or a probiotic containing the Akkermansia guangxiensis in the preparation of a product for improving intestinal barrier function.

2. The application according to claim 1, characterized in that: The Guangxi Akkermansia includes Guangxi Akkermansia strain N21116 and / or Guangxi Akkermansia strain N21169; The deposit number of the Guangxi Akkermansia strain N21116 is GDMCC No: 62888; The deposit number of the Guangxi Akkermansia strain N21169 is GDMCC No: 62889.

3. The application according to claim 1, characterized in that: Improving the intestinal barrier function includes treating intestinal barrier damage or protecting the intestinal barrier function.

4. The use according to claim 3, characterized in that: The intestinal barrier damage includes at least one of the following damage types: mechanical barrier damage, chemical barrier damage, microbial barrier damage, immune barrier damage, inflammatory factor barrier damage, oxidative stress damage and cell apoptosis damage.

5. The use according to claim 3, characterized in that: The intestinal barrier damage includes down-regulation of tight junction protein expression level and / or intestinal tissue morphological changes.

6. The use according to claim 5, characterized in that: The tight junction proteins include Claudin gene and / or ZO-1 gene; The intestinal tissue morphological changes include intestinal gland necrosis, partial shedding and necrosis of columnar cells, and a decrease in the number of goblet cells.

7. The use according to claim 1, characterized in that: The Guangxi Akkermansia bacteria include live bacteria and / or inactivated bacteria.

8. The use according to claim 1, characterized in that: The dosage form of the probiotic containing Akkermansia guangxiensis includes at least one of the following: powder, liquid and drops.

9. The use according to claim 1, characterized in that: The effective live bacterial concentration of Guangxi Akkermansia in the probiotic containing Guangxi Akkermansia is not less than 1×10 8 CFU / g or 1×10 8 CFU / mL.

10. The use according to any one of claims 1 to 9, characterized in that: The product includes at least one of the following: medicine, food, food additives, health products, feed and feed additives.

Images