Application of NCgl0214 protein and biological material thereof in production of L-isoleucine

Abstract

The invention discloses an application of NCgl0214 protein and a biological material thereof in production of L-isoleucine, and belongs to the technical field of biology. The technical problem to be solved by the invention is how to improve the yield of L-isoleucine. The sequence of the protein disclosed by the invention is SEQ ID No. 4 or SEQ ID No. 2. The yield of the L-isoleucine can be increased by replacing the coding gene of the protein as shown in SEQ ID No.2 in starting organism cells with the coding gene of the protein as shown in SEQ ID No.4 or increasing the content or activity of the protein as shown in SEQ ID No.2 or SEQ ID No.4 in the starting organism cells.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to application of NCgl0214 protein and biological materials thereof in producing L-isoleucine. Background Art

[0002] Isoleucine is an important branched-chain amino acid, widely used in food, medicine and feed industries. Its production mainly relies on microbial fermentation technology.

[0003] In the process of isoleucine synthesis in traditional production strains, some enzymes are also involved in the synthesis of other branched-chain amino acids (such as valine and leucine), resulting in low isoleucine production. The high-yield isoleucine strains obtained by genetic engineering have good industrial application prospects. They can improve the production efficiency and yield of isoleucine, reduce production costs, and meet the growing market demand for isoleucine. Metabolic engineering methods such as homologous recombination double exchange gene editing technology are used to transform the starting strain (such as Corynebacterium glutamicum) to obtain a genetically engineered strain with high isoleucine production. By artificially constructing the isoleucine synthesis pathway and integrating related genes to form an artificial operon, the synthesis efficiency of isoleucine can be improved. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to increase the yield of isoleucine.

[0005] In order to solve the above technical problems, the present invention first provides a protein, wherein the protein comprises the following A1), A2) or A3):

[0006] A1) a protein comprising the amino acid sequence shown in SEQ ID No. 4;

[0007] A2) a protein having 98% or more identity with SEQ ID No. 4 and having the same function as SEQ ID No. 4 after one or more amino acid residues are substituted and / or deleted and / or added;

[0008] A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0009] The protein in A2) above is a protein having an amino acid sequence identity of 98% or more with the protein shown in SEQ ID No. 4 and having the same function. Identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default value) respectively, and searching for the identity of a pair of amino acid sequences to calculate, and then the identity value (%) can be obtained. The above-mentioned identity of 98% or more means an identity of 98% or 99%.

[0010] The protein in the above A2) may specifically be the protein shown in SEQ ID No.2.

[0011] The protein in A2) above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.

[0012] The coding gene of the protein in A2) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID No.3, and / or performing missense mutation of one or several nucleotide pairs, and / or connecting the coding sequence of the tag at its 5′ end and / or 3′ end, such as the coding gene shown in SEQ ID No.1. Among them, the DNA molecule shown in SEQ ID No.3 encodes the protein shown in SEQ ID No.4, and the DNA molecule shown in SEQ ID No.1 encodes the protein shown in SEQ ID No.2.

[0013] The tag in A3) can be a polypeptide or protein fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag and / or SUMO tag, etc.

[0014] In one embodiment of the present invention, the protein is the protein shown by SEQ ID No.4.

[0015] In another embodiment of the present invention, the protein is the protein shown by SEQ ID No.2.

[0016] The protein shown in SEQ ID No. 4 is obtained by mutating the alanine residue at position 118 in SEQ ID No. 2 to a valine residue.

[0017] The present invention also provides a biological material related to the protein, wherein the biological material comprises any one of the following B1) to B4):

[0018] B1) a nucleic acid molecule encoding the protein;

[0019] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0020] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0021] B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).

[0022] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0023] Those skilled in the art can easily mutate the nucleotide sequence encoding the above-mentioned protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the protein of the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the above-mentioned protein and have the same protein function.

[0024] In the above biological material, the nucleic acid molecule described in B1) may contain the following b11) or b12):

[0025] b11) a DNA molecule whose coding sequence contains SEQ ID No. 3;

[0026] b12) A DNA molecule that has 75% or more identity with the nucleotide sequence defined in b11) and encodes the protein.

[0027] b11) can be a DNA molecule shown in SEQ ID No.3.

[0028] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the present invention encoding the protein consisting of the amino acid sequence shown in SEQ ID No.4. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0029] The above 75% or more identity may be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0030] b12) can be the DNA molecule shown in SEQ ID No.1.

[0031] B1) The nucleic acid molecule may be a DNA molecule shown in SEQ ID No.3 or a DNA molecule shown in SEQ ID No.1.

[0032] In the above biological material, the expression cassette containing the nucleic acid molecule encoding the protein (the gene expression cassette of the protein) described in B2) refers to a DNA capable of expressing the protein in a host cell, and the DNA may include not only a promoter for initiating gene transcription of the protein, but also a terminator for terminating gene transcription of the protein. Furthermore, the expression cassette may also include an enhancer sequence.

[0033] B2) The promoter in the expression cassette may contain or may be the following b21) or b22):

[0034] b21) the DNA molecule shown in positions 21 to 120 of SEQ ID No. 7 in the sequence list;

[0035] b22) A DNA molecule having 75% or more identity with the nucleotide sequence defined in b21) and having promoter function.

[0036] In one embodiment of the present invention, the expression cassette B2) may be as shown in positions 21-543 of SEQ ID No.7 or positions 21-543 of SEQ ID No.8.

[0037] Existing expression vectors can be used to construct a recombinant vector containing the gene expression cassette of the protein.

[0038] In the above biological materials, the vector may be a plasmid, a cosmid, a phage or a virus vector. The plasmid may specifically be a pK18mobsacB vector or a pXMJ19 vector.

[0039] B3) The recombinant vector may be the recombinant vector pK18-NCgl0214 A118V , pK18-NCgl0214 A118V The recombinant vector is obtained by replacing the fragment (small fragment) between the Xbal I and BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown in positions 37-1236 of SEQ ID No. 5 in the sequence table, while keeping the other sequences of the pK18mobsacB vector unchanged.

[0040] B3) The recombinant vector may be the recombinant vector pXMJ19-NCgl0214 or pXMJ19-NCgl0214 A118V pXMJ19-NCgl0214 is a recombinant vector obtained by inserting the gene expression cassette of the protein shown at positions 37-559 of SEQ ID No.10 into the pXMJ19 vector. pXMJ19-NCgl0214 A118V The recombinant vector is obtained by inserting the gene expression cassette of the protein shown at positions 37-559 of SEQ ID No. 11 into the pXMJ19 vector.

[0041] In the above-mentioned biological material, the microorganism can be at least a bacterium, and can also be a yeast, algae or fungus. Among them, the bacterium can at least be Corynebacterium glutamicum. The bacterium can also be Escherichia coli, Pantoea ananatis, Bacillus brevis or Brevis lactobacillus.

[0042] In one embodiment of the present invention, the Corynebacterium glutamicum is Corynebacterium glutamicum CGMCC 20437 or Corynebacterium glutamicum ATCC13032.

[0043] B4) The recombinant microorganism may be a recombinant microorganism obtained by replacing the gene encoding the protein shown in SEQ ID No.4 (such as the gene shown in SEQ ID No.3) in the starting microorganism with the gene encoding the protein shown in SEQ ID No.2 (such as the gene shown in SEQ ID No.1), or a recombinant microorganism obtained by expressing the protein in the starting microorganism or increasing the content or activity of the protein in the starting microorganism.

[0044] In an embodiment of the present invention, the recombinant microorganism is recombinant bacteria YPI-0214-001, YPI-0214-002, YPI-0214-003, YPI-0214-004, YPI-0214-005, YPI-0214-006, YPI-0214-007, YPI-0214-008, YPI-0214-009, and YPI-0214-010.

[0045] The recombinant bacterium YPI-0214-001 is a strain obtained by replacing the gene shown in SEQ ID No. 1 in Corynebacterium glutamicum CGMCC 20437 with the gene shown in SEQ ID No. 3.

[0046] The recombinant bacterium YPI-0214-002 is a strain obtained by replacing the gene shown in SEQ ID No. 1 in Corynebacterium glutamicum ATCC13032 with the gene shown in SEQ ID No. 3.

[0047] The recombinant bacterium YPI-0214-003 is obtained by inserting the gene expression cassette shown in positions 21-543 of SEQ ID No. 7 into the poxB site in the genome of Corynebacterium glutamicum CGMCC 20437.

[0048] The recombinant bacterium YPI-0214-004 is obtained by inserting the gene expression cassette shown in positions 21-543 of SEQ ID No. 8 into the poxB site in the genome of Corynebacterium glutamicum CGMCC 20437.

[0049] The recombinant bacterium YPI-0214-005 is obtained by inserting the gene expression cassette shown in positions 21-543 of SEQ ID No. 7 at the poxB site in the genome of Corynebacterium glutamicum ATCC13032.

[0050] The recombinant bacterium YPI-0214-006 is obtained by inserting the gene expression cassette shown in positions 21-543 of SEQ ID No. 8 at the poxB site in the genome of Corynebacterium glutamicum ATCC13032.

[0051] The recombinant bacterium YPI-0214-007 is obtained by introducing the recombinant vector pXMJ19-NCgl0214 into Corynebacterium glutamicum CGMCC 20437.

[0052] The recombinant bacteria YPI-0214-008 is a recombinant vector pXMJ19-NCgl0214 A118V The recombinant bacteria obtained by introducing the gene into Corynebacterium glutamicum CGMCC 20437.

[0053] The recombinant bacterium YPI-0214-009 is obtained by introducing the recombinant vector pXMJ19-NCgl0214 into Corynebacterium glutamicum ATCC13032.

[0054] The recombinant bacteria YPI-0214-010 is a recombinant vector pXMJ19-NCgl0214 A118V The recombinant bacteria obtained by introducing the gene into Corynebacterium glutamicum ATCC13032.

[0055] The present invention also provides a method for producing isoleucine (such as L-isoleucine), which method at least comprises X1) or X2):

[0056] X1) replacing the gene encoding the protein shown in SEQ ID No. 2 in the starting bacteria with the gene encoding the protein shown in SEQ ID No. 4 to obtain a recombinant bacteria; culturing the recombinant bacteria to obtain isoleucine;

[0057] X2) expressing the protein in the starting biological cell, or increasing the content or activity of the protein in the starting biological cell to obtain a recombinant biological cell; culturing the recombinant biological cell to obtain isoleucine.

[0058] The starting biological cell is at least bacteria, yeast, algae or fungi that can synthesize isoleucine.

[0059] The starting bacteria contains a gene encoding a protein shown in SEQ ID No.2, such as a DNA molecule shown in SEQ ID No.1.

[0060] The starting bacteria can at least be bacteria. The bacteria can at least be Corynebacterium glutamicum, such as Corynebacterium glutamicum CGMCC 20437 or Corynebacterium glutamicum ATCC13032.

[0061] The bacteria of the present invention include but are not limited to Corynebacterium glutamicum, and any bacteria containing isoleucine synthesis pathway can utilize the protein of the present invention and its related biological materials to produce isoleucine. The bacteria can at least be Corynebacterium glutamicum. The bacteria can also be Escherichia coli, Pantoea ananatis, Bacillus brevis or Brevis lactobacillus.

[0062] The above method X2) can be achieved by introducing the gene encoding the protein into the cells of the starting organism and expressing it.

[0063] In the above method, the recombinant biological cell (or the recombinant bacteria) can be cultured using a culture medium that can grow the recombinant biological cell (or the recombinant bacteria);

[0064] And / or, the recombinant biological cell (or the recombinant bacteria) is cultured under conditions that enable the recombinant biological cell (or the recombinant bacteria) to grow.

[0065] The recombinant biological cell may be the recombinant microorganism described above. The recombinant bacteria may also be the recombinant microorganism described above.

[0066] The use of the protein or the biomaterial in producing isoleucine (such as L-isoleucine), or in preparing a product for producing isoleucine (such as L-isoleucine), also falls within the protection scope of the present invention.

[0067] The protein of the present invention or the biomaterial can be used to produce a variety of products, including but not limited to isoleucine in the embodiment, and the amino acids produced can also be glutamic acid, valine, glycine, alanine, leucine, lysine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine and histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutaric acid, citric acid, ornithine, citrulline. When various target products are produced, the protein of the present invention is placed in the target product synthesis pathway to achieve the production of the target product.

[0068] The protein and biological material of the present invention can be used to produce isoleucine. The production of isoleucine can be increased by replacing the coding gene of the protein shown in SEQ ID No. 2 in the starting biological cell with the coding gene of the protein shown in SEQ ID No. 4, or by increasing the content or activity of the protein shown in SEQ ID No. 2 or SEQ ID No. 4 in the starting biological cell.

[0069] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0070] Description of biological material deposit

[0071] Classification name: Corynebacterium glutamicum

[0072] Strain ID: YPILE001

[0073] Name of depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0074] Abbreviation of depository unit: CGMCC

[0075] Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101

[0076] Date of deposit: August 17, 2020

[0077] CGMCC Registration Number: CGMCC No.20437 DETAILED DESCRIPTION

[0078] The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. The following examples were processed using SPSS11.5 statistical software, and the experimental results were expressed as average values, and One-way ANOVA tests were used.

[0079] Corynebacterium glutamicum CGMCC 20437 in the following examples has been deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration Committee (referred to as CGMCC, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences) on August 17, 2020, with a deposit registration number of CGMCC No. 20437 and a classification name of Corynebacterium glutamicum. Corynebacterium glutamicum CGMCC20437 contains an L-isoleucine synthesis pathway.

[0080] The cultivation of Corynebacterium glutamicum in Examples 1-5 was carried out at 32°C.

[0081] Example 1: Construction of a recombinant vector containing a point mutation in the coding region of the NCgl0214 gene

[0082] According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, a pair of primers for amplifying the coding region of the NCgl0214 gene were designed and synthesized, and a point mutation was introduced into the coding region (SEQ ID No.1) of the NCgl0214 gene of Corynebacterium glutamicum CGMCC 20437 (sequencing confirmed that the wild-type NCgl0214 gene was retained on the chromosome of the strain) by means of allele replacement. The point mutation was to mutate the 353rd cytosine (C) in the nucleotide sequence (SEQ ID No.1) of the NCgl0214 gene to thymine (T).

[0083] Among them, the DNA molecule shown by SEQ ID No.1 encodes a protein with an amino acid sequence of SEQ ID No.2 (the protein is a wild-type protein, denoted as protein NCgl0214).

[0084] The DNA molecule shown in SEQ ID No.3 encodes a mutant protein having an amino acid sequence of SEQ ID No.4 (the mutant protein is denoted as NCgl0214 A118V). The mutant protein NCgl0214 A118V The valine (V) at position 118 in (SEQ ID No. 4) was mutated from alanine (A).

[0085] The vector was constructed using NEBuilder recombination technology. The primers were designed as follows (synthesized by Shanghai Invitrogen). The nucleotides in bold font are the mutation positions:

[0086] P1: 5′- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG ATTTCGTCTG GCTGCCGGGC-3′,

[0087] P2:

[0088] P3: 5′-ACCTTCGGTG CGGCCTTCTG GGGTGTGATT GTGCTGGCGT-3′,

[0089] P4: 5′- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GGCCATCTAC CAGCACGACA-3′.

[0090] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed with primers P1 and P2, P3 and P4, respectively, to obtain two DNA fragments (NCgl0214 Up and NCgl0214 Down) of the NCgl0214 gene coding region with mutant nucleotides and sizes of 1060 bp and 736 bp, respectively.

[0091] The two DNA fragments (NCgl0214 Up and NCgl0214 Down) were separated and purified by agarose gel electrophoresis, and then ligated with the pK18mobsacB vector (BioVector, which contains a kanamycin resistance marker) that had been digested with Xbal I / BamHI and purified using NEBuilder enzyme (NEB) at 50°C for 30 min. The ligated product was transformed into DH5α and the resulting monoclonal clone was identified by PCR using M13 primers (M13F: 5′-TGT AAA ACG ACG GCC AGT-3′, M13R: 5′-CAG GAA ACA GCT ATGACC-3′) to obtain the positive recombinant vector pK18-NCgl0214 A118V . Cut the correct recombinant vector pK18-NCgl0214 A118V The recombinant vector pK18-NCgl0214 containing the correct point mutation (CT) was sent to a sequencing company for sequencing identification. A118V Save for later use.

[0092] Recombinant vector pK18-NCgl0214 A118V Containing the DNA fragment shown in SEQ ID No.5, which is a recombinant vector obtained by replacing the fragment (small fragment) between the Xbal I and BamHI recognition sites of the pK18mobsacB vector with the DNA fragment shown at positions 37-1236 of SEQ ID No.5 in the sequence list, while keeping the other sequences of the pK18mobsacB vector unchanged.

[0093] Recombinant vector pK18-NCgl0214 A118V Contains the mutant gene NCgl0214 shown in SEQ ID No.3 A118V .

[0094] Example 2: Construction of a gene containing NCgl0214 A118V Engineered strains

[0095] Construction method: The allelic replacement vector (pK18-NCgl0214 A118V ) were transformed into Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC13032 by electroporation, and then cultured in a culture medium. The culture medium components are shown in Table 1. Single colonies produced by the culture were selected and cultured on a culture medium containing 15% sucrose (sucrose concentration was 15 g / L, and other components and concentrations were shown in Table 1). Single colonies produced by the culture were cultured on a culture medium containing kanamycin and a culture medium without kanamycin, respectively. The strains that grew on the culture medium without kanamycin but did not grow on the culture medium containing kanamycin were selected and further identified by PCR using the following primers (synthesized by Shanghai Invitrogen Company):

[0096] P5: 5′-ATCACCTTGG GTCTGTTCTC-3′,

[0097] P6: 5′-CATCGCCGAA AAACCTTGAT-3′.

[0098] The obtained PCR amplification product (240bp) was sequenced, and through sequence comparison, the strain with a mutation (CT) at the 353rd nucleotide of the NCgl0214 gene was a positive strain with successful allelic substitution; the mutant strain obtained from Corynebacterium glutamicum CGMCC 20437 was named YPI-0214-001, and the mutant strain obtained from Corynebacterium glutamicum ATCC13032 was named YPI-0214-002.

[0099] The recombinant bacteria YPI-0214-001 and YPI-0214-002 are obtained by replacing the wild-type NCgl0214 gene in Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC13032 strains with the NCgl0214 gene shown in SEQ ID No. 3. A118V The strain obtained by mutating the gene.

[0100] Table 1. Composition of culture medium (the rest is water)

[0101] Element concentration sucrose 10g / L Polypeptone 10g / L Beef extract 10g / L Yeast powder 5g / L Urea 2g / L Sodium chloride 2.5g / L Agar powder 20g / L pH 7.0

[0102] Example 3: Construction of a genome-wide overexpression of NCgl0214 gene and NCgl0214 A118V Genetically engineered strains

[0103] The vector was constructed using NEBuilder recombination technology. Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, three pairs of upstream and downstream homology arm fragments and NCgl0214 or NCgl0214 were designed and synthesized. A118V Primers for the gene coding region and promoter region are used to introduce NCgl0214 or NCgl0214 into Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC13032 by homologous recombination. A118V Gene expression cassette.

[0104] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0105] P7:

[0106] P8:

[0107] P9:

[0108] P10:

[0109] P11:

[0110] P12:

[0111] Construction method: The genome of Corynebacterium glutamicum ATCC13032 or YPI-0214-001 in Example 1 was used as a template, and PCR amplification was performed with primers P7 / P8, P9 / P10, and P11 / P12, respectively, to obtain an upstream homology arm fragment of 791 bp (the sequence is shown in SEQ ID No. 6), a fragment of 565 bp containing the NCgl0214 gene and its promoter (the sequence is shown in SEQ ID No. 7, where the 21st to 120th positions of SEQ ID No. 7 are the promoter, the 121st to 543rd positions are the NCgl0214 gene, and the 21st to 543rd positions are the NCgl0214 gene expression cassette), or a fragment containing NCgl0214 A118V The fragment of the gene and its promoter is 565 bp (the sequence is shown in SEQ ID No. 8, the 21st to 120th positions of SEQ ID No. 8 are the promoter, and the 121st to 543rd positions are NCgl0214 A118V gene, NCgl0214 gene expression cassette shown at positions 21-543) and a downstream homology arm fragment of 815 bp (the sequence is shown in SEQ ID No.9).

[0112] After the PCR reaction, the three fragments amplified from each template were recovered by electrophoresis using a column DNA gel recovery kit. The three recovered fragments were connected to the pK18mobsacB vector (which contained kanamycin resistance as a selection marker) purified after Xbal I / BamH I digestion using NEBuilder enzyme (NEB) at 50°C for 30 minutes. The single clones grown after the ligation product was transformed into DH5 α were identified by PCR using M13 primers (M13F: 5′-TGT AAA ACG ACG GCC AGT-3′, M13R: 5′-CAG GAA ACA GCT ATG ACC-3′) to obtain positive integration vectors (recombinant vectors), which were pK18-NCgl0214OE, pK18-NCgl0214 A118V OE, this positive integration vector contains a kanamycin resistance marker, and recombinants with the vector integrated into the genome can be obtained through kanamycin screening.

[0113] The correctly sequenced integration vectors (pK18-NCgl0214OE, pK18-NCgl0214 A118VOE) were electrotransformed into Corynebacterium glutamicum CGMCC 20437 and ATCC13032, respectively, and cultured in a culture medium. The composition of the culture medium is shown in Table 1. The single colonies produced by the culture were identified by PCR using P13 / P14 primers. The positive strains were amplified with a fragment of 1393 bp in size, and the strains without amplification were the original strains. The positive strains were cultured on a culture medium containing 15% sucrose, and the single colonies produced by the culture were further identified by PCR using P15 / P16 primers. The bacteria with amplified fragments of 1468 bp in size were NCgl0214 or NCgl0214 A118V The positive strains in which the gene was integrated into the genome of the target strain were named YPI-0214-003 (without mutation point) and YPI-0214-004 (with mutation point) using Corynebacterium glutamicum CGMCC 20437 as the starting bacteria; the transformed bacteria obtained using Corynebacterium glutamicum ATCC13032 as the starting bacteria were named YPI-0214-005 (without mutation point) and YPI-0214-006 (with mutation point).

[0114] Recombinant bacteria YPI-0214-003 and YPI-0214-005 contain double copies of NCgl0214 gene expression cassettes; specifically, recombinant bacteria YPI-0214-003 is a recombinant bacteria obtained by inserting NCgl0214 gene expression cassette (21st-543rd position of SEQ ID No.7) into the poxB site in the genome of Corynebacterium glutamicum CGMCC 20437, and keeping other nucleotides in the genome of Corynebacterium glutamicum CGMCC 20437 unchanged; recombinant bacteria YPI-0214-005 is a recombinant bacteria obtained by inserting NCgl0214 gene expression cassette (21st-543rd position of SEQ ID No.7) into the poxB site in the genome of Corynebacterium glutamicum ATCC13032, and keeping other nucleotides in the genome of Corynebacterium glutamicum ATCC13032 unchanged. Recombinant bacteria containing double copies of NCgl0214 gene can significantly and stably increase the expression amount of NCgl0214 gene.

[0115] The recombinant bacteria YPI-0214-004 and YPI-0214-006 contain the mutant NCgl0214 shown in SEQ ID No.3 A118V Specifically, the recombinant bacterium YPI-0214-004 is a recombinant bacterium in which NCgl0214 is inserted into the poxB site of the genome of Corynebacterium glutamicum CGMCC 20437. A118VThe gene expression cassette (positions 21-543 of SEQ ID No. 8) was inserted into the poxB site of the genome of Corynebacterium glutamicum ATCC13032 to obtain the recombinant bacteria. A118V The gene expression cassette (positions 21-543 of SEQ ID No. 8) is used to obtain a recombinant bacterium by keeping other nucleotides in the genome of Corynebacterium glutamicum ATCC13032 unchanged.

[0116] The PCR identification primers are as follows:

[0117] P13: 5′-GCCAGAAAT GGTTGCGTG-3′,

[0118] P14: 5′-GTCCTTTTTT GCACCGAGGA-3′,

[0119] P15: 5′-GAGGAAACTG ACAAGCTGCT-3′,

[0120] P16: 5′-GTCGGATCATTTTGGATG-3′.

[0121] Example 4: Construction of vectors for overexpression of NCgl0214 gene or NCgl0214 A118V Genetically engineered strains

[0122] The NEBuilder recombination technology was used to construct the vector. Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, a pair of amplification vectors NCgl0214 and NCgl0214 were designed and synthesized. A118V Primers for the gene coding region and promoter region were designed as follows (synthesized by Shanghai Invitrogen):

[0123] P17: 5′- GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC GAGC ACGGCATCGT GATTCG-3′ (the underlined nucleotide sequence is the sequence on pXMJ19),

[0124] P18: 5′- ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC TTAGTCCTTT TTTGCACCG-3′ (the underlined nucleotide sequence is the sequence on pXMJ19).

[0125] Construction method: The genomes of Corynebacterium glutamicum ATCC13032 and YPI-0214-001 in Example 1 were used as templates, and PCR amplification was performed with primers P17 / P18 to obtain a fragment containing the NCgl0214 gene and its promoter (sequence shown in SEQ ID No. 10) and a fragment containing NCgl0214 A118V The fragment of the gene and its promoter (sequence as shown in SEQ ID No. 11) was 593 bp. The amplified product was subjected to electrophoresis and purified and recovered using a column DNA gel recovery kit. The recovered DNA fragment was connected with the shuttle vector pXMJ19 (BioVector Company, which contains chloramphenicol resistance as a selection marker) recovered by EcoRI / KpnI digestion using NEBuilder enzyme (NEB Company) at 50°C for 30 minutes. The single clone grown after the ligation product was transformed into DH5α was identified by PCR with M13R (-48) (5′-AGCGGATAAC AATTTCACAC AGGA-3′) / P18 primers to obtain the positive overexpression vector pXMJ19-NCgl0214 (containing the NCgl0214 gene) and pXMJ19-NCgl0214 with the correct sequence. A118V (Contains NCgl0214 A118V Gene), the vector was sent for sequencing. Because the vector contains a chloramphenicol resistance marker, chloramphenicol can be used to screen whether the vector is transformed into the strain. pXMJ19-NCgl0214 is a recombinant vector obtained by inserting the NCgl0214 gene expression cassette shown at positions 37-559 of SEQ ID No.10 into the pXMJ19 vector. pXMJ19-NCgl0214 A118V To insert NCgl0214 shown at positions 37-559 of SEQ ID No. 11 into the pXMJ19 vector A118V The recombinant vector obtained by gene expression cassette.

[0126] The correctly sequenced pXMJ19-NCgl0214 and pXMJ19-NCgl0214 A118VThe vectors were electrotransformed into Corynebacterium glutamicum CGMCC 20437 and ATCC13032, respectively, and cultured in a culture medium. The composition of the culture medium is shown in Table 1. The single colonies produced by the culture were identified by PCR using primers M13R(-48)(5′-AGCGGATAAC AATTTCACAC AGGA-3′) / P18. The PCR amplified fragment containing a size of 593 bp was a positive strain. The transformed bacteria obtained by using Corynebacterium glutamicum CGMCC 20437 as the starting bacteria were named YPI-0214-007 (without mutation point) and YPI-0214-008 (with mutation point); the transformed bacteria obtained by using Corynebacterium glutamicum ATCC13032 as the starting bacteria were named YPI-0214-009 (without mutation point) and YPI-0214-010 (with mutation point).

[0127] The recombinant bacteria YPI-0214-007 and YPI-0214-009 are obtained by introducing the recombinant vector pXMJ19-NCgl0214 into Corynebacterium glutamicum CGMCC 20437 and ATCC13032, respectively, and both contain the NCgl0214 gene and its promoter (i.e., the NCgl0214 gene expression cassette);

[0128] The recombinant bacteria YPI-0214-008 and YPI-0214-010 were respectively transformed with the recombinant vector pXMJ19-NCgl0214 A118V The recombinant bacteria obtained by introducing into Corynebacterium glutamicum CGMCC 20437 and ATCC13032 all contain NCgl0214 A118V Gene and its promoter (i.e. NCgl0214 A118V gene expression cassette).

[0129] Example 5: Construction of an engineered strain lacking the NCgl0214 gene in the genome

[0130] The vector was constructed using NEBuilder recombination technology. According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were synthesized to amplify the fragments at both ends of the coding region of the NCgl0214 gene as upstream and downstream homology arm fragments. The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0131] P19: 5′- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CACGGCTTCCACGGTCGCAG-3′,

[0132] P20:

[0133] P21:

[0134] P22: 5′- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC CAATTTTCGC GCAGGTCGCG-3′.

[0135] Construction method: The genome of Corynebacterium glutamicum ATCC13032 was used as a template, and PCR amplification was performed with primers P19 / P20 and P21 / P22, respectively, to obtain an upstream homology arm fragment of NCgl0214 of 856 bp and a downstream homology arm fragment of NCgl0214 of 748 bp.

[0136] The amplified product was subjected to electrophoresis and purified using a column DNA gel recovery kit. The recovered DNA fragment was connected to the pK18mobsacB vector (which contains kanamycin resistance as a selection marker) purified after Xbal I / BamHI digestion using NEBuilder enzyme (NEB) at 50°C for 30 minutes. The single clone grown after transformation of the ligation product was identified by PCR using M13 primers to obtain the positive knockout vector pK18-ΔNCgl0214. The recombinant vector pK18-ΔNCgl0214 contains 1564bp of Up-Down DNA of ΔNCgl0214 (the sequence is shown in SEQ ID No.12).

[0137] The vector was sent for sequencing, and the knockout vector pK18-ΔNCgl0214 with correct sequencing was electro-transformed into Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC 13032, respectively, and cultured in a culture medium. The composition of the culture medium is shown in Table 1. The single colonies produced by the culture were identified by PCR using the following primers (synthesized by Shanghai Invitrogen Company):

[0138] P23: 5′-CACG GCTTCCACGG TCGCAG-3′,

[0139] P24: 5′-CAATTTTCGCGCAGGTCGCG-3′.

[0140] The strains that simultaneously amplified the bands of 1490 bp and 1913 bp by the above PCR were positive strains, and the strains that only amplified the band of 1913 bp were the original strains. The positive strains were screened on a 15% sucrose medium and cultured on a medium containing kanamycin and a medium without kanamycin, respectively. The strains that grew on a medium without kanamycin but did not grow on a medium containing kanamycin were selected for further PCR identification using P23 / P24 primers, and the strains that amplified the band of 1490 bp were positive strains in which the coding region of the NCgl0214 gene was knocked out. The positive strain NCgl0214 fragment was amplified again by P23 / P24 primer PCR and sequenced, and the correctly sequenced strains were named YPI-0214-011 (the NCgl0214 gene on the genome of Corynebacterium glutamicum CGMCC20437 was knocked out) and YPI-0214-012 (the NCgl0214 gene on the genome of Corynebacterium glutamicum ATCC 13032 was knocked out).

[0141] Example 6, L-isoleucine shake flask fermentation experiment

[0142] The strains constructed in the above examples and the original strains Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC 13032 were verified by shake flask fermentation. The specific culture medium is as follows, each strain was repeated three times, and the results are shown in Table 3.

[0143] Slant culture: Take the -80℃ stored strain and inoculate it on the activated slant (see Table 1 for the composition of the culture medium), culture it at 30℃ for 24h, and subculture it once;

[0144] Shake flask seed culture: Use an inoculation loop to scrape a ring of slant seeds and inoculate it into a 500 mL Erlenmeyer flask filled with 30 mL of seed culture medium (see Table 1 for culture medium composition, excluding agar powder), seal with nine layers of gauze, and culture at 37°C, 200 rpm for 7-10 h;

[0145] Shake flask fermentation culture: inoculate 10-15% of the volume of the seed culture solution into a 500mL Erlenmeyer flask (final volume is 30mL) filled with fermentation medium, seal with nine layers of gauze, and culture at 37°C, 200r / min with shaking. During the fermentation process, the pH is maintained at 7.0-7.2 by adding ammonia water; 60% (m / v) glucose solution is added to maintain the fermentation; the fermentation period is 24h.

[0146] The results are shown in Table 3. The NCgl0214 gene was mutated to NCgl02 14 A118V The gene can increase the production of L-isoleucine. The NCgl0214 gene and NCgl0214 A118VGene overexpression also helps to increase the production of L-isoleucine, while knocking out the NCgl0214 gene is not conducive to the accumulation of L-isoleucine.

[0147] Table 2, shake flask fermentation medium formula (the rest is water)

[0148] Reagent name Concentration (g / L) glucose 30 Yeast powder 15 Polypeptone 15 Ammonium sulfate 5 Urea 3 <![CDATA[KH 2 AFTER 4 ]]> 6 <![CDATA[K 2 HPO 4 ]]> 5 Magnesium sulfate 0.2 Calcium Pantothenate 0.6 Biotin 0.5 VB1 0.5 pH 6.8-7.2

[0149] Table 3. L-isoleucine fermentation experimental results

[0150]

[0151] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Protein, comprising the following A1), A2) or A3): A1) a protein comprising the amino acid sequence shown in SEQ ID No. 4; A2) a protein having 98% or more identity with SEQ ID No. 4 and having the same function as SEQ ID No. 4 after one or more amino acid residues are substituted and / or deleted and / or added; A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

2. Biomaterial, characterized in that: The biological material comprises any one of the following B1) to B4): B1) a nucleic acid molecule encoding the protein according to claim 1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).

3. The biomaterial according to claim 2, characterized in that: B1) The nucleic acid molecule contains the following b11) or b12): b11) a DNA molecule whose coding sequence contains SEQ ID No. 3; b12) A DNA molecule that has 75% or more identity with the nucleotide sequence defined in b11) and encodes the protein.

4. The biomaterial according to any one of claims 2-3, characterized in that: The microorganisms are bacteria.

5. The biomaterial according to claim 4, characterized in that: The bacterium is at least Corynebacterium glutamicum.

6. A method for producing isoleucine, comprising at least X1) or X2): X1) replacing the gene encoding the protein shown in SEQ ID No. 2 in the starting bacteria with the gene encoding the protein shown in SEQ ID No. 4 to obtain a recombinant bacteria; culturing the recombinant bacteria to obtain isoleucine; X2) expressing the protein of claim 1 in a starting biological cell, or increasing the content or activity of the protein of claim 1 in a starting biological cell, to obtain a recombinant biological cell; and culturing the recombinant biological cell to obtain isoleucine.

7. The method according to claim 6, characterized in that: The starting biological cell is bacteria, yeast, algae or fungi that can synthesize isoleucine.

8. The method according to claim 6, characterized in that: The starting bacteria are at least bacteria.

9. The method according to claim 7 or 8, characterized in that: The bacteria is at least one of Corynebacterium glutamicum, Escherichia coli and Pantoea.

10. Use of the protein according to claim 1 or the biomaterial according to any one of claims 2 to 5 in producing isoleucine, or in preparing a product for producing isoleucine.

Images