Method for constructing frontotemporal lobe degeneration animal model by using TAF15 prefabricated precursor fiber

Abstract

The invention discloses a method for constructing a frontotemporal lobe degeneration animal model by using TAF15 prefabricated precursor fibers, and belongs to the technical field of biology. The TAF15PFs provided by the invention is formed by aggregation of protein fragments with an amino acid sequence as shown in SEQ ID NO.1, and can promote aggregation of TAF15 protein in the brain, induce neuronal injury and synaptic dysfunction, and lead to cognitive dysfunction and anxiety and depression-like behaviors of mice. The TAF15PFFs is injected into the prefrontal cortex of a mouse, so that the frontal-temporal lobe degeneration mouse model can be constructed. The invention provides a new animal model for pathogenesis research and therapeutic drug screening of frontotemporal lobe degeneration.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a method for constructing a frontotemporal lobar degeneration animal model by using TAF15 prefabricated precursor fibers and an application thereof. Background Art

[0002] Frontotemporal lobar degeneration (FTLD) is a group of chronic neurodegenerative diseases characterized by localized atrophy of the frontotemporal lobes. Its clinical manifestations are progressive language disorders and mental and behavioral abnormalities. It is one of the main causes of early-onset cognitive impairment. To date, the etiology and pathogenesis of FTLD are still unclear, and there is a lack of corresponding animal models.

[0003] TATA-binding protein-associated factor 15 (TAF15) is an RNA-binding protein that is involved in regulating gene transcription, RNA splicing, processing and transport. Studies have found that there are a large number of amyloid fibers formed by TAF15 aggregation in the brains of FTLD patients, suggesting that pathological TAF15 aggregates may be a key factor in FTLD neurodegeneration. The construction of an animal model based on this pathology will help study the pathogenesis of FTLD and will also help to fully understand the occurrence and development of FTLD. Summary of the invention

[0004] The purpose of the present invention is to provide a method for constructing an FTLD animal model using TAF15 preformed fibrils (PFFs), and the application of the mouse model obtained according to the method in the study of the pathogenesis of FTLD and the screening of therapeutic drugs. The method of the present invention can stably induce TAF15 aggregate pathology in vivo, and promote cognitive dysfunction and anxiety- and depression-like behaviors in mice, and has great application prospects for the study of the pathogenesis of FTLD and the screening of therapeutic drugs.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] The present invention provides a protein fragment capable of forming TAF15 PFFs, and the amino acid sequence of the protein fragment is shown in SEQ ID NO.1.

[0007] The present invention also provides a biological material related to the protein fragment, which is any one of the following A1) to A4):

[0008] A1) a nucleic acid molecule encoding the protein fragment, the sequence of which is preferably as shown in SEQ ID NO.2;

[0009] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0010] A3) a recombinant expression vector containing the nucleic acid molecule described in A1), or a recombinant expression vector containing the expression cassette described in A2); the recombinant expression vector is preferably pET32a;

[0011] A4) a recombinant cell containing the nucleic acid molecule described in A1), or a recombinant cell containing the expression cassette described in A2), or a recombinant cell containing the recombinant expression vector described in A3); the recombinant cell preferably uses Escherichia coli BL21 as a host cell.

[0012] The present invention also provides a method for preparing the above protein fragments, which comprises the following steps: inoculating the above recombinant cells into a culture medium, and obtaining the protein fragments through culture, inducing expression, and purification.

[0013] The present invention also provides TAF15 PFFs, which are formed by the aggregation of the above protein fragments, and can be prepared by a method comprising the following steps: dissolving the above protein fragments in a buffer and shaking to obtain TAF15 PFFs. The buffer is preferably PBS; and the shaking is preferably performed at 25-37°C.

[0014] The present invention also provides the use of the above TAF15 PFFs in constructing an animal model of a disease caused by TAF15 aggregation. The symptoms of the disease caused by TAF15 aggregation include cognitive dysfunction, anxiety, depression, etc. Further, the disease caused by TAF15 aggregation includes FTLD.

[0015] The present invention provides a method for constructing an animal model of a disease caused by TAF15 aggregation using TAF15 PFFs, comprising the following steps: injecting TAF15 PFFs into an animal to construct an animal model of a disease caused by TAF15 aggregation. The symptoms of the disease caused by TAF15 aggregation include cognitive dysfunction, anxiety, depression, etc. Furthermore, the disease caused by TAF15 aggregation includes FTLD.

[0016] In the method of constructing an animal model of a disease caused by TAF15 aggregation using TAF15 PFFs, TAF15 PFFs are preferably injected into the animal brain, and more preferably TAF15 PFFs are injected into the prefrontal cortex. Further, TAF15 PFFs are injected into the prefrontal cortex of mice, and after 5 months, a FTLD mouse model with cognitive dysfunction, anxiety, and depression-like behaviors containing TAF15 aggregate pathology can be obtained.

[0017] The present invention also provides an application of the animal model obtained by the above method, and the application includes: studying the pathogenesis of diseases caused by TAF15 aggregation, and screening therapeutic drugs for diseases caused by TAF15 aggregation. The symptoms of the diseases caused by TAF15 aggregation include cognitive dysfunction, anxiety, depression, etc. Furthermore, the diseases caused by TAF15 aggregation include FTLD.

[0018] The above-mentioned animal models include mouse, rat, guinea pig, rabbit, monkey, zebrafish and other animal models, preferably a mouse model.

[0019] Advantages and beneficial effects of the present invention: The TAF15 PFFs of the present invention can promote TAF15 protein aggregation in the brain, induce neuronal damage and synaptic dysfunction, and lead to cognitive dysfunction and anxiety and depression-like behaviors in mice. The present invention provides a new animal model for the study of the pathogenesis of FTLD and the screening of therapeutic drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The results of preparing TAF15 PFFs in vitro. A is the aggregation curve of TAF15 protein, which shows that TAF15 protein aggregates in a concentration- and time-dependent manner; B is the electron microscopy negative staining result of TAF15 PFFs, which shows that TAF15 PFFs are composed of two intertwined fibers, scale: 500nm.

[0021] Figure 2 The results of TAF15 PFFs inducing TAF15 aggregation in the mouse brain. A is the result of TAF15 immunohistochemical staining of the mouse prefrontal cortex 5 months after modeling; B is the optical density statistical graph of the immunohistochemical staining. The results show that TAF15 PFFs successfully induced TAF15 protein aggregation in the mouse brain, scale: 50μm. n = 10 mice per group, variance analysis, ****p<0.0001.

[0022] Figure 3 The results of TAF15 PFFs-induced neuronal damage in mice. A is the result of NeuN immunofluorescence staining in the prefrontal cortex of mice 5 months after modeling; B is the statistical diagram of the number of neurons per unit area in this area. The results show that TAF15 PFFs induce a decrease in the number of neurons in mice, scale: 50μm. n = 10 mice per group, Student's t test, **p<0.01.

[0023] Figure 4The results of TAF15 PFFs-induced synaptic damage in mice. A is the immunoblot result of synaptic-related proteins in the prefrontal cortex of mice 5 months after modeling, and B is the grayscale analysis statistical graph of the immunoblot. The results showed that TAF15 PFFs induced a decrease in the level of synaptic-related proteins in mice. n = 5 mice per group, Student's t test, *p<0.05, **p<0.01, ****p<0.0001.

[0024] Figure 5 The results of TAF15 PFFs-induced cognitive dysfunction in mice. AC are the results of the Y-maze experiment in mice 5 months after modeling: A is the statistical graph of the time mice explored the new arm, B is the statistical graph of the number of times mice explored the new arm, and C is the crawling trajectory of mice. The results show that TAF15 PFFs induced a decrease in spatial working memory in mice. DF is the results of the Morris water maze experiment in mice 5 months after modeling: D is the statistical graph of the time mice went to the island during the training period, E is the statistical graph of the time mice explored the target quadrant during the test period, and F is the swimming trajectory of mice during the test period. The results show that TAF15 PFFs induced a decrease in spatial learning and memory in mice. n = 10 mice per group, Student's t test, *p<0.05, **p<0.01.

[0025] Figure 6 The results of TAF15 PFFs-induced anxiety and depression-like behaviors in mice. AC are the results of the open field test in mice 5 months after modeling: A is the crawling trajectory of the mouse, B is the statistical graph of the time the mouse explored the central area, and C is the statistical graph of the distance the mouse explored the central area. The results show that TAF15 PFFs induce anxiety-like behaviors in mice. D and E are the results of the forced swimming test in mice 5 months after modeling: D is the statistical graph of the time the mouse remained immobile, and E is the statistical graph of the time the mouse remained struggling; F and G are the results of the tail suspension test in mice 5 months after modeling: F is the statistical graph of the time the mouse remained immobile, and G is the statistical graph of the time the mouse remained struggling. The results show that TAF15 PFFs induce depression-like behaviors in mice. n = 10 mice per group, Student's t test, *p<0.05, **p<0.01. DETAILED DESCRIPTION

[0026] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0027] Example 1 Preparation of TAF15 PFFs in vitro

[0028] 1. Purification of TAF15 protein fragment monomer

[0029] (1) Construction of a recombinant plasmid expressing a TAF15 protein fragment: The amino acid sequence of the TAF15 protein fragment is shown in SEQ ID NO. 1, and its coding sequence is shown in SEQ ID NO. 2. Using the cDNA of HEK293 cells as a template and pET32a as an expression vector, a recombinant plasmid was constructed by PCR amplification of the target gene, restriction digestion, ligation, transformation, and the like.

[0030] SEQ ID NO.1: YGQSGGEQQS YSTYGNPGSQ GYGQASQSYS GYGQTTDSSY GQN YSGYSSYGQSQSGYSQS YGGYENQKQS SYSQQPYNNQ GQQQNMESSG SQG.

[0031] SEQ ID NO.2:TACGGTCAGTCTGGGGGTGAGCAGCAAAGTTATTCTACCTATGGAA ATCCAGGCAGCCAAGGCTATGGACAAGCATCACAAAGCTATTCTGGCTATGGGCAAACGACTGATTCCTCTTATGGACAGAACTACAGCGGTTACTCCAGTTATGGACAAAGTCAGTCAGGTTATTCACAGTCCTATGGTGGTTATGAGAATCAAAAGCAGAGCTCATATAGCCAGCAACCATATAATAACCAGGGACAGCAGCAAAACATGGAATCATCAGGAAGCCAAGGT.

[0032] (2) Amplification of protein expression bacteria: The recombinant plasmid was transformed into competent E. coli BL21 (DE3) cells, and protein expression bacteria were obtained after screening and sequencing. The protein expression bacteria were added to LB medium and cultured on a shaker at 37°C and 250 r / min until the bacterial solution OD600 = 0.7, and then IPTG was added at a final concentration of 1 mM, and cultured on a shaker at 25°C and 160 r / min for 20 hours.

[0033] (3) Purification of target protein: Collect the bacterial solution by centrifugation, resuspend the bacteria with washing solution (0.5M NaCl, 20mM Tris-HCl, 10mM imidazole, pH=7.8), and sonicate in an ice-water bath for 1 hour. After centrifugation at 4°C and 11000r / min for 20 minutes, collect the supernatant. Use a low-pressure chromatography system to load the supernatant onto an affinity chromatography column containing Ni-NTA Agarose and repeat 3 times. Subsequently, wash away the impurities with washing solution, and replace the target protein with an eluent (0.5M NaCl, 20mM Tris-HCl, 250mM imidazole, pH=7.8). After digestion with enterokinase, use a low-pressure chromatography system again to remove the tag protein and obtain the target protein monomer.

[0034] (4) Protein verification and storage: Protein purity was tested by Coomassie Brilliant Blue staining and Western Blots, and protein concentration was determined by BCA method. The purified protein solution was placed in a dialysis bag, placed in deionized water, and dialyzed at 4°C for 24 h. The protein solution was freeze-dried and stored at -80°C.

[0035] 2. Thioflavin T detection of aggregation kinetics of TAF15 PFFs

[0036] The above TAF15 protein fragment powder was dissolved in sterile PBS to prepare TAF15 solutions with concentrations of 0.5 mg / mL, 1 mg / mL, and 2 mg / mL, respectively. 1 mL was taken into a test tube and placed in a 37°C constant temperature mixer and shaken at 1,000 r / min for 80 hours. The solution changed from clear to turbid. At different time points, 10 μL of the above TAF15 PFFs solution was mixed in 90 μL of 20 μM thioflavin T solution. 100 μL of 20 μM thioflavin T solution was used as a control. The fluorescence intensity was measured using an enzyme marker (excitation light = 440 nm, emission light = 480 nm) to draw an aggregation curve. The results of the thioflavin T aggregation kinetics test showed that the TAF15 protein aggregated in a concentration- and time-dependent manner ( Figure 1 A).

[0037] 3. Preparation of TAF15 PFFs in vitro

[0038] Dissolve the above TAF15 protein fragment powder in sterile PBS solution to a final concentration of 2 mg / mL. Take 1 mL and place it in a 37°C constant temperature mixer at 1,000 r / min for 72 hours to obtain a TAF15 PFFs solution. The solution can be stored at -80°C for a long term.

[0039] 4. Transmission Electron Microscopy Observation of the Morphology of TAF15 PFFs

[0040] Take 20 μL of TAF15 PFFs solution and drop it on the carbon film copper mesh and let it stand for 5 minutes. Use filter paper to absorb the excess liquid. Then add 2% phosphotungstic acid solution and let it stand for 2 minutes. Use filter paper to absorb the excess liquid and dry it at room temperature. Finally, use transmission electron microscopy to observe the morphology of TAF15 PFFs. The negative staining results of electron microscopy showed that TAF15 PFFs consisted of two intertwined fibers ( Figure 1 B).

[0041] Example 2 TAF15 PFFs induce TAF15 protein aggregation in vivo

[0042] 1. Stereotaxic Injection of TAF15 PFFs into the Brain

[0043] The TAF15 PFFs solution was ultrasonicated for 30 minutes in an ice-water bath, and the solution or PBS was injected into the prefrontal cortex of 2-month-old C57BL / 6 mice using a stereotaxic apparatus at the coordinates of 1.9 mm in front of the bregma, 0.3 mm to the right of the midline, and 2.3 mm below the skull surface. The injection speed was 300 nL / min, and the total injection volume was 7 μL.

[0044] 2. Animal tissue sections

[0045] The mice were deeply anesthetized 5 months after the modeling, and physiological saline and 4% paraformaldehyde solution were perfused from the heart. The brain tissue was then removed and fixed in 4% paraformaldehyde solution. After dehydration and transparency, the tissue was embedded in paraffin and sliced ​​with a thickness of 4 μm.

[0046] 3. Immunohistochemical Staining

[0047] After the above paraffin sections were dewaxed with xylene and hydrated with ethanol solutions of decreasing concentrations, they were heat-repaired with antigen repair solution (100mM trisodium citrate solution, pH=6.0) at 94°C for 20 minutes. After rinsing with PBS solution three times, incubate with 3% hydrogen peroxide solution for 10 minutes to block endogenous peroxidase. Then block with 3% bovine serum albumin solution for 30 minutes and incubate TAF15 antibody (Aviva Systems Biology, ARP30112_P050) at 4°C overnight. The next day, rinse with PBS solution three times for 5 minutes each time, incubate enzyme-labeled secondary antibody at 37°C for 1 hour, use DAB for color development, rinse the sections with running water to end the color development, place them in hematoxylin staining solution for 2 minutes, and decolorize them in differentiation solution for 5 seconds. Finally, use 75%, 85%, 95%, and 100% ethanol gradient dehydration in turn, xylene transparent, and neutral gum sealing. The results of immunohistochemical staining showed that TAF15 aggregates formed in the prefrontal cortex of mice 5 months after injection of TAF15 PFFs ( Figure 2 A); and the difference in immunohistochemical optical density values ​​was statistically significant ( Figure 2B), indicating that TAF15 PFFs induce TAF15 protein aggregation in mouse brain.

[0048] Example 3 TAF15 PFFs induce neuronal damage in mice

[0049] After dewaxing, hydration and antigen repair according to the standard process, the paraffin sections were blocked with 3% bovine serum albumin solution for 30 minutes and incubated with neuron marker NeuN antibody at 4°C overnight. The next day, the sections were rinsed with PBS solution 3 times for 5 minutes each time, incubated with fluorescent labeled secondary antibody at room temperature for 2 hours, and stained with DAPI for 5 minutes. Finally, the sections were rinsed with PBS solution 3 times and sealed with anti-fluorescence quencher. The results of immunofluorescence staining showed that the level of NeuN in the prefrontal cortex of mice 5 months after injection of TAF15 PFFs decreased ( Figure 3 A); the number of neurons per unit area in this region is significantly reduced ( Figure 3 B), indicating that TAF15 PFFs induce neuronal damage in the mouse brain.

[0050] Example 4 TAF15 PFFs induce synaptic damage in mice

[0051] The mice were deeply anesthetized 5 months after the modeling, and the brain tissue was immediately peeled off after perfusing normal saline from the heart. The prefrontal cortex on the injected side was separated on ice, and quickly frozen with liquid nitrogen and stored at -80°C for a long time. The prefrontal cortex tissue was lysed using RIPA lysis buffer containing protease inhibitors, and tissue proteins were extracted by tissue grinding, centrifugation and other steps, and the protein concentration was determined by the BCA method. Subsequently, Western blot experiments were used to detect the levels of synaptic-related proteins in the mouse brain lysate, including synapsin I, synaptophysin, VAMP2 and PSD95. The results of protein immunoblotting showed that the levels of synaptic-related proteins in the prefrontal cortex of mice 5 months after injection of TAF15PFFs decreased ( Figure 4 A); and the difference in the grayscale value of the stripes is statistically significant ( Figure 4 B), indicating that TAF15 PFFs induce synaptic damage in the mouse brain.

[0052] Example 5 TAF15 PFFs induce cognitive dysfunction in mice

[0053] The spatial working memory ability of mice 5 months after the above modeling was tested by Y-maze experiment, and ANY-maze software was used for monitoring and analysis. The Y-maze consists of 3 arms of equal length, with an angle of 120 degrees between each two arms. During the training period, the entrance of one of the arms (the new arm) was blocked with a partition, and the mice were placed from the end of either of the remaining two arms and allowed to explore freely for 5 minutes. One hour later, the new wall was opened, and the mice were placed again from the same position and explored for 5 minutes. The time and number of times the mice explored the new arm were counted, and the crawling trajectory of the mice was recorded. The results of the Y-maze experiment showed that the time mice spent exploring the new arm 5 months after injection of TAF15 PFFs was shortened ( Figure 5 A), the number of times decreased ( Figure 5 B), and the crawling trajectories in the three arms were similarly distributed ( Figure 5 C), indicating that TAF15 PFFs induce a decrease in the spatial working memory ability of mice.

[0054] The spatial learning and memory ability of mice 5 months after the above modeling was detected by Morris water maze experiment, and ANY-maze software was used for monitoring and analysis. The water maze consists of a circular pool with a diameter of 1.2 meters, which is divided into four quadrants. One of the quadrants (target quadrant) contains a circular transparent platform (island) with a diameter of 10 cm, which is placed 1 cm below the water surface. On the first day of the experiment, the platform was marked with colorful flags, and the mice were placed in the pool from the four quadrants respectively, and allowed to explore freely for 1 minute. If the platform was not found, the mice were guided to stay on the platform for 20 seconds, and each experiment was half an hour apart. The second to sixth days of the experiment were the training period, the platform logo was removed, and each mouse was trained four times a day, the method was the same as before, and the time for the mouse to go to the island was counted. The seventh day of the experiment was the test period, the platform was removed, and the mice were placed in the pool from the quadrant opposite the target quadrant, and the behavioral trajectory of the mice within 1 minute and the time to explore the target quadrant were monitored. The results of the water maze test showed that the mice injected with TAF15PFFs had a longer time on the island during the training period ( Figure 5 D), the time spent exploring the target quadrant during the test period was reduced ( Figure 5 E), and the swimming trajectories in the four quadrants were similarly distributed ( Figure 5 F), indicating that TAF15 PFFs induce a decrease in the spatial learning and memory abilities of mice.

[0055] Example 6 TAF15 PFFs induce anxiety and depression-like behaviors in mice

[0056] The anxiety-like behavior of mice 5 months after the above modeling was detected by open field test, and ANY-maze software was used for monitoring and analysis. The open field is a square empty box of 50×50×25 cm, and its central area accounts for 30% of the total area. The mice were placed in the center and allowed to explore freely for 5 minutes. The behavioral trajectory of the mice was monitored, and the time and distance of the mice exploring the central area were counted. The results of the open field test showed that the crawling trajectory of mice 5 months after injection of TAF15 PFFs was concentrated around the open field ( Figure 6 A), the time mice spent exploring the central area was shortened ( Figure 6 B), and the percentage of distance to the central area is reduced ( Figure 6 C), indicating that TAF15 PFFs induce anxiety-like behavior in mice.

[0057] Forced swimming test and tail suspension test were used to detect the depressive-like behavior of mice 5 months after the above modeling. The forced swimming test was conducted in a transparent glass cup with a diameter of 15 cm and a water depth of 10 cm. The mice were placed in the cup and allowed to swim freely for 6 minutes. The time the mice remained immobile and struggled within 4 minutes was monitored. The tail suspension test was to suspend the mice by fixing the tail tip for 6 minutes and monitor the time the mice remained immobile and struggled within 4 minutes. The results of the forced swimming test showed that the time the mice remained immobile 5 months after the injection of TAF15 PFFs was prolonged ( Figure 6 D) The time of struggling is shortened ( Figure 6 E). The results of the tail suspension test also showed that the mice remained immobile for a longer period of time after 5 months of injection of TAF15 PFFs ( Figure 6 F), the time of struggling state is shortened ( Figure 6 G) This indicates that TAF15 PFFs induce depressive-like behavior in mice.

[0058] The above embodiments are only used to help illustrate the present invention. The implementation methods of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A protein fragment capable of forming TAF15 PFFs or a biomaterial related to the protein fragment, characterized in that: The amino acid sequence of the protein fragment is shown in SEQ ID NO.1; The biological material related to the protein fragment is any one of the following A1) to A4): A1) a nucleic acid molecule encoding the protein fragment; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant expression vector containing the nucleic acid molecule described in A1), or a recombinant expression vector containing the expression cassette described in A2); A4) a recombinant cell containing the nucleic acid molecule described in A1), or a recombinant cell containing the expression cassette described in A2), or a recombinant cell containing the recombinant expression vector described in A3).

2. A TAF15 PFFs, characterized in that: It is formed by aggregation of the protein fragments described in claim 1.

3. The method for preparing TAF15 PFFs according to claim 2, characterized in that: The method comprises the following steps: dissolving the protein fragment according to claim 1 in a buffer and shaking the buffer to obtain TAF15 PFFs.

4. Use of the TAF15 PFFs according to claim 3 in constructing an animal model of a disease caused by TAF15 aggregation.

5. A method for constructing a disease animal model caused by TAF15 aggregation using TAF15 PFFs, characterized in that: The method comprises the following steps: injecting TAF15 PFFs into animals to construct an animal model of disease caused by TAF15 aggregation.

6. The method according to claim 5, characterized in that: TAF15 PFFs were injected into the animal brain to construct an animal model of disease caused by TAF15 aggregation.

7. The method according to claim 5, characterized in that: TAF15 PFFs were injected into the prefrontal cortex of animals to construct an animal model of disease caused by TAF15 aggregation.

8. Use of a disease animal model caused by TAF15 aggregation obtained by the method according to any one of claims 5 to 7, characterized in that: The applications include: studying the pathogenesis of diseases caused by TAF15 aggregation, and screening therapeutic drugs for diseases caused by TAF15 aggregation.

9. The use according to claim 4, the method according to any one of claims 5 to 7 or the use according to claim 8, characterized in that: Diseases caused by TAF15 aggregation include frontotemporal lobar degeneration.

10. The use according to claim 4, the method according to any one of claims 5 to 7 or the use according to claim 8, characterized in that: The animals include mice, rats, guinea pigs, rabbits, monkeys, and zebrafish.

Images