A method for constructing a frontotemporal lobe degenerative animal model using TAF15 pre-fabricated precursor fibers
By constructing an animal model of TAF15 PFFs and injecting TAF15 PFFs into the brain of mice to simulate FTLD symptoms, the problem of lack of effective animal models in the existing technology has been solved, and support has been provided for the study of the pathogenesis of FTLD and the screening of therapeutic drugs.
Patent Information
- Application Number
- CN202411924194.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-25
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2044-12-25
AI Technical Summary
Current technology lacks effective animal models for FTLD, making it impossible to conduct in-depth research on its pathogenesis and screen for therapeutic drugs.
An animal model based on TAF15 pre-precursor fibers (PFFs) was constructed. By injecting TAF15 PFFs into the brain of the animals, TAF15 protein aggregation was induced, resulting in cognitive dysfunction, anxiety and depression-like behaviors, mimicking FTLD symptoms.
The study successfully induced the aggregation of TAF15 protein in the mouse brain, leading to neuronal damage and synaptic dysfunction, mimicking the clinical symptoms of FTLD, and providing a reliable animal model for the study of the pathogenesis of FTLD and the screening of therapeutic drugs.
Smart Images

Figure CN119735664B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to a method for constructing a frontotemporal lobe degenerative animal model using TAF15 pre-fabricated precursor fibers and its application. Background Technology
[0002] Frontotemporal lobar degeneration (FTLD) is a group of chronic neurodegenerative diseases characterized by localized atrophy of the frontotemporal lobes. Clinically, it manifests as progressively worsening language impairment and behavioral abnormalities, and is one of the leading causes of early-onset cognitive impairment. To date, the etiology and pathogenesis of FTLD remain unclear, and corresponding animal models are lacking.
[0003] TATA-binding protein-associated factor 15 (TAF15) is an RNA-binding protein involved in regulating gene transcription, RNA splicing, processing, and transport. Studies have found large amounts of amyloid fibers formed by TAF15 aggregates in the brains of patients with flaccid fibrosis (FTLD), suggesting that pathological TAF15 aggregates may be a key factor in the neurodegenerative changes of FTLD. Constructing an animal model based on this pathology would contribute to the study of the pathogenesis of FTLD and to a fuller understanding of its development. Summary of the Invention
[0004] The purpose of this invention is to provide a method for constructing an animal model of FTLD using TAF15 pre-formed fibrils (PFFs), and the application of the mouse model obtained by the method in the study of the pathogenesis of FTLD and the screening of therapeutic drugs. The method of this invention can stably induce TAF15 aggregate pathology in vivo and promote cognitive dysfunction and anxiety and depression-like behaviors in mice, showing great promise for the study of the pathogenesis of FTLD and the screening of therapeutic drugs.
[0005] The objective of this invention is achieved through the following technical solution:
[0006] The present invention provides a protein fragment capable of forming TAF15 PFFs, the amino acid sequence of which is shown in SEQ ID NO.1.
[0007] The present invention also provides a biomaterial associated with the said protein fragment, which is any one of A1) to A4) below:
[0008] A1) A nucleic acid molecule encoding the protein fragment, preferably having the sequence shown in SEQ ID NO.2;
[0009] A2) An expression cassette containing the nucleic acid molecules described in A1);
[0010] A3) A recombinant expression vector containing the nucleic acid molecule described in A1), or a recombinant expression vector containing the expression cassette described in A2); the recombinant expression vector is preferably pET32a;
[0011] A4) Recombinant cells containing the nucleic acid molecules described in A1), or recombinant cells containing the expression cassette described in A2), or recombinant cells containing the recombinant expression vector described in A3); wherein the recombinant cells preferably use Escherichia coli BL21 as the host cell.
[0012] The present invention also provides a method for preparing the above-mentioned protein fragment, which includes the following steps: seeding the above-mentioned recombinant cells into a culture medium, and obtaining the protein fragment by culturing, inducing expression, and purifying.
[0013] This invention also provides TAF15 PFFs, which are formed by the aggregation of the above-mentioned protein fragments. Specifically, TAF15 PFFs can be prepared by a method including the following steps: dissolving the above-mentioned protein fragments in a buffer solution and shaking to obtain TAF15 PFFs. The buffer solution is preferably PBS; the shaking is preferably performed at 25-37°C.
[0014] This invention also provides the application of the aforementioned TAF15 PFFs in constructing animal models of diseases caused by TAF15 aggregation. Symptoms of the diseases caused by TAF15 aggregation include cognitive impairment, anxiety, and depression. Further, the diseases caused by TAF15 aggregation include FTLD (Follicular Particulate Disorder).
[0015] This invention provides a method for constructing an animal model of disease caused by TAF15 aggregation using TAF15 PFFs, comprising the following steps: injecting TAF15 PFFs into an animal to construct an animal model of disease caused by TAF15 aggregation. Symptoms of the disease caused by TAF15 aggregation include cognitive impairment, anxiety, and depression. Further, the disease caused by TAF15 aggregation includes FTLD (Follicular Particulate Disorder).
[0016] In the method for constructing an animal model of disease caused by TAF15 aggregation using TAF15 PFFs, it is preferable to inject TAF15 PFFs into the animal brain, and more preferably to inject TAF15 PFFs into the prefrontal cortex. Further, injecting TAF15 PFFs into the prefrontal cortex of mice yields an FTLD mouse model with cognitive impairment and anxiety / depression-like behaviors exhibited by TAF15 aggregates after 5 months.
[0017] This invention also provides applications of the animal models obtained by the above methods, including: studying the pathogenesis of diseases caused by TAF15 aggregation and screening therapeutic drugs for diseases caused by TAF15 aggregation. The symptoms of diseases caused by TAF15 aggregation include cognitive impairment, anxiety, and depression. Further, the diseases caused by TAF15 aggregation include FTLD (Follicular Particulate Disorder).
[0018] The aforementioned animal models include mouse, rat, guinea pig, rabbit, monkey, zebrafish, and other animal models, with mouse models being preferred.
[0019] Advantages and beneficial effects of this invention: The TAF15 PFFs of this invention can promote the aggregation of TAF15 protein in the brain, induce neuronal damage and synaptic dysfunction, leading to cognitive dysfunction and anxiety and depression-like behaviors in mice. This invention provides a new animal model for the study of the pathogenesis of FTLD and the screening of therapeutic drugs. Attached Figure Description
[0020] Figure 1 The results show the in vitro preparation of TAF15 PFFs. A is the aggregation curve of TAF15 protein, which shows that TAF15 protein aggregates in a concentration- and time-dependent manner; B is the electron microscopy negative staining result of TAF15 PFFs, which shows that TAF15 PFFs are composed of two intertwined fibers, scale bar: 500 nm.
[0021] Figure 2 The results show the TAF15 aggregation induced by TAF15 PFFs in the mouse brain. A is the immunohistochemical staining result of TAF15 in the prefrontal cortex of mice 5 months after modeling; B is the optical density statistical graph of the immunohistochemical staining. The results show that TAF15 PFFs successfully induced TAF15 protein aggregation in the mouse brain. Scale bar: 50 μm. n = 10 mice per group. Analysis of variance, ****p<0.0001.
[0022] Figure 3 The results show the effects of TAF15 PFFs-induced neuronal damage in mice. A shows the NeuN immunofluorescence staining results of the prefrontal cortex of mice 5 months after modeling; B shows the number of neurons per unit area in this region. The results show that TAF15 PFFs induced a decrease in the number of neurons in mice (scale bar: 50 μm). n = 10 mice per group. Student's t-test was used, **p < 0.01.
[0023] Figure 4The results show the effects of TAF15 PFFs-induced synaptic damage in mice. A is an immunoblot image of synapse-related proteins in the prefrontal cortex of mice 5 months after modeling, and B is a grayscale analysis of the immunoblot. The results show that TAF15 PFFs induce a decrease in the level of synapse-related proteins in mice. n = 5 mice per group. Student's t-test was used, *p<0.05, **p<0.01, ****p<0.0001.
[0024] Figure 5 The results show the effects of TAF15 PFFs-induced cognitive impairment in mice. AC represents the results of the Y-maze experiment in mice 5 months after modeling: A shows the time spent exploring the new arm, B shows the number of times the mouse explored the new arm, and C shows the crawling trajectory of the mouse. The results show that TAF15 PFFs induced a decline in spatial working memory in mice. DF represents the results of the Morris water maze experiment in mice 5 months after modeling: D shows the time spent on the island during the training period, E shows the time spent exploring the target quadrant during the testing period, and F shows the swimming trajectory of the mouse during the testing period. The results show that TAF15 PFFs induced a decline in spatial learning memory in mice. n = 10 mice per group. Student's t-test was used, *p<0.05, **p<0.01.
[0025] Figure 6 The results show the effects of TAF15 PFFs on anxiety and depression-like behaviors in mice. AC represents the results of the open field experiment 5 months after modeling: A shows the crawling trajectory of the mice, B shows the time spent exploring the central area, and C shows the distance spent exploring the central area. The results show that TAF15 PFFs induce anxiety-like behaviors in mice. D and E represent the results of the forced swimming experiment 5 months after modeling: D shows the time spent remaining still, and E shows the time spent struggling. F and G represent the results of the tail suspension experiment 5 months after modeling: F shows the time spent remaining still, and G shows the time spent struggling. The results show that TAF15 PFFs induce depression-like behaviors in mice. n = 10 mice per group. Student's t-test was used, *p < 0.05, **p < 0.01. Detailed Implementation
[0026] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.
[0027] Example 1: In vitro preparation of TAF15 PFFs
[0028] 1. Purify TAF15 protein fragment monomers
[0029] (1) Construction of a recombinant plasmid expressing the TAF15 protein fragment: The amino acid sequence of the TAF15 protein fragment is shown in SEQ ID NO.1, and its coding sequence is shown in SEQ ID NO.2. Using cDNA from HEK293 cells as a template and pET32a as an expression vector, the recombinant plasmid was constructed through steps such as PCR amplification of the target gene, enzyme digestion, ligation, and transformation.
[0030] SEQ ID NO.1: YGQSGGEQQS YSTYGNPGSQ GYGQASQSYS GYGQTTDSSY GQN YSGYSSYGQSQSGYSQS YGGYENQKQS SYSQQPYNNQ GQQQNMESSG SQG.
[0031] SEQ ID NO.2:TACGGTCAGTCTGGGGGTGAGCAGCAAAGTTATTCTACCTATGGAA ATCCAGGCAGCCAAGGCTATGGACAAGCATCACAAAGCTATTCTGGCTATGGGCAAACGACTGATTCCTCTTATGGACAGAACTACAGCGGTTACTCCAGTTATGGACAAAGTCAGTCAGGTTATTCACAGTCCTATGGTGGTTATGAGAATCAAAAGCAGAGCTCATATAGCCAGCAACCATATAATAACCAGGGACAGCAGCAAAACATGGAATCATCAGGAAGCCAAGGT.
[0032] (2) Amplification of protein expression bacteria: The recombinant plasmid was transformed into Escherichia coli BL21(DE3) competent cells, and protein expression bacteria were obtained after screening and sequencing. The protein expression bacteria were added to LB medium and cultured on a shaker at 37°C and 250 r / min until the bacterial OD600 = 0.7. Then, IPTG was added to a final concentration of 1 mM, and the culture was continued on a shaker at 25°C and 160 r / min for 20 hours.
[0033] (3) Purification of the target protein: The bacterial culture was collected by centrifugation, and the cells were resuspended in washing buffer (0.5M NaCl, 20mM Tris-HCl, 10mM imidazole, pH=7.8) and sonicated in an ice-water bath for 1 hour. After centrifugation at 4℃ and 11000r / min for 20 minutes, the supernatant was collected. The supernatant was loaded into an affinity chromatography column containing Ni-NTA agarose using a low-pressure chromatography system, repeated 3 times. Then, impurities were washed away with washing buffer, and the target protein was removed by elution buffer (0.5M NaCl, 20mM Tris-HCl, 250mM imidazole, pH=7.8). After enzymatic digestion with enterokinase, the tag protein was removed again using a low-pressure chromatography system to obtain the target protein monomer.
[0034] (4) Protein validation and storage: Protein purity was determined by Coomassie brilliant blue staining and Western blotting, and protein concentration was determined by the BCA method. The purified protein solution was placed in a dialysis bag, immersed in deionized water, and dialyzed at 4°C for 24 h. The protein solution was then lyophilized and stored at -80°C.
[0035] 2. Thioflavin T assay for aggregation kinetics of TAF15 PFFs
[0036] The TAF15 protein fragment powder was dissolved in sterile PBS to prepare TAF15 solutions with concentrations of 0.5 mg / mL, 1 mg / mL, and 2 mg / mL. 1 mL of each solution was placed in a test tube and shaken at 1000 rpm for 80 hours at 37°C. The solution changed from clear to turbid. At different time points, 10 μL of the TAF15 PFFs solution was mixed with 90 μL of 20 μM thioflavone T solution, using 100 μL of 20 μM thioflavone T solution as a control. Fluorescence intensity was measured using a microplate reader (excitation light = 440 nm, emission light = 480 nm), and aggregation curves were plotted. The thioflavone T aggregation kinetics assay showed that TAF15 protein aggregated in a concentration- and time-dependent manner. Figure 1 A).
[0037] 3. In vitro preparation of TAF15 PFFs
[0038] The TAF15 protein fragment powder was dissolved in sterile PBS solution to a final concentration of 2 mg / mL. 1 mL of this solution was then placed in a 37°C incubator and shaken at 1000 rpm for 72 hours to obtain the TAF15 PFFs solution. The solution was stored at -80°C for extended periods.
[0039] 4. Morphology of TAF15 PFFs observed by transmission electron microscopy
[0040] 20 μL of TAF15 PFFs solution was dropped onto a carbon film copper grid and allowed to stand for 5 minutes. Excess liquid was then absorbed with filter paper. Subsequently, 2% phosphotungstic acid solution was added and allowed to stand for 2 minutes. Excess liquid was absorbed with filter paper, and the solution was air-dried at room temperature. Finally, the morphology of TAF15 PFFs was observed using a transmission electron microscope. Negative staining results showed that TAF15 PFFs consisted of two intertwined fibers. Figure 1 B).
[0041] Example 2: TAF15 PFFs induce TAF15 protein aggregation in vivo.
[0042] 1. Stereotactic injection of TAF15 PFFs into the brain
[0043] The above-mentioned TAF15 PFFs solution was sonicated in an ice-water bath for 30 minutes. Using a stereotaxic instrument, the solution or PBS was injected into the prefrontal cortex of 2-month-old C57BL / 6 mice at coordinates 1.9 mm anterior to the anterior fontanelle, 0.3 mm to the right of the midline, and 2.3 mm below the skull surface. The injection rate was 300 nL / min, and the total injection volume was 7 μL.
[0044] 2. Animal tissue sections
[0045] Five months after the model was established, the mice were deeply anesthetized, and their hearts were perfused with physiological saline and 4% paraformaldehyde solution. Brain tissue was then dissected and fixed in 4% paraformaldehyde solution. After dehydration and clearing, the tissue was embedded in paraffin and sectioned to a thickness of 4 μm.
[0046] 3. Immunohistochemical staining
[0047] The paraffin sections were dewaxed with xylene, hydrated with ethanol solutions of decreasing concentrations, and then heat-retrieved for 20 minutes at 94°C using antigen retrieval solution (100mM trisodium citrate solution, pH=6.0). After rinsing three times with PBS, they were incubated with 3% hydrogen peroxide solution for 10 minutes to block endogenous peroxidase. Next, they were blocked with 3% bovine serum albumin solution for 30 minutes and incubated overnight at 4°C with TAF15 antibody (Aviva Systems Biology, ARP30112_P050). The following day, they were rinsed three times with PBS solution for 5 minutes each time, incubated with enzyme-labeled secondary antibody at 37°C for 1 hour, and developed using DAB staining. After rinsing with running water, the sections were stained with hematoxylin for 2 minutes and destained in differentiation solution for 5 seconds. Finally, they were dehydrated sequentially with 75%, 85%, 95%, and 100% ethanol, cleared with xylene, and mounted with neutral resin. Immunohistochemical staining results showed that TAF15 aggregates were formed in the prefrontal cortex of mice 5 months after injection of TAF15 PFFs. Figure 2 A); and the difference in immunohistochemical optical density values was statistically significant. Figure 2B) indicates that TAF15 PFFs induce TAF15 protein aggregation in the mouse brain.
[0048] Example 3: TAF15 PFFs induce neuronal damage in mice
[0049] After dewaxing, hydration, and antigen retrieval according to standard procedures, the paraffin sections were blocked with 3% bovine serum albumin solution for 30 minutes and incubated overnight at 4°C with NeuN antibody, a neuronal marker. The next day, they were washed three times with PBS solution for 5 minutes each time, incubated with fluorescently labeled secondary antibody at room temperature for 2 hours, and stained with DAPI for 5 minutes. Finally, they were washed three times with PBS solution and mounted with an anti-fluorescence quencher. Immunofluorescence staining results showed that the NeuN level in the prefrontal cortex of mice decreased 5 months after injection of TAF15 PFFs. Figure 3 A); The number of neurons per unit area in this region is significantly reduced ( Figure 3 B) indicates that TAF15 PFFs induce neuronal damage in the mouse brain.
[0050] Example 4: TAF15 PFFs induce synaptic damage in mice
[0051] Five months after the model was established, mice were deeply anesthetized, and brain tissue was immediately dissected after perfusion of physiological saline into the heart. The prefrontal cortex on the injection side was isolated on ice and flash-frozen in liquid nitrogen for long-term storage at -80°C. The prefrontal cortex tissue was lysed using RIPA lysis buffer containing protease inhibitors. Tissue proteins were extracted through tissue grinding and centrifugation, and protein concentrations were determined using the BCA method. Subsequently, Western blot experiments were used to detect the levels of synaptic-related proteins in the mouse brain lysate, including synapsin I, synaptophysin, VAMP2, and PSD95. Western blot results showed that the levels of synaptic-related proteins in the prefrontal cortex of mice five months after injection of TAF15PFFs decreased. Figure 4 A); and the difference in the gray values of the bands is statistically significant. Figure 4 B) indicates that TAF15 PFFs induce synaptic damage in the mouse brain.
[0052] Example 5: TAF15 PFFs induce cognitive dysfunction in mice
[0053] Spatial working memory (SRAM) in mice 5 months after modeling was assessed using a Y-maze test, and the results were monitored and analyzed using ANY-maze software. The Y-maze consists of three arms of equal length, with a 120-degree angle between each pair of arms. During training, the entrance to one arm (the new arm) was blocked by a partition, and mice were placed in from either of the remaining two arms, allowing them to explore freely for 5 minutes. One hour later, the new wall was opened, and the mice were placed in the same position again and explored for 5 minutes. The time and number of times the mice explored the new arm were recorded, along with their crawling trajectories. The Y-maze test results showed that mice injected with TAF15 PFFs 5 months prior had a shorter time to explore the new arm (…). Figure 5 A), the number of times decreased ( Figure 5 B), and the crawling trajectories in the three arms are similarly distributed. Figure 5 C) indicates that TAF15 PFFs induce a decline in spatial working memory in mice.
[0054] The Morris water maze experiment was used to assess the spatial learning and memory abilities of mice 5 months after modeling, and the results were monitored and analyzed using ANY-maze software. The water maze consisted of a circular pool with a diameter of 1.2 meters, divided into four quadrants. One quadrant (the target quadrant) contained a 10cm diameter circular transparent platform (island) positioned 1cm below the water surface. On the first day of the experiment, the platforms were marked with colored flags. Mice were placed into the pool from each of the four quadrants and allowed to explore freely for one minute. If a mouse could not find a platform, it was guided to stay on it for 20 seconds. Each experiment was spaced half an hour apart. From the second to the sixth day, the platform markings were removed. Each mouse was trained four times a day using the same method, and the time spent on the island was recorded. On the seventh day, the platform was removed, and mice were placed into the pool from the quadrant opposite the target quadrant. The mice's behavioral trajectory and the time spent exploring the target quadrant were monitored over one minute. The water maze test results showed that mice injected with TAF15PFFs for 5 months had a prolonged time to reach the island during the training period. Figure 5 D), the time spent exploring the target quadrant during the testing period is shortened ( Figure 5 E), and the swimming trajectories are similarly distributed in the four quadrants. Figure 5 F) indicates that TAF15 PFFs induce a decline in spatial learning and memory abilities in mice.
[0055] Example 6: TAF15 PFFs induce anxiety and depression-like behaviors in mice.
[0056] The anxiety-like behavior of mice 5 months after the above-mentioned model was detected by an open field test, and the ANY-maze software was used for monitoring and analysis. The open field was a 50×50×25cm square empty box, with the central area accounting for 30% of the total area. Mice were placed in the center and allowed to explore freely for 5 minutes. The behavioral trajectory of the mice was monitored, and the time and distance of the mice exploring the central area were recorded. The results of the open field test showed that the crawling trajectory of mice 5 months after injection of TAF15 PFFs was concentrated around the perimeter of the open field. Figure 6 A) The time mice spend exploring the central region is shortened. Figure 6 B), and the percentage of distance explored to the central area decreased ( Figure 6 C) indicates that TAF15 PFFs induce anxiety-like behavior in mice.
[0057] Depressive-like behaviors in mice 5 months after the initial modeling was assessed using forced swimming and tail suspension tests. The forced swimming test was conducted in a 15cm diameter transparent glass with 10cm water. Mice were placed in the glass and allowed to swim freely for 6 minutes. The time spent immobile and struggling was monitored in the last 4 minutes. The tail suspension test involved suspending the mice by fixing their tail tips for 6 minutes, and the time spent immobile and struggling was monitored in the last 4 minutes. The forced swimming test results showed that mice injected with TAF15 PFFs 5 months prior exhibited a prolonged immobile state (…). Figure 6 D), the time spent in a struggling state is shortened ( Figure 6 E). The tail suspension test also showed that mice injected with TAF15 PFFs maintained an immobile state for an extended period of time 5 months later. Figure 6 F), the time spent in a struggling state is shortened ( Figure 6 G). This indicates that TAF15 PFFs induce depressive-like behavior in mice.
[0058] The above embodiments are only used to help illustrate the present invention. The implementation of the present invention is not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention should be considered as equivalent substitutions and are included within the protection scope of the present invention.
Claims
1. A protein fragment capable of forming TAF15 PFFs or a biomaterial associated with said protein fragment, characterized in that: The amino acid sequence of the protein fragment is shown in SEQ ID NO.1; The biological material associated with the protein fragment is any one of A1) to A4) below: A1) A nucleic acid molecule encoding the protein fragment; A2) An expression cassette containing the nucleic acid molecules described in A1); A3) A recombinant expression vector containing the nucleic acid molecule described in A1), or a recombinant expression vector containing the expression cassette described in A2); A4) Recombinant cells containing the nucleic acid molecules described in A1), or recombinant cells containing the expression cassette described in A2), or recombinant cells containing the recombinant expression vector described in A3).
2. A TAF15 PFF, characterized in that: It is formed by the aggregation of protein fragments as described in claim 1.
3. The method for preparing TAF15 PFFs according to claim 2, characterized in that, The method includes the following steps: dissolving the protein fragment of claim 1 in a buffer solution and shaking it to obtain TAF15 PFFs.
4. The application of the TAF15 PFFs as described in claim 2 in constructing an animal model of frontotemporal lobe degeneration.
5. A method for constructing a frontotemporal lobe degenerative animal model using the TAF15 PFFs described in claim 2, characterized in that, The procedure includes the following steps: injecting TAF15 PFFs into the brain of an animal to construct a frontotemporal lobe degeneration animal model.
6. The method according to claim 5, characterized in that: A frontotemporal lobe degeneration animal model was constructed by injecting TAF15 PFFs into the prefrontal cortex of animals.
7. An application of a frontotemporal lobe degenerative animal model obtained by the method of claim 5 or 6, characterized in that: The application described is for screening therapeutic drugs for frontotemporal lobe degeneration.
8. The application according to claim 4, the method according to claim 5 or 6, or the application according to claim 7, characterized in that: The animals mentioned are mice, rats, guinea pigs, rabbits, or monkeys.
Citation Information
Patent Citations
Treatment of hydrogel-dependent amyloid aggregation disease
CA2790636A1
Amyloid protein TDP-43 and application thereof
CN104497121A