New acremonium dark strain and application thereof

Abstract

The invention belongs to the technical field of fermentation of wine brewing microorganisms, and particularly relates to a new strain of acremoniumsp. And an application of the new strain of acremoniumsp. In order to further enrich beneficial microorganisms in a white spirit brewing environment, a new acremonium dark strain is separated and screened from a strong-flavor yeast production environment, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.41536. When the strain is used for preparing mouldy bran and yeast for making hard liquor, various hydrolases required by wine brewing can be produced; meanwhile, compared with non-reinforced yeast, the strain is used for simulating production of reinforced yeast, and alpha-GC and beta-GC hydrolase can be produced at high yield; in addition, fermentation in a pit is simulated, various flavor substances such as 4-ethyl phenol and 4-ethyl guaiacol can be generated, a new choice is provided for improving the flavor of white spirit in white spirit brewing, and wide application prospects and great application value are achieved.

Description

Technical Field

[0001] The invention belongs to the technical field of wine brewing microbial fermentation, and specifically relates to a new strain of Phaeoacremonium sp. and a use thereof. Background Art

[0002] The production of Daqu is carried out in an open, natural environment, and is widely distributed in the air, water, raw materials, utensils, and the environment of the koji room. During the koji making process, these natural environment microorganisms settle and enrich on the koji made of starchy raw materials such as wheat. Through temperature and humidity control, they form various beneficial brewing microbial strains and enzyme systems, and then become Daqu for brewing after storage, which is a saccharifying agent and fermentation agent for brewing.

[0003] Phaeoacremonium sp. belongs to the Eukaryota, Fungi, Ascomycota, Pezizomycotina, Togniniales, and Togniniaceae in taxonomy. The conidia of the new species of Phaeoacremonium are cylindrical, elliptical, and allantoic. At present, there are only about 60 new species of Phaeoacremonium in the world, distributed in 19 countries including South Africa, Brazil, and Spain. Among them, two species, P.cratiense and P.fusiformostromum, are derived from wood in Guangdong and Guizhou, China. Studies have shown that Phaeoacremonium is a dominant fungal genus in Aquilaria plants and Ephedra roots, and can promote the accumulation of sesquiterpenoid components in white wood callus and the synthesis of biflavonoid compounds in Ephedra roots.

[0004] However, there are no reports on the use of Acremonium microorganisms in liquor production, especially in the Daqu production environment. Summary of the invention

[0005] In order to further enrich the beneficial microorganisms in the liquor brewing environment, the present invention develops a new brewing mold, which is a new species of Phaeoacremonium sp., and the strain number is WLY-WMCC30120.

[0006] In order to achieve the above application purpose, the technical solution adopted by the present invention is as follows:

[0007] In the first aspect, the present invention provides a new strain of Phaeoacremonium sp., with a strain number of WLY-WMCC30120 and a deposit number of CGMCC No.41536. The deposit time of the new strain is October 11, 2024; the deposit location is: General Microbiology Center (CGMCC) of China Microbiological Culture Collection Administration, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101. The classification name is Phaeoacremonium sp.

[0008] The nucleotide sequence of ITS rRNA of the new strain of the genus Acremonium is shown in SEQ ID NO:1.

[0009] SEQ ID NO:1 Nucleotide sequence of ITS rRNA of a new species of the genus Acremonium:

[0010] .

[0011] Among them, the morphological characteristics of the above-mentioned new species of the genus Acremonium are: the hyphae are without septa and rough, with spores, and the spore shape is oblong; the colony is black in the center, white at the edge, with a flat surface, granular texture, and neatly spread edges.

[0012] Among them, the bran koji prepared by the above-mentioned new strain of the genus Acremonium can produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

[0013] Among them, the Daqu prepared by the above-mentioned new strain of the genus Acremonium can produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

[0014] Among them, the enhanced Daqu prepared by the above-mentioned new strain of the genus Acremonium can produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

[0015] In a second aspect, the present invention provides a microbial agent comprising the above-mentioned new strain of the genus Acremonium.

[0016] In a third aspect, the present invention provides the use of the above-mentioned new strain of the genus Acremonium or microbial agent in liquor brewing.

[0017] Wherein, the liquor is at least one of sauce-flavor type, strong-flavor type, light-flavor type or rice-flavor type.

[0018] In a fourth aspect, the present invention provides the use of the above-mentioned new strain of the genus Acremonium or microbial agent in the preparation of bran koji, daqu, fortified daqu or fermented grains.

[0019] Among them, the new strain of the genus Acremonium or microbial agent can metabolize and produce hydrolases, and the hydrolases are at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

[0020] In a fifth aspect, the present invention provides the use of the above-mentioned new strain of the genus Acremonium or microbial agent in producing wine-making flavor substances.

[0021] The flavor substances include at least one of 4-ethylguaiacol, acetic acid, ethylphenol, isopentanol, caproic acid, ethyl acetate, isovaleric acid, phenylethyl alcohol, isobutyric acid, 2,4-di-tert-butylphenol, 2-methoxy-4-vinylphenol, phenylacetaldehyde, isovaleric acid, methyl oleate, 4-methylvaleric acid, γ-nonalactone, ethyl palmitate, benzoic acid, n-hexanol, benzaldehyde, butyric acid, n-valeric acid, p-hydroxystyrene, ethyl n-hexanoate, 2-propyl-1-pentanol, 2,3,5-trimethylpyrazine, n-decanol, methyl maltol, methyl palmitoleate, isobutanol, palmitic acid, isooctyl alcohol or octanol.

[0022] In particular, the use of the new strain of Acremonium genus or microbial agent in producing 4-ethylguaiacol.

[0023] Wherein, the flavor substance is obtained by fermenting the above-mentioned new strain of Acremonium genus or microbial agent in potato glucose liquid culture medium or five-grain flour.

[0024] Beneficial effects: The present invention isolates and screens a new strain of Phaeoacremonium sp. from the production environment of Luzhou-flavor Daqu, and the deposit number is CGMCC No. 41536. The new strain is used to prepare bran koji and Daqu, and can metabolize to produce a variety of hydrolases; at the same time, the new strain is used to simulate the production of enhanced Daqu to produce high-yield β-glucosidase, and the activity reaches 1522.40U / g dry koji, which is 2 times higher than that of unenhanced Daqu; and under the conditions of simulated cellar fermentation, 4-ethylphenol, 4-ethylguaiacol and other flavor substances can be produced, which broadens the source of microorganisms producing 4-ethylguaiacol, so that it is not limited to yeast and Bacillus; at the same time, it meets the needs of liquor brewing, especially the brewing of multi-grain Luzhou-flavor liquor, and provides a new choice for improving the flavor of liquor in liquor brewing, which has broad application prospects and great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 A phylogenetic tree constructed based on the Neighbor-Joining method of the ITS sequence of the new strain of the genus Acremonium WLY-WMCC30120 of the present invention;

[0026] Figure 2 This is a microscopic morphology of the new strain of the genus Acremonium WLY-WMCC30120 of the present invention;

[0027] Figure 3 This is a colony morphology diagram of the new strain of the genus Acremonium WLY-WMCC30120 of the present invention;

[0028] Figure 4 This is a diagram showing the results of enzyme production in preparing bran koji on bran culture medium of the new strain of the genus Acremonium WLY-WMCC30120 of the present invention;

[0029] Figure 5 This is a diagram showing the results of enzyme production in Daqu prepared by the new strain of the genus Acremonium WLY-WMCC30120 of the present invention on pure wheat culture medium;

[0030] Figure 6 This is a diagram showing the results of simulating and enhancing the enzyme production of Daqu by the new strain of the genus Acremonium WLY-WMCC30120 of the present invention.

[0031] The new strain of the genus Phaeoacremonium of the present invention has a deposit number of CGMCC No. 41536. The deposit time is October 11, 2024; the deposit center is: General Microbiological Center of China Microbiological Culture Collection Administration, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101, and the classification name is Phaeoacremonium sp. DETAILED DESCRIPTION

[0032] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clear, the present application is further described in detail below in combination with the implementation methods. Unless otherwise defined, all scientific and technological terms used herein have the same meanings as understood by ordinary technicians in the field.

[0033] The enzymes and abbreviations appearing in the present invention are as follows: α-glucosidase (EC 3.2.1.20 abbreviated as α-GC), β-glucosidase (EC 3.2.1.21 abbreviated as β-GC), α-galactosidase (EC 3.2.1.22 abbreviated as α-GAL), β-galactosidase (EC 3.2.1.23 abbreviated as β-GAL), N-acetyl-β-glucosidase (EC 3.2.1.52 abbreviated as NAG), carboxylesterase (EC 3.1.1.1 abbreviated as CarE), alkaline protease (EC 3.4.4.16 abbreviated as AKP), acid protease (EC3.4.23.18 abbreviated as ACP), neutral protease (abbreviated as NP), lipase (EC 3.1.1.3 abbreviated as LPS), β-glucuronidase (EC 3.2.1.31 abbreviated as β-GD), saccharifying enzyme (EC 3.2.1.52 abbreviated as NAG), 3.2.1.3), exo-β-1,4-glucanase / cellobiosidase (EC 3.2.1.91 abbreviated as C1), α-L-arabinofuranosidase (EC 3.2.1.55 abbreviated as α-L-Af), β-xylosidase (EC 3.2.1.37), cellulase (EC 3.2.1.4 abbreviated as CL), α-amylase (EC 3.2.1.1 abbreviated as α-AL), β-amylase (EC 3.2.1.2 abbreviated as β-AL), pectinase, plant sucrase (EC 3.2.1.26 abbreviated as P-SC), polygalacturonase (EC 3.2.1.15 abbreviated as PG), acyltransferase (EC 2.3.1.- abbreviated as AAT).

[0034] In one embodiment of the present invention, a new strain of the genus Phaeoacremonium is provided, and the deposit number is CGMCC No. 41536. The deposit time is October 11, 2024; the deposit center is: General Microbiological Center of China Microbiological Culture Collection Administration, No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101, and the classification name is Phaeoacremonium sp. It was screened and isolated from the koji making environment of Yibin Wuliangye Co., Ltd., and its biological characteristics are: the mycelium is septate and rough, with budspores, and the spore shape is oblong; the colony is black in the center, white on the edge, flat on the surface, granular in texture, and neatly spread on the edge.

[0035] Among them, the nucleotide sequence of ITS rRNA of the new species of the genus Acremonium described in the present invention is shown in SEQ ID NO: 1.

[0036] In one embodiment of the present invention, the new strain of the genus Acremonium is used to prepare bran on a bran culture medium, which can produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

[0037] In one embodiment of the present invention, the new strain of the genus Acremonium is used to prepare Daqu, which can produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

[0038] In one embodiment of the present invention, the new strain of the genus Acremonium is used to prepare enhanced Daqu to produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

[0039] In one embodiment of the present invention, the new strain of the genus Acremonium is subjected to liquid static fermentation with potato glucose and five-grain flour to simulate cellar fermentation, and various flavor substances such as 4-ethylphenol and 4-ethylguaiacol can be produced under fermentation conditions, meeting the needs of multi-grain Luzhou-flavor liquor brewing, increasing the composition and content of flavor substances in liquor brewing, and providing a basis for improving the flavor of liquor.

[0040] Specific examples will be listed below to explain the scheme of the present invention. It will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the examples, the techniques or conditions described in the literature in this area or the product instructions are used. Reagents or instruments used that do not indicate manufacturers are all conventional products that can be obtained commercially.

[0041] Example 1 Screening of new strains

[0042] 1. Initial screening of new strains

[0043] Materials: Qu making environment of Wuliangye Yibin Co., Ltd.

[0044] Culture medium: Potato dextrose agar (PDA): a commercial synthetic culture medium purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021052. Potato dextrose liquid culture medium: a commercial synthetic culture medium purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021053.

[0045] 2. Test methods:

[0046] The koji making environment of Yibin Wuliangye Co., Ltd. was selected, and the FKC-1 type floating bacteria sampler of Zhejiang Sujing Purification Equipment Co., Ltd. was used. The sampler was 80 cm above the ground, and the malt agar plate with a diameter of 9 cm was placed in the sampler. Three parallels were set each time, the air flow rate was 100L / min, and the sampling time was 1min. Then the plate was inverted and cultured in a 28℃ incubator for 3-4 days; after the colonies grew out, single mold colonies with different colony morphology were selected in PDA medium, numbered and streaked for purification, and the purification was repeated 2 to 3 times until the colonies on the plate were all in the same morphology. Single colonies were picked to make water-immersion slides, and the bacterial cell morphology was observed under a microscope. After separation and purification, the inclined test tubes were stored in a 4℃ refrigerator.

[0047] Example 2 Morphological identification of new strains of the genus Acremonium of the present invention

[0048] Newly activated bacteria were used in each of the following tests. A small amount of bacteria was inoculated into PDA medium and cultured at 28°C for 3-5 days.

[0049] Colony and bacterial morphology observation:

[0050] The activated new strain of Acremonium genus was inoculated on PDA culture medium by streaking with an inoculation loop, cultured at 28°C for 5-7 days, and the colony morphology was observed; a small amount of bacteria was picked up with an inoculation needle, and the bacterial morphology was observed under a microscope.

[0051] Observation results of the fungus: The hyphae are rough and without septa, with spores, and the spores are long oval in shape. Figure 2 shown.

[0052] Colony observation results: The colony is black in the center, white at the edge, flat on the surface, granular in texture, and with neatly spread edges. Figure 3 shown.

[0053] Example 3 Molecular Biological Identification of the New Species of the Genus Acremonium of the Present Invention

[0054] The genomic DNA of the new strain was extracted and amplified with the forward primer ITS1, SEQ ID NO:2: TCCGTAGGTGAACCTGCGG and ITS4, SEQ ID NO:3: TCCTCCGCTTATTGATATGC using the ITS universal primer pair. The reaction conditions were as follows: pre-denaturation at 94°C for 4 min followed by the following cycle: denaturation at 94°C for 45 s, annealing at 55°C for 45 s, extension at 72°C for 60 s, 30 cycles; extension at 72°C for 10 min. The results of 2% agarose gel electrophoresis were good. The PCR amplification product was sent to Shanghai Biotech Co., Ltd. for sequencing. The sequencing results were compared with the BLAST sequence on the NCBI database. The new strain WLY-WMCC30120 was similar to Phaeoacremonium rubrigenum and Phaeoacremonium parasiticum. T The homology is 94.49% and 93.43% respectively. The base sequence difference with the closest new strain is 5.51%, and the base sequence difference with the new strain of Phaeoacremonium parasiticum model is 6.57%, which is much larger than the sequence difference between mold species in this area (-1%). Combined with colony morphology, bacterial characteristics, and ITS rDNA gene sequence analysis, it was determined to be a new species in the genus Phaeoacremonium and named Phaeoacremonium sp.WLY-WMCC30120. The new strain was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on October 11, 2024, with the deposit number CGMCC No.41536, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0055] Its biological characteristics are: the hyphae are rough and without septa, with spores, and the spores are oblong in shape; the colony is black in the center, white at the edges, with a flat surface, granular texture, and neatly spread edges.

[0056] Example 4 Enzyme production properties of the new strain WLY-WMCC30120 of the present invention

[0057] Culture medium: Activated culture medium: Commercial synthetic culture medium, purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021053;

[0058] Bran medium: 10 g bran, 8 mL distilled water, stir well, and sterilize at 121°C for 20 min;

[0059] Preparation of Daqu: Pure wheat is moistened with hot water and then crushed according to the existing conventional koji making process requirements, mixed with water to form koji embryo, and sterilized at 121℃ for 20 minutes;

[0060] Simulated fortified Daqu: Pure wheat is moistened with hot water and then crushed according to the existing preparation process requirements of Luzhou-flavor liquor Daqu, and water is added to mix into qu embryo.

[0061] Enzymatic property analysis: The present invention detected 22 kinds of hydrolases, namely α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT. The detection of these 22 enzyme activities was carried out with reference to the quantitative kit (Beijing Box Biotechnology Co., Ltd.).

[0062] The standard curve of α-GC is y=0.032x+0.0068, R 2 =0.9999; the standard curve of β-GC is y=0.0033x+0.0045, R 2 =0.9999; the standard curve of α-GAL is y=0.0034x-0.0008, R 2 =0.9996; the standard curve of β-GAL is y=0.0036x+0.0142, R 2 =0.9994; the standard curve of saccharifying enzyme is y=0.2954x-0.1997, R 2 =0.9933; the standard curve of α-L-Af is y=0.0073x+0.0195, R 2 =0.9997; the standard curve of β-xylosidase is y=1.5042x-0.0768, R 2 =0.9959; the standard curve of CL is y=0.3758x-0.0636, R 2 =0.9999; the standard curves of α-AL and β-AL are y=1.991x-0.1095, R 2 =0.9999; the standard curve of pectinase is y=0.1042x-0.1389, R 2 =0.9931; the standard curve of P-SC is y=0.3398x-0.06, R2 =0.9993; the standard curve of PG is y=0.1983x+0.0741, R 2 =0.9972; LPS standard curve is y=0.0067x+0.1531, R 2 =0.9952; the standard value of NAG is 0.285; the standard value of CarE is 0.004, the standard value of ACP is 0.753, the standard value of AKP is 0.696, the standard value of NP is 0.753; the standard value of β-GD is 0.001; in all standard curves, "y" is the absorbance value and "x" is the concentration of the standard.

[0063] Among them, the corresponding substrate generation amount is calculated based on the absorbance value combined with the standard curve.

[0064] The definition of α-GC enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of β-GC enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of α-GAL enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of β-GAL enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of NAG enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system l p-nitrophenol is defined as one unit of enzyme activity; CarE enzyme activity unit definition: under the condition of 37℃, the catalytic absorbance value increase of 0.5 per g of Daqu per minute is defined as one unit of enzyme activity; AKP enzyme activity unit definition: at 30℃, per mL of liquid sample, catalyzes the generation of 1μmol of tyrosine per minute, which is defined as one unit of enzyme activity; ACP enzyme activity unit definition: at 30℃, per mL of liquid sample, catalyzes the generation of 1μmol of tyrosine per minute, which is defined as one unit of enzyme activity; NP enzyme activity unit definition: at 30℃, per mL of liquid sample, catalyzes the generation of 1μmol of tyrosine per minute, which is defined as one unit of enzyme activity; LPS enzyme activity unit definition: at 37℃, per g of Daqu, oxidizes 1nmol per minute NADPH is defined as one unit of enzyme activity; β-GD enzyme activity unit definition: the amount of enzyme required to generate 1μmol phenolphthalein per g Daqu per hour is defined as one unit of enzyme activity; saccharifying enzyme activity unit definition: 1mg glucose is generated per g Daqu per hour is defined as one unit of enzyme activity; C1 enzyme activity unit definition: 1nmol p-nitrophenol is generated per g Daqu per hour is defined as one unit of enzyme activity; α-L-Af enzyme activity unit definition: 1nmol p-nitrophenol is generated per g Daqu per minute is defined as one unit of enzyme activity; β-xylosidase enzyme activity unit definition: 1μmol p-nitrophenol is generated per g Daqu per minute is defined as one unit of enzyme activity; CL enzyme activity unit definition: 1μg glucose is catalyzed per g Daqu per minute is defined as one unit of enzyme activity; α-AL and β-AL enzyme activity units definition: 1mg glucose is generated per g Daqu per minute is defined as one unit of enzyme activity; pectinase enzyme activity unit definition: 50℃ pH Under the conditions of 3.5, one unit of enzyme activity is defined as 1 μmol of galacturonic acid produced per gram of Daqu per hour; the definition of P-SC enzyme activity unit is: one unit of enzyme activity is defined as one gram of Daqu catalyzing the hydrolysis of 1 μg of sucrose per minute; the definition of PG enzyme activity unit is: under the conditions of 40℃ and pH 6.0, one unit of enzyme activity is defined as the decomposition of polygalacturonic acid per gram of Daqu per hour to produce 1 mg of galacturonic acid; the definition of AAT enzyme activity unit is: under the conditions of 37℃, the catalytic absorbance change of 0.0005 per gram of Daqu per mL of the system per minute is defined as one unit of enzyme activity.

[0065] (1) The target new strain WLY-WMCC30120 was activated with an activation medium. After confirming that there was no contamination, it was inoculated into a bran medium at a 10% inoculation rate to prepare bran koji and cultured at 28°C for 5 days. The hydrolase activity after culture was detected. Compared with the blank control group, the new strain WLY-WMCC30120 was able to metabolize 10 hydrolases such as AAT, β-GC, saccharifying enzyme, β-GAL, NAG, C1, α-GAL, AKP, α-GC and α-L-Af in a high-yield bran medium. Among them, the activity of AAT (EC 2.3.1.-) can reach 5800U / g dry koji, the activity of β-GC (EC 3.2.1.21) can reach 2671.72U / g dry koji, the activity of saccharifying enzyme (EC 3.2.1.3) can reach 1888.46U / g dry koji, the activity of β-GAL (EC 3.2.1.23) can reach 1129.82U / g dry koji, the activity of NAG (EC 3.2.1.52) can reach 579.68U / g dry koji, the activity of C1 (EC 3.2.1.91) can reach 438.59U / g dry koji, the activity of α-GAL (EC 3.2.1.22) can reach 323.78U / g dry koji), the activity of AKP (EC 3.4.4.16) can reach 319.43U / g dry koji, the activity of α-GC (EC 3.2.1.20) activity reached 222.98U / g dry koji, α-L-Af (EC 3.2.1.55) activity reached 154.25U / g dry koji, such as Figure 4 shown.

[0066] (2) The target new strain WLY-WMCC30120 was activated with an activation medium. After confirming that there was no contamination, it was inoculated into a pure wheat medium at a 10% inoculation rate to prepare Daqu, and cultured at 28°C for 5 days. The activity of the hydrolase after culture was detected. Compared with the blank control group, the Daqu prepared by the new strain WLY-WMCC30120 was able to metabolize and produce high yields of four hydrolases, including AAT, β-GAL, β-GC and AKP. Among them, the activity of AAT (EC 2.3.1.-) reached 1013.33U / g dry qu, the activity of β-GAL (EC 3.2.1.23) reached 474.07U / g dry qu, the activity of β-GC (EC 3.2.1.21) reached 215.42U / g dry qu, and the activity of AKP (EC 3.4.4.16) reached 142.03U / g dry qu. Figure 5 shown.

[0067] (3) The target new strain WLY-WMCC30120 was activated with an activation medium. After confirming that there was no contamination, it was inoculated into fresh koji embryos at a 10% inoculation rate to prepare fortified Daqu, and cultured at 28°C for 5 days. The activity of the hydrolase after culture was detected. Compared with the unfortified group, the fortified Daqu prepared by the new strain WLY-WMCC30120 was able to metabolize and produce high-yield hydrolases such as α-GC and β-GC. Among them, the activity of α-GC (EC 3.2.1.20) that can produce high-yield hydrolases reached 507.26U / g dry koji and the activity of β-GC (EC 3.2.1.21) that can produce high-yield hydrolases reached 1522.40U / g dry koji, which was 2 times higher than that of the unfortified Daqu. Figure 6 shown.

[0068] Example 5 Analysis of the main flavor components in the fermentation broth of the new strain WLY-WMCC30120 of the present invention

[0069] Culture medium: Potato dextrose liquid medium. Commercial synthetic culture medium, purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021053.

[0070] Culture medium: five-grain powder. Five grains (36% sorghum, 22% rice, 18% glutinous rice, 16% wheat, 8% corn) are ground into fine powder, and the ratio of five-grain powder to water is 1:10. Boil tap water, add fine five-grain powder, and cook for about 40 minutes (into a porridge state), cool to about 60°C, add liquefaction enzyme (5g / 3L) and saccharification enzyme (5g / 3L) at the same time, keep warm at 62°C for liquefaction and saccharification for 4 hours, stir every 1 hour, place in a 4°C refrigerator overnight, filter through 8 layers of gauze, replenish water, add glucose to make the sugar content reach about 12°Bé, pH about 6.8, and sterilize for later use.

[0071] The seed liquid of the new strain WLY-WMCC30120 was inoculated at a 1% inoculation rate into potato glucose liquid culture medium and five-grain powder culture medium, filled into 200mL / 250mL triangular flasks, sealed, and three groups of samples with the same treatment were made in parallel and cultured and fermented at 28°C for 5 days.

[0072] Pretreatment method of flavor substances in fermentation broth: Accurately pipette 1.0 mL of fermentation broth into a headspace bottle, then add 0.3 g of sodium chloride and 6 μL of 4-octanol (concentration of 12 ppb), insert the headspace bottle filled with the sample into the extraction column, place it in a 50°C water bath for equilibration for 15 minutes, extract for 45 minutes, and then put it on the machine for testing.

[0073] After the flavor compounds in the fermentation broth were extracted by pretreatment, they were subsequently analyzed by HS-SPME. The separation was performed according to the following procedure: GC conditions: DB-WAX capillary column (30m×250μm×0.25μm); carrier gas was helium (purity ≥99.999%), flow rate 1mL / min; injection mode: splitless injection; column temperature: starting temperature 60℃, maintained for 1min, increased to 200℃ at 8℃ / min, maintained for 1min, increased to 280℃ at 30℃ / min, maintained for 2min; injection port temperature: 250℃; auxiliary heating temperature 280℃.

[0074] Semi-quantitative analysis was performed using 4-octanol (12.0 ppb) as the internal standard and peak area normalization method. The peak area of ​​each compound was calculated using selected ion spectrometry (SIM), and the concentration of each compound was calculated based on the ratio of the peak area of ​​the internal standard substance.

[0075] The test results are shown in Table 1. It can be seen that the new strain mainly produces isovaleraldehyde, acetic acid, and isopentanol in potato glucose liquid medium. In five-grain powder medium, it mainly produces 4-ethylguaiacol, acetic acid, 4-ethylphenol, isopentanol, caproic acid, ethyl acetate, isovaleric acid, phenylethanol, and isobutyric acid. In both culture media, acetic acid and isopentanol are the main products.

[0076] At present, research reports show that 4-ethylguaiacol is mainly produced by yeast (Zou Mouyong, He Liqin, Sun Qixing, et al. Identification of 4-ethylguaiacol-producing yeast and its application in soy sauce [J]. Food Science, 2021, 42(12): 138-144.) and Bacillus (Guo Mingwei, Geng Yuhuan. Screening and identification of a 4-ethylguaiacol-transforming bacterium during soy sauce fermentation [J]. Food and Fermentation Industries, 2021, 47(21): 18-23. DOI: 10.13995 / j.cnki.11-1802 / ts.026836.), and has not been reported in molds. The new species of the genus Acremonium in the present invention is the first report of mold metabolism to produce 4-ethylguaiacol.

[0077] 4-Ethylguaiacol has spicy, floral, clove, smoky, toasty, pickled pork hind leg, and phenolic aromas. It is widely found in wine, beer, rum, whiskey, white wine, liquor, soy sauce, and vinegar. Its average content in Luzhou-flavor liquor is 96.07 μg / L (Fan Wenlai, Xu Yan. Wine Flavor Chemistry, China Light Industry Press, 2020.). The new strain of the genus Acremonium of the present invention can produce 4-ethylguaiacol up to 223.64 μg / L by static fermentation simulating cellar fermentation.

[0078] Table 1 Flavor substances of the new strain WLY-WMCC30120 in different culture media

[0079]

[0080]

[0081] It can be seen from the above embodiments that the new strain WLY-WMCC30120 of the present invention can be used to produce a variety of hydrolases and ferment to produce a variety of flavor substances. Using it in liquor brewing can enhance the flavor of liquor and brew liquor with better flavor, and has great application value.

Claims

1. A new strain of the genus Acremonium WLY-WMCC30120, characterized in that: The taxonomic name is Phaeoacremonium sp. and the deposit number is CGMCC No.41536.

2. A microbial agent, characterized in that: Contains the new strain of the genus Acremonium as described in claim 1.

3. Use of the new strain of the genus Acremonium according to claim 1 or the microbial agent according to claim 2 in liquor brewing.

4. The use according to claim 3, characterized in that: The liquor is at least one of sauce-flavor type, strong-flavor type, light-flavor type or rice-flavor type.

5. Use of the new strain of the genus Acremonium according to claim 1 or the microbial agent according to claim 2 in preparing bran koji, daqu, fortified daqu or fermented grains.

6. The use according to claim 5, characterized in that: The new strain of the genus Acremonium or the microbial agent can metabolize and produce a hydrolase, and the hydrolase is at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

7. Use of the new strain of the genus Acremonium as described in claim 1 or the microbial agent as described in claim 2 in producing wine flavor substances.

8. The use according to claim 7, characterized in that: The flavor substances include at least one of 4-ethylguaiacol, acetic acid, ethylphenol, isopentanol, caproic acid, ethyl acetate, isovaleric acid, phenylethyl alcohol, isobutyric acid, 2,4-di-tert-butylphenol, 2-methoxy-4-vinylphenol, phenylacetaldehyde, isovaleric acid, methyl oleate, 4-methylvaleric acid, γ-nonalactone, ethyl palmitate, benzoic acid, n-hexanol, benzaldehyde, butyric acid, n-valeric acid, p-hydroxystyrene, ethyl n-hexanoate, 2-propyl-1-pentanol, 2,3,5-trimethylpyrazine, n-decanol, methyl maltol, methyl palmitoleate, isobutanol, palmitic acid, isooctyl alcohol or octanol.

9. The use according to claim 8, characterized in that: The new strain of Acremonium genus or the microbial agent is used in producing 4-ethylguaiacol.

10. The use according to claim 8 or 9, characterized in that: The flavor substance is obtained by fermenting the new strain of the genus Acremonium described in claim 1 or the microbial agent described in claim 2 in a potato glucose liquid culture medium or five-grain flour.

Images