Pseudomonas aeruginosa and application thereof in denitrification and vibrio parahaemolyticus resistance

Abstract

The invention discloses pseudomonas aeruginosa and application of the pseudomonas aeruginosa in denitrification and vibrio parahaemolyticus resistance, the pseudomonas aeruginosa is preserved in Guangdong Microbial Culture Collection Center on July 31, 2024, and the preservation number is GDMCC No: 64925. The compound can resist vibrio parahaemolyticus, and extracellular antibacterial substances of the compound have good thermal stability, pH tolerance and ultraviolet stability; meanwhile, the pseudomonas aeruginosa has the capabilities of heterotrophic nitrification and aerobic denitrification and has a very good effect in the aspect of denitrification, and the degradation rate of ammonia nitrogen reaches 96.90%; the degradation rate on nitrate reaches 97.18%; and the degradation rate of nitrite reaches 93.84%. The device can be used for purifying aquaculture water.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and more specifically to Pseudomonas aeruginosa and application thereof in denitrification and resistance to Vibrio parahaemolyticus. Background Art

[0002] Litopenaeus vannamei (Boone), also known as Vannamei shrimp, was introduced and promoted by the Chinese Academy of Sciences in 1988 for its delicious taste, tender meat, rich nutrition and other edible values. Since the 1990s, white shrimp has gradually become the most important shrimp farming species in my country and an important pillar industry of my country's fishery economy. With the globalization of white shrimp farming, it has become an important farming species in the world. It has also driven the development of related industrial chains such as introduction and breeding, feed production, equipment production, farming and processing, transportation and sales, import and export trade, and has generated huge economic, social and cultural benefits.

[0003] As the market demand for whiteleg shrimp continues to increase, high-density farming models have gradually been applied to various farming methods. High-density farming not only increases the density of shrimp farming and maximizes the yield per unit area, but also saves the use of water resources, land resources and other resources.

[0004] With the development of high-density shrimp farming, the disadvantages of high-density farming are becoming increasingly apparent. In particular, unused feed and shrimp excrement increase the content of substances such as ammonia nitrogen and nitrite nitrogen in the water, which will lead to the deterioration of water quality; at the same time, a large number of pathogens multiply rapidly, which will inevitably cause infection in the shrimp population and cause collective death. The traditional way to solve this problem is to replace a large amount of water and use chemical drugs such as antibiotics. However, when the aquaculture wastewater is not properly treated, the waste and excrement in the wastewater flow into the ecosystem through the water and soil, causing environmental pollution; excessive antibiotics may also cause antibiotic residues in shrimp, affecting the safety and health of food, and then affecting people's health and the stability of the ecosystem.

[0005] Vibrio parahaemolyticus is a Gram-negative rod-shaped, arc-shaped, oval-shaped, non-spore-forming bacterium belonging to the genus Vibrio. It is a common pathogen. Its main habitat is in seawater. If seafood contaminated by this bacterium is consumed, food poisoning will occur. Vibrio parahaemolyticus food poisoning is caused by eating food containing this bacterium, mainly from seafood or salt-preserved products, most commonly crabs, squid, jellyfish, fish, yellow mud snails, etc., followed by eggs, meat or vegetables.

[0006] By adding organisms that can metabolize pollutants into aquaculture water, the concentration of pollutants in the water can be reduced through the metabolic activities of these organisms. This method is fast in effect, low in cost, and easy to operate. Its biggest advantage is that it will not cause secondary pollution. Summary of the invention

[0007] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a Pseudomonas aeruginosa and its application in denitrification and resistance to Vibrio parahaemolyticus.

[0008] The first object of the present invention is to provide Pseudomonas aeruginosa.

[0009] The second object of the present invention is to provide the use of one or more of the Pseudomonas aeruginosa, its fermentation broth and its culture supernatant in combating Vibrio parahaemolyticus.

[0010] The third object of the present invention is to provide the use of one or more of the Pseudomonas aeruginosa, its fermentation broth and its culture supernatant in the preparation of products against Vibrio parahaemolyticus.

[0011] The fourth object of the present invention is to provide the use of the Pseudomonas aeruginosa in denitrification, characterized in that the denitrification is the degradation of one or more of ammonia nitrogen, nitrate and nitrite.

[0012] The fifth object of the present invention is to provide the use of the Pseudomonas aeruginosa in the preparation of a denitrification product, characterized in that the denitrification is the degradation of one or more of ammonia nitrogen, nitrate and nitrite.

[0013] The sixth object of the present invention is to provide an anti-Vibrio parahaemolyticus and / or denitrification product.

[0014] The seventh object of the present invention is to provide another anti-Vibrio parahaemolyticus and / or denitrification product.

[0015] The eighth object of the present invention is to provide a product against Vibrio parahaemolyticus.

[0016] The ninth object of the present invention is to provide a method for combating Vibrio parahaemolyticus.

[0017] The tenth object of the present invention is to provide a denitrification method.

[0018] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0019] The present invention claims protection for a Pseudomonas aeruginosa D-1, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on July 31, 2024, with the deposit number GDMCC No: 64925.

[0020] The present invention also claims the following applications:

[0021] The application of one or more of the Pseudomonas aeruginosa D-1, its fermentation liquid and its culture supernatant in combating Vibrio parahaemolyticus.

[0022] The invention relates to the use of one or more of the Pseudomonas aeruginosa D-1, its fermentation liquid and its culture supernatant in the preparation of products against Vibrio parahaemolyticus.

[0023] The application of Pseudomonas aeruginosa D-1 in denitrification is characterized in that the denitrification is the degradation of one or more of ammonia nitrogen, nitrate and nitrite.

[0024] The Pseudomonas aeruginosa D-1 is used in the preparation of denitrification products, wherein the denitrification is the degradation of one or more of ammonia nitrogen, nitrate and nitrite.

[0025] The present invention also claims protection for the following products:

[0026] A product for resisting Vibrio parahaemolyticus and / or denitrification is prepared by utilizing the Pseudomonas aeruginosa D-1, wherein the denitrification is the degradation of one or more of ammonia nitrogen, nitrate and nitrite.

[0027] A product for resisting Vibrio parahaemolyticus and / or denitrification contains the Pseudomonas aeruginosa D-1, wherein the denitrification is the degradation of one or more of ammonia nitrogen, nitrate and nitrite.

[0028] Preferably, the product is a bacterial agent.

[0029] A product for resisting Vibrio parahaemolyticus is prepared by using the fermentation liquid or culture supernatant of Pseudomonas aeruginosa D-1.

[0030] The present invention also claims the following method:

[0031] A method for resisting Vibrio parahaemolyticus, using the Pseudomonas aeruginosa D-1, one or more of its fermentation liquid and culture supernatant, or any of the products described.

[0032] A denitrification method uses the Pseudomonas aeruginosa D-1 or the product, wherein the denitrification is the degradation of one or more of ammonia nitrogen, nitrate and nitrite.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] The present invention has discovered a Pseudomonas aeruginosa, which can resist Vibrio parahaemolyticus, and its extracellular antibacterial substances have good thermal stability, pH tolerance and ultraviolet stability; at the same time, the Pseudomonas aeruginosa has the ability of heterotrophic nitrification and aerobic denitrification, and has a good effect in denitrification, with a degradation rate of 96.90% for ammonia nitrogen, 97.18% for nitrate, and 93.84% for nitrite. It can be used for purification of aquaculture water. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the colony morphology of strain D-1.

[0036] Figure 2 This is a scanning electron micrograph of strain D-1.

[0037] Figure 3 This is the phylogenetic tree of strain D-1 based on the 16S rDNA gene.

[0038] Figure 4 For strain D-1, NH4 + -Denitrification characteristics of bacteria when N is the only nitrogen source.

[0039] Figure 5 For strain D-1, NO3 - Denitrification characteristics of bacteria when -N is the only nitrogen source

[0040] Figure 6 The NO2 - Denitrification characteristics of bacteria when -N is the only nitrogen source

[0041] Figure 7 This is the counting result of co-culture of strain D-1 and Vibrio parahaemolyticus.

[0042] Figure 8 The colony characteristics of strain D-1 on CAS medium.

[0043] Fig. 9 Biofilm of strain D-1 stained with crystal violet; left: bacterial solution, in which the biofilm was stained purple; right: culture medium (as ck), no change.

[0044] Fig.10 Colony characteristics of strain D-1 on skimmed milk powder nutrient agar medium at 24h (a) and 48h (b). DETAILED DESCRIPTION

[0045] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0046] Trace element solution: EDTA 50g / L, ZnSO4·7H2O 3.92g / L, MnCl2·4H2O 5.06g / L, FeSO4·7H2O 5.0g / L, MgSO4·7H2O 0.2g / L, CoCl2·6H2O 1.61g / L, CaCl2 5.5g / L, (NH4)6Mo7O2·4H2O1.1g / L and CuSO4·5H2O 1.57g / L.

[0047] LB medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 5 g / L, pH about 7.0.

[0048] R2A liquid culture medium: 0.25g / L tryptone, 0.5g / L acid hydrolyzed casein, 0.5g / L yeast extract powder, 0.5g / L soluble starch, 0.3g / L dipotassium hydrogen phosphate, 0.1g / L magnesium sulfate, 0.3g / L sodium pyruvate, 0.25g / L peptone and 0.5g / L glucose, pH is about 7.2; R2A solid culture medium is based on R2A liquid culture medium, and 1.5g / L agar is added.

[0049] Nitration (DM) liquid culture medium: K2HPO4 1.50g / L, MgSO4 7H2O 0.01g / L, sodium citrate 5.66g / L, Na2HPO4 7.90g / L, NaNO3 0.841g / L, NaNO2 0.362g / L and NH4Cl 0.192g / L solution pH is about 7.0; nitration (DM) solid culture medium is based on nitration (DM) liquid culture medium, and 1.5g / L agar is added.

[0050] Bromothymol blue (BTB) medium: K2HPO4 1.5g / L, MgSO4 7H2O 0.01g / L, sodium citrate 5.66g / L, Na2HPO4 7.9g / L, NaNO3 0.841g / L, NaNO2 0.362g / L, NH4Cl0.192g / L, trace element solution 2ml, BTB solution 1ml and agar 15g / L, pH is about 7.0.

[0051] Heterotrophic nitrification medium: (NH4)2SO4 0.47 g / L, sodium citrate 5.62 g / L and Wei's salt solution 50 mL.

[0052] Weiss salt solution: K2HPO4 5.0g / L, MgSO4·7H2O 2.5g / L, NaCl 2.5g / L, MnSO4·4H2O0.05g / L and FeSO4·7H2O 0.05g / L.

[0053] Gries reagent: Dissolve 0.5 g of p-aminobenzenesulfonic acid in 50 mL of 30% acetic acid and store in a dark place. Dissolve 0.4 g of α-naphthylamine in 100 mL of distilled water and boil. Mix the colorless supernatant with 6 mL of 80% acetic acid. Mix the two liquids in equal amounts before use.

[0054] MRS medium: peptone 10g / L, beef extract powder 8.0g / L, yeast extract powder 4.0g / L, glucose 20.0g / L, dipotassium hydrogen phosphate 2.0g / L, diammonium hydrogen citrate 2.0g / L, sodium acetate 5.0g / L, magnesium sulfate 0.2g / L, manganese sulfate 0.04g / L and Tween 80 1.0g / L. The pH of the solution is about 6.5. MRS solid medium is supplemented with 1.5% agar.

[0055] CAS detection culture medium: chrome azuro blue S (CAS) 60.5 mg / L, hexadecyltrimethylammonium bromide (HDTMA) 72.9 mg / L, ferric chloride hexahydrate 2.645 mg / L, sodium dihydrogen phosphate dihydrate 295.25 mg / L, sodium dihydrogen phosphate dodecahydrate 1213.5 mg / L, ammonium chloride 125 mg / L, potassium dihydrogen phosphate 37.5 mg / L, sodium chloride 62.5 mg / L and agar 9000 mg / L, the solution pH is about 8.6.

[0056] Example 1 Screening of strains

[0057] 1. Bacterial Isolation and Purification

[0058] 1. Experimental methods

[0059] Take 1 ml of aquaculture water (L. vannamei aquaculture water in Shanwei) and use LB liquid medium, R2A liquid medium, and denitrification liquid medium for enrichment culture. The enriched bacterial culture solution is heated with PBS phosphate buffer for 10 -1 , 10 -2 Up to 10 -8Perform gradient dilution, spread 200 μL of the diluted bacterial solution on nutrient agar medium, R2A solid medium and DM solid medium, make 3 parallels for each group, and use an equal amount of PBS as a blank control. Culture at 30°C for 1 to 3 days, select as many different single bacteria as possible based on the size, color, transparency, etc. of the colonies, and store in glycerol after 3 times of streak purification.

[0060] 2. Experimental results

[0061] The enriched bacterial culture fluid was diluted and spread on three solid culture media, and a total of 82 strains of bacteria were isolated, of which 30 strains were isolated from LB medium, 26 strains were isolated from R2A medium, and 26 strains were isolated from denitrification medium. The strains were numbered L / R / D-X, where L, R, and D represent LB, R2A, and DM culture media, respectively, and X represents a digital number.

[0062] 2. Preliminary screening of denitrifying strains

[0063] 1. Experimental methods

[0064] The purified single bacteria were inoculated into LB medium for activation, 10 μL of the activated bacterial solution was dropped into BTB denitrification identification medium, and an equal amount of sterile LB medium was used as a blank control, and inverted culture was performed at 30°C. Due to the action of the nitrate reductase of denitrifying bacteria, nitrates will be reduced to nitrites, thereby increasing the pH of the culture medium. Under the action of the acid-base indicator BTB, the culture medium changes from green to blue, thereby preliminarily judging the denitrification ability of the bacteria.

[0065] 2. Experimental results

[0066] Among the 82 strains of bacteria isolated, 13 strains had denitrification ability. The screening results are shown in Table 1. The culture media of 3 strains quickly turned blue within 24 hours of inoculation, and the color was darker. It was preliminarily determined that these 3 strains had the strongest denitrification ability; the culture media of 5 strains turned blue within 48 hours of inoculation, with different shades of color. It was preliminarily determined that these 5 strains had strong denitrification ability; the culture media of 5 strains also changed color 48 hours after inoculation. It was determined that these 5 strains had denitrification ability, but the ability was weak.

[0067] Table 1

[0068]

[0069] Note: 1) “+++” means strong, “++” means relatively strong, and “+” means weak;

[0070] 2) The time for the BTB medium to turn blue is < 1 day, indicating strong denitrification ability "+++"; 1 day < the time for the BTB medium to turn blue < 2 days, indicating relatively strong denitrification ability "++"; the time for the BTB medium to turn blue > 2 days, indicating weak denitrification ability "+".

[0071] III. Preliminary screening of nitrifying strains

[0072] 1. Experimental method

[0073] Inoculate the single bacteria with denitrification function preliminarily screened into LB medium for activation. Take 100 μL of the activated bacterial liquid and inoculate it into 100 mL of heterotrophic nitrification medium, and culture it on a shaker at 30 °C and 160 r / min for 48 h. Take 500 μL of the culture solution into a white disk, use an equal amount of sterile medium as a blank control, and add 2 drops of Griess reagent.

[0074] If the medium is red or brown, it is preliminarily judged that there is nitrite nitrogen in the medium. If the medium does not show color, add a small amount of zinc powder after 5 min. If the medium turns red, it indicates the presence of nitrate nitrogen. The nitrification ability of the bacteria can be preliminarily judged according to the color reaction.

[0075] 2. Experimental results

[0076] As shown in Table 2, among the 13 bacteria with denitrification ability, 8 bacteria were not detected with nitrification function, and 5 bacteria had nitrification ability, among which 3 bacteria had the strongest nitrification function and 2 bacteria had relatively strong nitrification ability.

[0077] Combined with the preliminary screening results of denitrification function, two strains of bacteria, D-1 and D-4, have both nitrification-denitrification functions.

[0078] Table 2 Preliminary screening of nitrifying strains

[0079]

[0080] Note: 1) "++" represents strong, "+" represents relatively strong, and "-" represents none

[0081] 2) The color of the culture solution is pink, indicating strong nitrification ability "++"; the color of the culture solution is light pink, indicating relatively strong nitrification ability "+"; the culture solution is colorless, indicating no nitrification ability "-".

[0082] Example 2 Antagonistic effect of strains D-1 and D-4 against Vibrio parahaemolyticus

[0083] I. Experimental method

[0084] Inoculate Vibrio parahaemolyticus into LB medium for activation, culture it at 30 °C and 160 r / min for 24 h, and dilute it to 10 with PBS 5Take 1mL of Vibrio parahaemolyticus dilution and mix it with DM agar medium which has been sterilized and cooled to about 40℃. Pour the mixture evenly into a plate as the identification medium for antagonistic bacteria of Vibrio parahaemolyticus.

[0085] The strains D-1 and D-4 were activated in LB medium, and the culture solution was applied to DM medium. The sterile LB culture solution was used as a control. Three groups of parallels were made for each strain. The plate was inverted and cultured at 30℃ for 24 hours. If a transparent inhibition zone appeared on the strain, it was preliminarily determined that the strain was an antagonist of Vibrio parahaemolyticus. The diameter of the inhibition zone was measured with a caliper.

[0086] 2. Experimental Results

[0087] Both strain D-1 and strain D-4 produced inhibition zones, and the diameters of the inhibition zones in DM agar medium were 37.15±0.49 mm and 18.7±1.27 mm, respectively.

[0088] Example 3 Genetic stability test of strains D-1 and D-4

[0089] 1. Experimental Methods

[0090] The strains D-1 and D-4 were subcultured five times on nutrient agar, and each time the strains were seeded on the identification medium of antagonistic bacteria to Vibrio parahaemolyticus, and the diameter of the inhibition zone was recorded. If the inhibition zone appeared in five subcultures and the size was stable, it was determined that the bacteria had the ability to antagonize Vibrio parahaemolyticus in a stably inherited manner.

[0091] 2. Experimental Results

[0092] The results are shown in Table 3. The strain D-1 has a stable and inherited ability to antagonize Vibrio parahaemolyticus, while the antagonistic properties of D-4 to Vibrio parahaemolyticus are lost during the passage.

[0093] Table 3 Stable genetic inheritance of the ability of D-1 and strains to antagonize Vibrio parahaemolyticus

[0094]

[0095] Example 4 Identification of strain D-1

[0096] 1. Colony morphology

[0097] The appearance of strain D-1 is as follows Figure 1 As shown, a single colony of strain D-1 is light yellow, slightly transparent, round in shape, with neat edges, moist and without protrusions.

[0098] 2. Electron microscopic morphology observation

[0099] 1. Experimental methods

[0100] Take 1 ml of bacterial liquid, centrifuge it, rinse it twice with physiological saline, add 1 mL of 2.5% glutaraldehyde fixative, mix it thoroughly, and let it stand overnight for fixation; after washing it with physiological saline for 3 times, perform gradient ethanol shrinkage, that is, add 30%, 50%, 70%, 80%, and 90% ethanol once, and 100% ethanol twice, let it stand for 15 minutes each time, and then centrifuge to remove the supernatant (dehydrate with 70% ethanol overnight, and continue gradient dehydration on the next day); send the sample to dry, and then observe it under a scanning electron microscope.

[0101] 2. Experimental results

[0102] The morphology of strain D-1 under scanning electron microscopy is as follows Figure 2 As shown: rod-shaped, without flagella and spores, with a size of (1.5~3.0)μm×(0.5~0.8)μm.

[0103] 3. 16S rDNA Identification

[0104] 1. Experimental methods

[0105] After activating strain D-1, the genomic DNA of the target strain was extracted using a bacterial DNA extraction kit and used as a template. The primers selected were bacterial 16S rDNA universal primers 27F (5′-AGAGTTTGATC(A / C)TGGCTCAG-3′) and 1492R (5′-TACGG(C / T)TACCTTGTTACGACTT-3′) for amplification.

[0106] The PCR reaction system was: 2×Taq PCR Mix 12.5μL, Forward Primer (27F) 1μL, Reverse Primer (1492R) 1μL, Template DNA 1μL and ddH2O 9.5μL

[0107] The PCR amplification products were detected by agarose gel electrophoresis and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing after the detection was correct. The sequencing results were submitted to the GenBank database.

[0108] 2. Experimental results

[0109] There was a bright band near 1500 bp and no other non-specific amplification bands. The fragment was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. The sequence is shown in SEQ ID NO: 1.

[0110] SEQ ID NO: 1:

[0111] GGGTCTAACACATGCAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCA

[0112] GCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAA

[0113] CGTCCGGAAACGGGCGCTAATAACCGCATACGTCCTGAGGGAGAAAGTGGG

[0114] GGATCTTCGGACCTCACGCTATCGATGAGCCTAGGTCGGATTAGCTAGTTG

[0115] GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGGAT

[0116] GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG

[0117] CAGTGGGGAATATTGGACAATGGGCGAAGCCTGATCCAGCCATGCCGCGT

[0118] GTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGG

[0119] CAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACCGG

[0120] CTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCG

[0121] GAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATGTGA

[0122] AATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAGAGTA

[0123] CGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAG

[0124] GAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGA

[0125] GGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACG

[0126] CCGTAAACGATGTCGACTAGCCGTTGGGATCCTTGAGATCTTAGTGGCGCA

[0127] GCTAACGCGATAAGTCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAAC

[0128] TCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATT

[0129] CGAAGCAACGCGAAGAACCTTACCTGGCCTTGACATGCTGAGAACTTTCC

[0130] AGAGATGGATTGGTGCCTTCGGGAACTCAGACACAGTGCTGCATGGCTGTC

[0131] GTCAGCTCGTGTCGTGAGATGTTGGGTTAAGTCCCGTACGAGCGCACCCTG

[0132] TCCTAGTACAGCACTCGTGGCACTCTAGGAGACTGCCGGTGACAACCGAGAAGGTGGGATGACGTCAGTCATCATGGCCCTTA.

[0133] (II) Evolutionary tree analysis

[0134] 1. Experimental methods

[0135] The sequences of the target strains were analyzed by BLAST alignment on NCBI, and other sequences with higher homology were selected to construct a phylogenetic tree using the Neighbor-Joining method in MEGA 5.2 software.

[0136] 2. Experimental results

[0137] Results Figure 3The 16S rRNA sequence of strain D-1 has high homology with many bacteria of the genus Pseudomonas. The similarity between D-1 and Pseudomonas aeruginosa strain DSM 50071 (NR117678.1) is more than 99%, and strain D-1 is determined to be Pseudomonas aeruginosa. Strain D-1 (Pseudomonas aeruginosa D-1) was deposited in Guangdong Provincial Microbiological Culture Collection Center on July 31, 2024, with the deposit number GDMCC No: 64925, and its taxonomic name is Pseudomonas aeruginosa.

[0138] Example 5 Nitrification-denitrification activity of strain D-1

[0139] 1. Experimental Methods

[0140] The activated strain D-1 was inoculated into 100 mL of heterotrophic nitrification medium, DM medium with nitrate and nitrite as the only nitrogen sources, and cultured at 30°C and 160 r / min for 5 days to determine the removal rates of ammonia nitrogen, nitrate nitrogen and nitrite.

[0141] 2. Experimental Results

[0142] The results showed that strain D-1 had a high degradation rate for ammonia nitrogen, nitrate and nitrite, among which the degradation rate for ammonia nitrogen reached 96.90%; the degradation rate for nitrate reached 97.18%; and the degradation rate for nitrite reached 93.84%, with high heterotrophic nitrification-aerobic denitrification functional activity.

[0143] Example 6 Nitrogen degradation characteristics of strain D-1

[0144] 1. Experimental Methods

[0145] The D-1 strain was inoculated into LB medium for activation. The activated bacterial solution was centrifuged to collect the bacterial precipitate, washed three times with PBS and resuspended, and inoculated into 100 mL of DM medium with NaNO3, NaNO2 and (NH4)2SO4 (initial concentrations were all 273 mg / L) as the sole nitrogen source, respectively. The initial OD 600 0.1, 30℃, 160r / min shaking culture for 5 days. NO3 was measured every 24h - -N, NO2 - -N、NH4 + -N content.

[0146] 2. Experimental Results

[0147] 1. Degradation characteristics of ammonia nitrogen

[0148] The results are as follows Figure 4 As shown, strain D-1 can convert the initial 274 mg / L NH4 + -N degradation was 0.57mg / L, and the removal rate was 2.27mg / L / h. The degradation rate peaked on the second day, at 4.49mg / L / h. During the entire ammonia nitrogen consumption process, a small amount of intermediate products, nitrate and nitrite, were generated. NO3 - -N can reach up to 12.70mg / L, NO2 - -N can reach up to 1.264mg / L, among which the maximum generation of nitrite, which is more toxic to aquatic animals, does not exceed 1.5mg / L, and its accumulation increases with NH4 + -N degradation also gradually decreased.

[0149] 2. Nitrate degradation characteristics

[0150] result Figure 5 As shown, D-1 can convert the initial 273 mg / L NO3 - -N degradation was 7.26 mg / L, and the removal rate was 2.22 mg / L / h. The rate of nitrate degradation by D-1 was the highest on the third day, which was 3.72 mg / L / h. In the late stage of degradation, the degradation rate slowed down due to the consumption of nutrients in the culture medium and the generation of bacterial metabolites.

[0151] During the entire nitrate consumption process, a small amount of intermediate nitrite was generated, but the maximum cumulative amount was very low, at 0.13 mg / L. Ammonia nitrogen was also generated in a small amount during the entire process, with the maximum generation amount being 0.8 mg / L. The reason may be that in the late fermentation period, the autolysis of the bacteria caused the release of intracellular ammonia nitrogen, or the organic nitrogen of some dying cells was converted into ammonia nitrogen, resulting in a small amount of NH4 being detected in the culture medium. + -N.

[0152] 3. Degradation characteristics of nitrite

[0153] result Figure 6As shown, strain D-1 can effectively degrade nitrite, and the nitrite degradation rate of D-1 is 1.77 mg / L / h. Strain D-1 did not start to degrade nitrite quickly on the first and second days compared with ammonia nitrogen and nitrate nitrogen. The possible reason is that the strain was stressed by high concentrations of nitrite. The strain did not grow and reproduce rapidly during the adaptation period, but after two days, DM gradually recovered its activity and began to degrade nitrite. On the fifth day, the degradation rate reached 3.91 mg / L / h. Ammonia nitrogen was also detected in small amounts throughout the process, with the highest cumulative amount of 0.071 mg / L, which may be due to the autolysis of the bacteria and the conversion of organic nitrogen of the dying cells into ammonia nitrogen.

[0154] Antagonistic effects of the fermentation broth, supernatant and resuspended precipitate of Example 7D-1 against Vibrio parahaemolyticus

[0155] 1. Experimental Methods

[0156] The strain D-1 was inoculated into 100 mL of LB medium, and cultured at 30°C and 160 r / min with shaking for 24 h. 50 mL of the culture medium was taken for storage, and the remaining 50 mL of the culture medium was centrifuged to obtain the supernatant. The supernatant was filtered through a 0.22 μm bacterial filter to obtain a sterile supernatant. The precipitate was washed with sterile PBS and resuspended to obtain a resuspended precipitate. The sterile supernatant and resuspended precipitate were stored at 4°C.

[0157] Spread a 6mm sterile filter paper in the center of the identification medium for the antagonist of Vibrio parahaemolyticus. Take 20μL of culture medium, sterile supernatant and resuspended precipitate and drop them on the filter paper of the identification medium. An equal amount of sterile culture medium is used as a control. Each strain is made in triplicate. The plate is inverted and cultured at 30℃ for 24h, and the diameters of the inhibition zones of the fermentation broth, sterile supernatant and resuspended precipitate are compared.

[0158] 2. Experimental Results

[0159] The results are shown in Table 5. The fermentation broth, fermentation supernatant and fermentation precipitate of D-1 strain all formed inhibition zones, and the sizes of the inhibition zones were almost the same, all larger than 15 mm, indicating that it can antagonize Vibrio parahaemolyticus. The ability of the supernatant to produce inhibition zones indicates that the antibacterial substances produced by the strain can be secreted outside the cell.

[0160] Table 5 Inhibition zones formed by fermentation broth, supernatant and resuspended precipitate of D-1

[0161]

[0162] Example 8 Co-culture of D-1 strain and Vibrio parahaemolyticus

[0163] 1. Experimental Methods

[0164] D-1 strain and Vibrio parahaemolyticus were inoculated into 100mL LB medium, shaken and cultured at 30℃ and 160r / min for 24h as seed solution, and 200μL of D-1 strain and Vibrio parahaemolyticus seed solution were inoculated into 100mL LB medium for co-culture, with Vibrio parahaemolyticus cultured alone as control. After shaking and cultured at 30℃ and 160r / min for 48h, gradient dilution was performed and spread on TCBS solid medium, with three groups of parallels for each concentration, and the plate was inverted and cultured at 30℃ for 24h before counting. Since Vibrio parahaemolyticus is blue-green on TCBS medium, blue-green circular colonies were selected for counting.

[0165] 2. Experimental Results

[0166] Results Figure 7 The result of single culture count of Vibrio parahaemolyticus was 26.16×10 10 CFU / mL, the co-culture count of D-1 and Vibrio parahaemolyticus was 11.83×10 10 CFU / mL, the co-culture results were significantly lower than those of Vibrio parahaemolyticus alone, indicating that strain D-1 can effectively inhibit the reproduction of Vibrio parahaemolyticus.

[0167] Example 9 Effect of environmental factors on strain antagonism

[0168] 1. Effect of temperature on the antagonistic ability of strains

[0169] 1. Experimental methods

[0170] The culture fluid, sterile supernatant and resuspended precipitate of the D-1 strain prepared in Example 7 were taken, and the three samples were treated at 30, 60, 80, 100 and 121°C for 30 min, and immediately returned to room temperature. The 30°C treatment was used as a control, and the diameter of the inhibition zone was determined by the method of Example 7, and each group was repeated three times.

[0171] 2. Experimental results

[0172] The culture medium of the D-1 strain contains extracellular antibacterial substances and bacteria, the sterile supernatant contains extracellular antibacterial substances, and the resuspended precipitate is the resuspension of the bacteria. During the plate culture process, the bacteria in the culture medium and the resuspended precipitate will grow rapidly and produce antibacterial active substances.

[0173] The results are shown in Table 6. At 30 and 60 °C, the sizes of the inhibition zones of the three samples all decreased with the increase of temperature, but the sizes of the inhibition zones were still above 20 mm, indicating that although the treatment at 60 °C reduced the antibacterial activity, the impact was relatively small; at 80 and 100 °C, all three still had inhibition zones, but the sizes decreased to below 20 mm; after autoclaving at 121 °C, the fermentation broth and the supernatant showed inhibition zones below 10 mm, and the precipitate had no antibacterial effect, indicating that the bacteria in the fermentation broth and the precipitate could not grow after being inactivated at high temperature and could not produce antibacterial substances, while the extracellular antibacterial substances in the culture medium and the sterile supernatant could still exert antibacterial effects, indicating that the extracellular antibacterial substances of the strain had good thermal stability.

[0174] Under the conditions of pasteurization at 100 °C and autoclaving at 121 °C for strain D-1, the extracellular antibacterial substances of strain D-1 could maintain antibacterial activity and had good thermal stability.

[0175] Table 6 Effects of temperature on the antagonistic ability of the strain

[0176]

[0177] II. Effects of pH on the antagonistic ability of the strain

[0178] 1. Experimental method

[0179] Take the culture medium, sterile supernatant and resuspended precipitate of strain D-1 prepared in Example 7. Adjust the pH of the three samples to 3, 5, 7, 9, 11 and 13 with HCl solution and NaOH solution respectively, and adjust the samples to the same volume with sterile PBS. Treat for 30 min, then water bath at 37 °C for 1 h, and then adjust the pH value to 7. Measure the diameter of the inhibition zone by the method of Example 7, and repeat each group three times.

[0180] 2. Experimental results

[0181] The results are shown in Table 7. When pH = 3, none of the three samples produced inhibition zones, indicating that both the bacteria and the extracellular antibacterial substances were inhibited by strong acid and had no antagonistic ability against Vibrio parahaemolyticus; when 5 < pH < 9, the sizes of the inhibition zones of the three samples were all greater than 20 mm, and the antibacterial activity of the extracellular antibacterial substances produced by the strain was relatively high. When pH = 11, the antibacterial activity decreased slightly, and when pH = 13, the extracellular antibacterial substances still had antibacterial activity. The results showed that the extracellular antibacterial substances of the strain had good acid-base stability.

[0182] Table 7 Effects of pH on the antagonistic ability of the strain

[0183]

[0184] III. Effects of ultraviolet light on the antagonistic ability of the strain

[0185] 1. Experimental methods

[0186] The culture fluid, sterile supernatant and resuspended precipitate of the D-1 strain prepared in Example 7 were taken, and the three samples were irradiated with ultraviolet light for 30, 60, 90 and 120 min. The untreated samples were used as controls, and the diameter of the inhibition zone was determined by the method of Example 8. Each group was repeated three times.

[0187] 2. Experimental results

[0188] The results are shown in Table 8: After 30 and 60 minutes of ultraviolet irradiation, there was no significant difference in the size of the inhibition zone of the three samples, all of which were around 30 mm, indicating that the activity of the antibacterial substance did not change significantly. After 90 minutes of ultraviolet irradiation, the diameter of the precipitated inhibition zone was 0 mm, indicating that the bacteria were inhibited and could not grow, but the diameter of the inhibition zone of the fermentation broth and the supernatant was around 20 mm, indicating that the extracellular antibacterial substances were still tolerable. After 120 minutes of irradiation, both the bacteria and the extracellular antibacterial substances were inactive. The results show that the antibacterial substances produced by the strain are ultraviolet stable to a certain extent.

[0189] Table 8 Effect of ultraviolet light on the antagonistic ability of strains

[0190]

[0191] Example 10D-1 Iron uptake and biofilm production ability of strain

[0192] 1. Iron uptake capacity of D-1 strain

[0193] 1. Experimental methods

[0194] The D-1 strain was inoculated into CAS agar medium and cultured at 30°C for 48 h to observe whether there was any obvious color change around the colonies.

[0195] 2. Experimental results

[0196] The results are as follows Figure 8 As shown, an obvious orange-yellow halo appeared around the D-1 colony, indicating that the D-1 strain can produce iron carriers to chelate iron in the culture medium and has an iron uptake system.

[0197] 2. Biofilm production ability of D-1 strain

[0198] 1. Experimental methods

[0199] After the D-1 strain was activated, it was inoculated into LB medium, and the culture solution was diluted to OD600 = 0.02. 150 μL of the culture solution was aspirated into a 96-well cell culture plate, and incubated at 30°C for 48 hours. The culture solution was removed, and the plate was rinsed with PBS three times, and then dried at 30°C. 1% crystal violet solution was added and incubated for 20 minutes, rinsed and dried, and 150 μL of dimethyl sulfoxide was added to the wells, incubated for 20 minutes, and the absorbance at 590 nm was measured. If D590 nm ≥ 1, the strain was considered to have good biofilm formation ability.

[0200] 2. Experimental results

[0201] The results are as follows Fig. 9 As shown, OD590 nm = 3.65 ± 0.03, indicating that the D-1 strain has a strong ability to produce biofilm. The strong ability to produce biofilm can promote the colonization of the D-1 strain in the intestine of aquatic products, adhere to the epithelial surface, interfere with the adhesion of pathogens to the intestinal mucosa, and play a role in regulating the balance of intestinal flora and resisting the invasion of pathogens.

[0202] Example 11 Enzyme production capacity of D-1 strain

[0203] 1. Experimental Methods

[0204] Agar diffusion method was used to determine the enzyme production capacity:

[0205] Add skim milk powder to the nutrient agar medium to detect the protease activity of the D-1 strain. After the identification medium is cooled, drop the same volume of bacterial liquid in the center of the plate. There is a transparent protein hydrolysis circle around the colony, indicating that the strain has protease activity.

[0206] Soluble starch in nutrient agar medium was used to detect the amylase activity of the D-1 strain. A 1% iodine solution was dropped on the surface of the culture medium plate. A visible decolorization halo appeared around the colony, indicating that the strain had amylase activity.

[0207] 1% Tween 80 was added to the nutrient agar medium to detect the lipase activity of the D-1 strain. A fatty acid precipitation ring was formed around the colony, indicating that the strain had lipase activity.

[0208] 2. Experimental Results

[0209] The digestive enzyme activity of strain D-1 is as follows Fig.10 As shown: on the nutrient agar medium supplemented with skimmed milk powder, there was a transparent proteolysis zone around the colonies, and after the plate was cultured for 1 day, all the white skimmed milk powder was completely degraded, indicating that the strain had a high protease activity; and no amylase activity and lipase activity of the strain were detected.

Claims

1. A Pseudomonas aeruginosa D-1, characterized in that On July 31, 2024, it was deposited in Guangdong Provincial Microbiological Culture Collection Center with the deposit number GDMCC No: 64925.

2. Use of one or more of the Pseudomonas aeruginosa D-1, its fermentation broth and its culture supernatant as claimed in claim 1 in combating Vibrio parahaemolyticus.

3. Use of one or more of the Pseudomonas aeruginosa D-1, its fermentation broth and its culture supernatant as claimed in claim 1 in the preparation of products against Vibrio parahaemolyticus.

4. The use of Pseudomonas aeruginosa D-1 according to claim 1 in denitrification, characterized in that: The denitrification is the degradation of one or more of ammonia nitrogen, nitrate and nitrite.

5. The use of Pseudomonas aeruginosa D-1 according to claim 1 in preparing a denitrification product, characterized in that: The denitrification is the degradation of one or more of ammonia nitrogen, nitrate and nitrite.

6. A product for resisting Vibrio parahaemolyticus and / or denitrification, characterized in that: The method is prepared by using the Pseudomonas aeruginosa D-1 described in claim 1, wherein the denitrification is the degradation of one or more of ammonia nitrogen, nitrate and nitrite.

7. A product for resisting Vibrio parahaemolyticus and / or denitrification, characterized in that: Contains the Pseudomonas aeruginosa D-1 as described in claim 1, and the denitrification is the degradation of one or more of ammonia nitrogen, nitrate and nitrite.

8. A product for resisting Vibrio parahaemolyticus, characterized in that: The method is prepared by using the fermentation liquid or culture supernatant of Pseudomonas aeruginosa D-1 described in claim 1.

9. A method for combating Vibrio parahaemolyticus, characterized in that: Use one or more of the Pseudomonas aeruginosa D-1, its fermentation broth and its culture supernatant as described in claim 1, or the product as described in any one of claims 6 to 8.

10. A method for denitrification, characterized in that: Using the Pseudomonas aeruginosa D-1 described in claim 1, or the product described in claim 6 or 7, the denitrification is the degradation of one or more of ammonia nitrogen, nitrate and nitrite.

Images