Strain co-culture system for scopoletin synthesis and its application

Abstract

The present invention relates to the field of biosynthesis technology, and in particular to a strain co-cultivation system for scopoletin synthesis and its application, wherein the system comprises a high-yield caffeic acid recombinant strain and a scopoletin synthesis recombinant strain, wherein the high-yield caffeic acid recombinant strain and the scopoletin synthesis recombinant strain are cultured separately and then mixed and co-cultivated. The purpose is to achieve independent optimization of upstream and downstream modules, reduce the metabolic burden of long synthesis pathways, select suitable host cells according to exogenous genes, and finally achieve efficient de novo synthesis of scopoletin, providing technical support for the green and large-scale production of scopoletin.

Description

Technical Field

[0001] The invention relates to the technical field of biosynthesis, and in particular to a bacterial strain co-culture system for scopoletin synthesis and application thereof. Background Art

[0002] Scopoletin, also known as scopoletin lactone or scopoletin, belongs to the coumarin class of compounds, and its chemical name is 6-methoxy-7-hydroxycoumarin. This compound is widely found in many plants, such as Dahurian angelica, Dinggongteng and tobacco of the Umbelliferae family. It has attracted much attention due to its rich pharmacological activities, including anti-tumor, anti-inflammatory, antioxidant, prevention and treatment of hyperuricemia and anti-neurodegenerative diseases. In the medical field, scopoletin can be used to treat bronchial diseases and asthma, and can also relieve symptoms of anxiety and depression. It is particularly important that it is non-toxic to normal cells, which makes it a potential lead compound in pharmaceutical research and development. Through structural modification, such as introducing cinnamic acid into the 7th position of scopoletin or the 3rd position of 3-aminoscopoletin, a variety of scopoletin derivatives with strong anti-tumor activity against human tumor cells can be synthesized. In addition, scopoletin is also widely used in agricultural production because of its insecticidal, antibacterial, and mite-killing effects. In the tobacco industry, the scopoletin content in tobacco leaves is an important indicator of cigarette quality. Scopoletin can also be used as a fragrance raw material in the production of high-quality cigarettes to improve the flavor and quality of cigarettes. It can be seen that scopoletin has broad prospects in the medical field and also plays an important role in agricultural production and the tobacco industry.

[0003] Currently, scopoletin is mainly produced through two methods: chemical synthesis and natural plant extraction. The chemical synthesis method is often limited by low yield, high cost and the use of large amounts of harmful solvents; the plant extraction method relies on specific medicinal plants such as Trichosanthes kirilowii, which have a long growth cycle, a complex biological system and diverse components, which brings many inconveniences to the extraction, resulting in cumbersome and high-cost extraction processes, and is also prone to raw material loss and waste of resources.

[0004] Microbial synthesis technology has gradually become an important way to obtain high value-added rare natural products with its significant advantages of short cycle, low cost and green environmental protection. Existing microbial synthesis of scopoletin mostly uses ferulic acid as the starting substrate. Scopoletin was synthesized by reconstructing the scopoletin synthesis pathway through Pc4CL from parsley and AtF6′H1 from Arabidopsis and heterologously expressing it in Escherichia coli. When the highly catalytically active sweet potato-derived IbF6′H2 and rice-derived Os4CL isozymes were used, and the solubility of F6′H was improved by combining GST fusion expression technology, and ferulic acid was used as the substrate for synthesis in Escherichia coli, the yield of scopoletin was greatly improved.

[0005] However, the synthesis of scopoletin has problems such as lengthy metabolic pathways, low levels of exogenous gene expression, and difficulty in regulating metabolic flux, making it difficult to meet the needs of efficient production of scopoletin. Summary of the invention

[0006] In view of this, the purpose of the present invention is to provide a strain co-cultivation system for scopoletin synthesis and its application, which can not only realize independent optimization of upstream and downstream modules and reduce the metabolic burden of long synthetic pathways, but also select suitable host cells according to exogenous genes, and ultimately realize efficient synthesis of scopoletin from scratch, providing technical support for the green and large-scale production of scopoletin.

[0007] The present invention solves the above technical problems by the following technical means:

[0008] A strain co-cultivation system for scopoletin synthesis includes a caffeic acid high-yield recombinant strain and a scopoletin synthesis recombinant strain. The caffeic acid high-yield recombinant strain and the scopoletin synthesis recombinant strain are cultured separately and then mixed and co-cultivated.

[0009] Preferably, the addition ratio of the caffeic acid high-yielding recombinant strain to the scopoletin-synthesizing recombinant strain is 1:1-10.

[0010] Further preferably, the fermentation medium of the co-culture system is one of M9 liquid medium and M9Y liquid medium.

[0011] Preferably, the culture conditions of the co-culture system are: fermentation at 28-37° C. and 200-300 rpm for 36-72 hours, adding IPTG inducer during fermentation, and adding glucose as the initial raw material.

[0012] Preferably, the caffeic acid high-yielding recombinant strain comprises the following steps during fermentation culture:

[0013] S1. Inoculate a single colony of the caffeic acid high-yielding recombinant strain into LB liquid medium and culture overnight until the optical density of the bacterial solution reaches OD 600 Reach 1.0;

[0014] S2. Inoculate the bacterial solution into new LB liquid medium at a ratio of 1:100. After continuing to culture for 3-5 hours, collect the bacteria by centrifugation and resuspend the bacterial pellet in M9 liquid medium to a value of OD 0. 600 Reach 1.0;

[0015] Preferably, the caffeic acid high-yielding recombinant strain is: BL21 Star (DE3)-pACYC::glnSm-FjTAL-J23101*-EchpaBC or / and BL21 Star (DE3)-pACYC::glnSm-FjTAL-J23101*-EchpaBC-J23101*-EchpaBC.

[0016] Preferably, the scopoletin synthetic recombinant strain comprises the following steps during fermentation culture:

[0017] S3. Pick a single colony of the scopoletin synthesis recombinant strain and inoculate it into LB liquid medium, and culture it overnight until the bacterial liquid OD 600 to 1.0;

[0018] S4. Inoculate into LB liquid medium at a ratio of 1:100 and continue to culture for 3-5 hours. Collect the cells by centrifugation and resuspend the cell pellet in M9 liquid medium to a value of OD 600 Reach 1.0;

[0019] Preferably, the co-culture and fermentation of the scopoletin-synthesizing strain comprises the following steps:

[0020] The caffeic acid high-yielding recombinant strain solution resuspended from S2 and the scopoletin synthesis recombinant strain solution resuspended from S4 were inoculated into M9 liquid medium in proportion, and the OD 600 The final concentration value is 0.1; then IPTG inducer and glucose are added, and fermentation is carried out at 28-37°C and 200-300rpm for 36-72h.

[0021] Preferably, the scopoletin synthetic recombinant strain comprises the following steps during synthesis:

[0022] S5. Using the plasmid containing the synthetic gene of AtF6′H2 as a template, the target fragment AtF6′H2 was amplified using the primer pair AtF6′H2-EcoRI-F and AtF6′H2-AflII-R;

[0023] S6. The AtF6′H2 treated in step S5 was double-digested with EcoRI and AflII, and ligated to the corresponding position of the pGEX6p-1 plasmid treated with EcoRI and AflII to construct the intermediate vector pGEX 6p-1::AtF6′H2;

[0024] S7. PCR amplification of the plasmid template containing the Os4CL synthetic gene was performed using RBS-Os4CL-AflII-F and Os4CL-XhoI-R primers to amplify the target fragment Os4CL;

[0025] S8. The Os4CL treated in step S7 was double-digested with AflII and XhoI, and then connected to the corresponding position of the intermediate vector pGEX 6p-1::AtF6′H2 treated with XhoI and AflII to construct pGEX 6p-1::AtF6′H2-RBS-Os4CL;

[0026] S9. Using the plasmid containing the AtCOMT synthetic gene as a template, PCR amplify RBS-AtCOMT using the AtCOMT-hm-XhoI-F / R primer pair to obtain the target fragment RBS-AtCOMT;

[0027] S10. The RBS-AtCOMT treated in step S9 was connected to the corresponding position of the pGEX 6p-1::AtF6′H2-RBS-Os4CL plasmid linearized by XhoI to obtain the recombinant plasmid pGEX 6p-1::AtF6′H2-RBS-Os4CL-RBS-AtCOMT.

[0028] S11. Transform the recombinant plasmid pGEX 6p-1::AtF6′H2-RBS-Os4CL-RBS-AtCOMT into competent cells to obtain a scopoletin-synthesizing recombinant strain.

[0029] Preferably, in step S11, the competent cells are Escherichia coli.

[0030] The present application also discloses an application of a bacterial strain co-culture system for scopoletin synthesis, which is applied to the synthesis of scopoletin.

[0031] The present application adopting the above scheme has the following beneficial effects:

[0032] 1. In this application, synthetic biology metabolic engineering was used to select Escherichia coli BL21Star (DE3) with excellent heterologous protein expression as the chassis cell, and a co-culture system of scopoletin de novo synthesis strains was established by co-cultivating high-yield caffeic acid strains and scopoletin synthesis strains. The yield of scopoletin de novo synthesized by the strain co-cultivation system was 0.86 mg / L, which was significantly better than the single strain system (0.14 mg / L). It can be seen that the dual-strain co-cultivation strategy is helpful to establish a scopoletin de novo efficient synthesis system and promote the low-cost and green and efficient synthesis of scopoletin;

[0033] 2. In this application, the microbial synthesis based on the strain co-culture system can avoid many problems of the traditional production model of scopoletin, such as high cost, long cycle, difficult separation and purification, and environmental pollution, and has good economic and environmental effects.

[0034] 3. In this application, the co-culture system can not only realize independent optimization of upstream and downstream modules and reduce the metabolic burden of the long synthetic pathway, but also select suitable host cells according to exogenous genes, and ultimately realize efficient synthesis of scopoletin from scratch, providing technical support for the green and large-scale production of scopoletin. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] The present application may be further illustrated by non-limiting examples given in the accompanying drawings;

[0036] Figure 1 It is a schematic diagram of the de novo synthesis metabolic pathway of scopoletin based on the bacterial strain co-culture system in this application;

[0037] Figure 2 This is the enzyme cleavage verification diagram of the scopoletin module with ferulic acid as the substrate in this application;

[0038] Figure 3 This is a HPLC analysis chart of the fermentation products of the recombinant strains SPT01 and SPT02 of the scopoletin module with ferulic acid as the substrate in the present application;

[0039] Figure 4 This is the enzyme cleavage verification diagram of the scopoletin module with caffeic acid as the substrate in this application;

[0040] Figure 5 This is a HPLC analysis chart of the fermentation products of the recombinant strains SPT03 and SPT04 of the scopoletin module with caffeic acid as the substrate in the present application;

[0041] Figure 6 This is the HPLC analysis chart of the fermentation product of the recombinant strain SPT05 for de novo synthesis of scopoletin using glucose as a substrate in the present application;

[0042] Figure 7 It is a HPLC qualitative analysis of the fermentation products of the co-culture system of the strains with glucose as the substrate in the present application, wherein A: CA11-SPT03; B: CA13-SPT03;

[0043] Figure 8 It is the HPLC quantitative analysis of the fermentation products of the co-culture system of the strains with glucose as the substrate in the present application, wherein A: CA11-SPT03; B: CA13-SPT03. DETAILED DESCRIPTION

[0044] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention:

[0045] The following raw materials are used in constructing the bacterial strain co-culture system for scopoletin synthesis in the present application:

[0046] M9 medium (g / L): M9 Broth 11.30, glucose 5.00, calcium chloride 0.0147, magnesium sulfate 0.246, ferrous sulfate 0.003, thiamine hydrochloride 0.01, CaCO3 5.00; autoclave at 121°C for 15 min.

[0047] LB liquid medium (g / L): 10.0 g tryptone, 5.0 g yeast extract, 10.0 g NaCl; solid LB medium, add 12 g or 15 g agar powder according to the needs. Autoclave at 121°C for 15 minutes.

[0048] Expression vector: pGEX 6p-1 plasmid carrying the solubilizing protein GST;

[0049] Host cells: Caffeic acid cell BL21 Star (DE3), from the paper: Reconstruction of caffeic acid synthesis pathway and its heterologous expression in Escherichia coli "DOI: 10.13343 / j.cnki.wsxb.20240354;

[0050] Caffeic acid high-producing strain CA11: BL21 Star(DE3)-pACYC::glnSm-FjTAL-J23101*-EchpaBC; CA13: BL21 Star(DE3)-pACYC::glnSm-FjTAL-J23101*-EchpaBC-J23101*-EchpaBC, from the paper: "Reconstruction of the caffeic acid synthesis pathway and its heterologous expression in Escherichia coli" DOI:10.13343 / j.cnki.wsxb.20240354;

[0051] The gene sequence of 4-coumarate-CoA ligase Os4CL from rice (Oryza sativa) is:

[0052]

[0053] The gene sequence of ferulic acid-6'-hydroxylase AtF6′H2 from Arabidopsis thaliana is:

[0054]

[0055] The gene sequence of ferulic acid-6'-hydroxylase IbF6′H2 from sweet potato (Ipomoea batatas) is:

[0056]

[0057] Caffeic acid methylase AtCOMT from Arabidopsis thaliana; its gene sequence is:

[0058]

[0059] Example 1, Scopoletin module engineering strain using ferulic acid as substrate

[0060] S5. Using the plasmid containing the synthetic gene of AtF6′H2 as a template, the target fragment AtF6′H2 was amplified by PCR using the primer pair AtF6′H2-EcoRI-F (AATTGAATTCATGGCGCCGACCCTGCTGA SEQ ID NO.1) and AtF6′H2-AflII-R (TTAACTTAAGCTTAAATTTTCGCATAATCCACGGTTTTTTTGC SEQ ID NO.2);

[0061] PCR amplification reaction system (50.0 μL): GXL DNA Polymerase (1.25U / μL) 1.0μL, 5× PrimeSTAR GXL Buffer 10.0μL, dNTP Mixture (2.5mmol / L) 4.0μL, AtF6′H2-EcoRI-F and AtF6′H2-AflII-R (10μmol / L) 2.0μL each, plasmid template containing AtF6′H2 1.0μL, ddH2O 30.0μL.

[0062] PCR reaction conditions: 98°C pre-denaturation for 5 min; 98°C denaturation for 30 s, 60°C annealing for 30 s, 68°C extension for 1.2 min, a total of 30 cycles; 68°C final extension for 5 min;

[0063] Using the plasmid containing the IbF6′H2 synthetic gene as a template, the target fragment IbF6′H2 was amplified by PCR using the primer pair IbF6′H2-EcoRI-F (AATTGAATTCATGATGCCGAGCACCACCCTGAGC SEQ ID NO.3) and IbF6′H2-AflII-R (TTAACTTAAGTTATTCAATGCGCGCAAACGCAATGG SEQ ID NO.4);

[0064] PCR amplification reaction system (50.0 μL): 1.0 μL of GXL DNA Polymerase (1.25 U / μL), 10.0 μL of 5× PrimeSTAR GXL Buffer, 4.0 μL of dNTP Mixture (2.5 mmol / L), 2.0 μL each of IbF6′H2-EcoRI-F and IbF6′H2-AflII-R (10 μmol / L), 1.0 μL of plasmid template containing IbF6′H2, and 30.0 μL of ddH2O.

[0065] PCR reaction conditions: 98°C pre-denaturation for 5 min; 98°C denaturation for 30 s, 60°C annealing for 30 s, 68°C extension for 1.2 min, a total of 30 cycles; 68°C final extension for 5 min;

[0066] S6. The AtF6′H2 treated in step S5 was double-digested with EcoRI and AflII, and ligated to the corresponding position of the pGEX6p-1 plasmid treated with EcoRI and AflII to construct the intermediate vector pGEX 6p-1::AtF6′H2;

[0067] IbF6′H2 treated in step S5 was double-digested with EcoRI and AflII, and ligated to the corresponding position of pGEX 6p-1 plasmid treated with EcoRI and AflII to construct the intermediate vector pGEX 6p-1::IbF6′H2;

[0068] S7. PCR amplification was performed using the primers RBS-Os4CL-AflII-F (AATTCTTAAGaaggagatataccaATGGGCAGCGTGGCGGCCSEQ ID NO.5) and Os4CL-XhoI-R (TTAATCGAGTTAGCTGCTTTTCGGCGCATCC SEQ ID NO.6) to amplify the target fragment Os4CL using the synthetic gene plasmid as a template;

[0069] PCR amplification reaction system (50.0 μL): GXL DNA Polymerase (1.25U / μL) 1.0μL, 5× PrimeSTAR GXL Buffer 10.0μL, dNTP Mixture (2.5mmol / L) 4.0μL, RBS-Os4CL-AflII-F and Os4CL-XhoI-R (10μmol / L) 2.0μL each, plasmid template containing Os4CL 1.0μL, ddH2O 30.0μL.

[0070] PCR reaction conditions: 98°C pre-denaturation for 5 min; 98°C denaturation for 30 s, 60°C annealing for 30 s, 68°C extension for 1.8 min, for a total of 30 cycles; 68°C final extension for 5 min;

[0071] S8. The Os4CL treated in step S7 was double-digested with AflII and XhoI, and then connected to the corresponding position of the intermediate vector pGEX 6p-1::AtF6′H2 treated with AflII and XhoI to construct the pGEX 6p-1::AtF6′H2-RBS-Os4CL recombinant plasmid;

[0072] The Os4CL treated in step S7 was double-digested with AflII and XhoI, and then ligated to the corresponding position of the intermediate vector pGEX6p-1::IbF6′H2 treated with AflII and XhoI to construct the pGEX 6p-1::IbF6′H2-RBS-Os4CL recombinant plasmid.

[0073] The pGEX 6p-1::AtF6′H2-RBS-Os4CL recombinant plasmid and pGEX 6p-1::IbF6′H2-RBS-Os4CL recombinant plasmid were verified by HincII and BamHI restriction enzyme digestion (such as Figure 2 The two recombinant plasmids were transformed into Escherichia coli BL21 Star (DE3) and the resulting strains were named SPT01 and SPT02. Subsequently, ferulic acid was used as a substrate and the amount of ferulic acid added was 0.3 mmol / L. The two recombinant strains were subjected to liquid fermentation, and the fermentation products were collected after 48 hours and analyzed by HPLC together with ferulic acid and scopoletin standards.

[0074] The fermentation method is as follows:

[0075] SPT01 and SPT02 were inoculated into a 100 mL conical flask containing 30 mL of M9 liquid culture medium at a ratio of 1:1-10, and the bacterial solution OD 600 The final concentration value was 0.1, and a final concentration of 0.2 mmol / L IPTG inducer and 0.3 mmol / L ferulic acid were added, and the culture was fermented at 37°C and 220 rpm for 48 h.

[0076] The HPLC analysis method is as follows:

[0077] Take 1 mL of fermentation broth and add an equal volume of ethyl acetate. After vortexing for 1 min, centrifuge at 12000 rpm for 10 min and take the supernatant. Repeat the same steps once and combine the two ethyl acetate extracts. After evaporating the solvent using a concentrator, add 0.3 mL of chromatographically pure methanol to dissolve the sample, filter it through a 0.22 m filter membrane, and then perform HPLC and HPLC-MS analysis. At the same time, use chromatographically pure methanol to prepare standard solutions of p-coumaric acid, caffeic acid, ferulic acid, and scopoletin, and perform HPLC detection together with the treated samples.

[0078] HPLC detection conditions are as follows: the chromatographic column is a ZORBAX SB-C18 reverse phase column (250mm×4.6mm, particle size is 5μm), the mobile phase A is 0.1% formic acid water, the mobile phase B is chromatographic pure methanol, the flow rate is 0.8mL / min; the injection volume is 10μL; the column temperature and detection wavelength are adjusted according to the test substance, column temperature: 30℃ (phenolic acid compounds) / 39℃ (scopoletin). The detection wavelengths of caffeic acid, p-coumaric acid, ferulic acid and scopoletin are 324nm, 308nm, 322nm and 343nm, respectively. The present application adopts a gradient elution method, and the specific elution conditions of phenolic acid compounds are: 0-8min, 5%~50% methanol; 8-10min, 50%~100% methanol; 10-12min, 100%~5% methanol; 12-24min, 5% methanol. The specific elution conditions of scopoletin are: 0-8min, 5%-50% methanol; 8-10min, 50%-100% methanol; 10-12min, 100%-5% methanol; 12-24min, 5% methanol. A standard curve is drawn with the above standard products, and the contents of scopoletin and ferulic acid are calculated according to the standard curve.

[0079] The HPLCMS-TOF detection procedure is as follows: The chromatographic column model is a fast high-resolution HD C18 column (1.8 μm particle size, 2.1 mm × 150 mm, Agilent, ZORBAX Eclipse Plus). According to the different structures of the intermediates and the target, this application mainly uses the anion mode to detect the fermentation products of the recombinant strain. The mobile phase A is deionized water, and the mobile phase B is HPLC-grade acetonitrile; the flow rate is 0.3 mL / min; the sample volume is 4 μL; the elution conditions are: 0 min, 2% B, 10 min, 15% B; 15 min, 100% B; 18 min, 100% B; 19 min, 2% B.

[0080] The experimental results showed that the fermentation products of the two recombinant strains had obvious single absorption peaks at retention times of 5.97min and 5.98min, respectively, which were highly consistent with the retention time of the scopoletin standard (6.03min), and the maximum value of the absorption peak and its peak shape characteristics were also consistent with those of the standard compound ( Figure 3 CD).

[0081] The results showed that in the SPT01 and SPT02 strains, ferulic acid could be successfully converted into scopoletin through the sequential catalysis of Os4CL and AtF6′H2 / IbF6′H2. Further determination of its yield found that the yield determination was set up for 3 repeated experiments (n=3), and the results were averaged. In the three different clones of the STP01 strain, the yield of scopoletin ranged from 1.10mg / L to 2.49mg / L, and the corresponding molar conversion rate was 1.90% to 4.32%; while in the three different clones of the STP02 strain, the yield of the target was lower, ranging from 0.19mg / L to 0.28mg / L, and the molar conversion rate was only 0.32% to 0.48% ( Figure 3 EF). In summary, the SPT01 strain constructed using AtF6′H2 from Arabidopsis thaliana has more advantages in the synthesis of scopoletin.

[0082] Example 2, Scopoletin synthesis module engineering strain using caffeic acid as substrate

[0083] S5. Using the plasmid containing the synthetic gene of AtF6′H2 as a template, the target fragment AtF6′H2 was amplified by PCR using the primer pair AtF6′H2-EcoRI-F (AATTGAATTCATGGCGCCGACCCTGCTGA SEQ ID NO.1) and AtF6′H2-AflII-R (TTAACTTAAGCTTAAATTTTCGCATAATCCACGGTTTTTTTGC SEQ ID NO.2). The amplification system and amplification conditions were the same as those in Example 1;

[0084] Using the plasmid containing the IbF6′H2 synthetic gene as a template, the target fragment IbF6′H2 was amplified by PCR using the primer pair IbF6′H2-EcoRI-F (AATTGAATTCATGATGCCGAGCACCACCCTGAGC SEQ ID NO.3) and IbF6′H2-AflII-R (TTAACTTAAGTTATTCAATGCGCGCAAACGCAATGG SEQ ID NO.4), and the amplification system and amplification conditions were the same as those in Example 1;

[0085] S6. The AtF6′H2 treated in step S5 was double-digested with EcoRI and AflII, and ligated to the corresponding position of the pGEX6p-1 plasmid treated with EcoRI and AflII to construct the intermediate vector pGEX 6p-1::AtF6′H2;

[0086] IbF6′H2 treated in step S5 was double-digested with EcoRI and AflII, and ligated to the corresponding position of pGEX 6p-1 plasmid treated with EcoRI and AflII to construct the intermediate vector pGEX 6p-1::IbF6′H2;

[0087] S7. PCR amplification was performed using primers RBS-Os4CL-AflII-F (AATTCTTAAGaaggagatataccaATGGGCAGCGTGGCGGCCSEQ ID NO.5) and Os4CL-XhoI-R (TTAATCGAGTTAGCTGCTTTTCGGCGCATCC SEQ ID NO.6) to amplify the target fragment Os4CL using the same amplification system and amplification conditions as in Example 1;

[0088] S8. The Os4CL treated in step S7 was double-digested with AflII and XhoI, and then connected to the corresponding position of the intermediate vector pGEX 6p-1::AtF6′H2 treated with AflII and XhoI to construct the pGEX 6p-1::AtF6′H2-RBS-Os4CL recombinant plasmid;

[0089] The Os4CL treated in step S7 was double-digested with AflII and XhoI, and then connected to the corresponding position of the intermediate vector pGEX6p-1::IbF6′H2 treated with AflII and XhoI to construct the pGEX 6p-1::IbF6′H2-RBS-Os4CL recombinant plasmid;

[0090] S9. Using the plasmid containing the AtCOMT synthetic gene as a template, PCR amplify RBS-AtCOMT using the primer pair AtCOMT-hm-XhoI-F (tgcgccgaaaagcagctaaCTCGAGaaggagatataccaATGGGCAGCACCGCGGAAA SEQ ID NO.7) and AtCOMT-hm-XhoI-R (gtcacgatgcggccgCTCGAGTTACAGTTTTTTCAGCAGTTCAATCAGGT SEQ ID NO.8) to obtain the target fragment RBS-AtCOMT;

[0091] PCR amplification reaction system (50.0 μL): 1.0 μL of GXL DNA Polymerase (1.25 U / μL), 10.0 μL of 5× PrimeSTAR GXL Buffer, 4.0 μL of dNTP Mixture (2.5 mmol / L), 2.0 μL each of AtCOMT-hm-XhoI-F and AtCOMT-hm-XhoI-R (10 μmol / L), 1.0 μL of plasmid template containing AtCOMT, and 30.0 μL of ddH2O.

[0092] PCR reaction conditions: 98°C pre-denaturation for 5 min; 98°C denaturation for 30 s, 60°C annealing for 30 s, 68°C extension for 1.2 min, a total of 30 cycles; 68°C final extension for 5 min;

[0093] S10. The RBS-AtCOMT treated in step S9 was connected to the corresponding position of the pGEX 6p-1::AtF6′H2-RBS-Os4CL plasmid linearized by XhoI to obtain the recombinant plasmid pGEX 6p-1::AtF6′H2-RBS-Os4CL-RBS-AtCOMT;

[0094] The RBS-AtCOMT treated in step S9 was connected to the corresponding position of the pGEX 6p-1::IbF6′H2-RBS-Os4CL plasmid linearized by XhoI to obtain the recombinant plasmid pGEX6p-1::IbF6′H2-RBS-Os4CL-RBS-AtCOMT;

[0095] The recombinant plasmid pGEX 6p-1::AtF6′H2-RBS-Os4CL-RBS-AtCOMT and the recombinant plasmid pGEX 6p-1::IbF6′H2-RBS-Os4CL-RBS-AtCOMT were verified by two sets of enzymes (pstI and BamHI / NcoI) ( Figure 4 The two recombinant plasmids were transformed into Escherichia coli BL21 Star (DE3) and the obtained strains were named SPT03 and SPT04. Then, caffeic acid was used as substrate and the amount of caffeic acid added was 140 mg / L. The two groups of strains were fermented in liquid, and the fermentation products were collected after 48 hours and analyzed by HPLC together with caffeic acid and scopoletin standards.

[0096] The fermentation method of the two groups of strains was the same as that of Example 1, caffeic acid was used as the substrate, and the HPLC analysis method was the same as that of Example 1.

[0097] The results showed that the fermentation products of the two recombinant strains showed obvious absorption peaks at retention times of 21.23min and 21.28, respectively, which were highly consistent with the retention time of the scopoletin standard (21.48min), and the maximum absorption peak value and peak shape characteristics were also consistent with the scopoletin standard ( Figure 5 CD).

[0098] The results showed that in the SPT03 and SPT04 strains, caffeic acid was catalyzed by AtCOMT, Os4CL and AtF6′H2 / IbF6′H2 enzymes to produce scopoletin. Further yield determination revealed that the yield determination was repeated three times (n=3), and the results were averaged. The scopoletin yield of the SPT03 strain ranged from 0.36mg / L to 0.58mg / L, and the corresponding molar conversion rate was 0.25% to 0.41%; while the scopoletin yield of the SPT04 strain was low, ranging from 0.14mg / L to 0.21mg / L, and the molar conversion rate was between 0.10% and 0.15% ( Figure 5 EF).

[0099] The above results not only confirmed the feasibility of microbial synthesis of scopoletin using caffeic acid as substrate, but also showed that the AtF6′H2 enzyme from Arabidopsis thaliana was superior to IbF6′H2 in catalytic efficiency.

[0100] Example 3 Construction of a single strain for de novo synthesis of scopoletin

[0101] A single colony of the caffeic acid high-producing strain BL21 Star(DE3)-pACYC::glnSm-FjTAL-J23101*-EchpaBC(CA11) was selected and inoculated into an appropriate amount of LB liquid medium, and cultured overnight at 37°C with shaking. Then, the overnight culture was inoculated into fresh LB liquid medium at a ratio of 1:100 and cultured until OD 600 About 0.5. Collect the bacterial solution in a pre-cooled centrifuge tube, let it stand on ice for 10-15 minutes, then centrifuge it at 4℃ at 5000rpm for 5-10 minutes, discard the supernatant, add pre-cooled 0.1M CaCl2 solution, gently blow to resuspend the bacterial precipitate, place it on ice for 5 minutes and then centrifuge it, repeat the washing step 1-2 times. Finally, add pre-cooled 0.1M CaCl2 solution to resuspend the bacterial precipitate to prepare the competent cells of the high-yield caffeic acid strain.

[0102] The scopoletin recombinant plasmid pGEX 6p-1::AtF6H′2-RBS-Os4CL-RBS-AtCOMT was transferred into the competent cells of the above-mentioned caffeic acid high-producing strain, placed on ice for 30 minutes, heat-shocked in a 42°C water bath for 45 seconds, and immediately placed on ice for 2 minutes; 600ul LB culture medium was added to the cooled Escherichia coli in an ultra-clean workbench, and cultured in a 37°C shaker for 60 minutes. After the recovery, centrifuge at 8000rpm for 1min, remove part of the supernatant, gently suspend the remaining precipitate, spread it on an LB plate containing chloramphenicol (Cm), kanamycin (Kana) and ampicillin (Amp), and culture it in a constant temperature incubator at 37°C for 12h to obtain the corresponding scopoletin de novo synthesis recombinant strain BL21 Star(DE3)-pACYC::glnSm-FjTAL-J23101*-EchpaBC / pGEX 6p-1::AtF6H′2-RBS-Os4CL-RBS-AtCOMT, which was named SPT05.

[0103] Since the enzyme catalytic activity in the caffeic acid synthesis module is easily inhibited by organic nitrogen sources (such as yeast extract), M9 liquid medium was still used as the fermentation medium, and shake flask fermentation was carried out with 20 g / L glucose as the sole carbon source. The fermentation products were collected after 48 hours and analyzed by HPLC together with caffeic acid and scopoletin standards.

[0104] The fermentation method of the strain was the same as that of Example 1, glucose was used as the substrate, and the HPLC analysis method was the same as that of Example 1.

[0105] The HPLC test results showed that the yield determination was repeated three times (n=3), and the results were averaged. Scopoletin was produced in the fermentation broth of the recombinant strain, but the yield was low, only 0.14 mg / L. At the same time, the test results showed that a large amount of caffeic acid and p-coumaric acid accumulated ( Figure 6 ).

[0106] Example 4 De novo synthesis of scopoletin based on dual bacterial strain co-culture

[0107] The caffeic acid high-producing bacteria CA11 or CA13 were selected as the upstream synthetic engineering strains, and the scopoletin-producing bacteria SPT03 was selected as the downstream synthetic engineering strains. The two were co-inoculated in M9 liquid culture medium at a ratio of 1:1. In view of the fact that CA11 and CA13 are resistant to Cm and Kana, and SPT03 is resistant to Cm and Amp, in order to establish a co-culture system of two strains with different resistances, the common resistance Cm resistance was selected as the antibiotic screening marker, and 20g / L glucose was added as the only carbon source for co-culture fermentation of the two strains. Finally, the obtained fermentation liquid was treated and subjected to HPLC qualitative and quantitative analysis. The details are as follows:

[0108] S1. Inoculate a single colony of the caffeic acid high-producing recombinant strain CA11 or CA13 into LB liquid medium and culture overnight until the optical density of the bacterial solution reaches OD 600 Reach 1.0;

[0109] S2. Inoculate the bacterial solution into new LB liquid medium at a ratio of 1:100. After continuing to culture for 4 hours, collect the bacteria by centrifugation at 5000 rpm for 5 minutes, and resuspend the bacterial pellet in M9 liquid medium to make the OD of the resuspended bacteria 600 Reach 1.0;

[0110] S3. Pick a single colony of the scopoletin synthesis recombinant strain and inoculate it into LB liquid medium, and culture it overnight until the bacterial liquid OD 600 to 1.0;

[0111] S4. Inoculate into LB liquid medium at a ratio of 1:100 and continue to culture for 4 hours. Collect the cells by centrifugation at 5000 rpm for 5 minutes, and resuspend the cell pellet in M9 liquid medium to adjust the OD of the resuspended cells to 0. 600 Reach 1.0;

[0112] The caffeic acid high-yielding recombinant strain solution of S2 and the scopoletin synthesis recombinant strain solution of S4 were inoculated into a 100 mL conical flask containing 30 mL of M9 liquid culture medium at a ratio of 1:1, and the OD of the bacterial solution was adjusted to 0. 600 The final concentration value was 0.1, and a final concentration of 0.2 mmol / L IPTG inducer and 20 g / L glucose were added, and the culture was fermented at 37°C and 220 rpm for 48 h.

[0113] After 48 hours, the fermentation products were collected and analyzed by HPLC together with caffeic acid and scopoletin standards. The HPLC analysis method was the same as in Example 1.

[0114] The experimental results show that ( Figure 7 ): Scopoletin (STP) was successfully detected in both CA11-SPT03 and CA13-SPT03 co-culture systems, accompanied by varying degrees of accumulation of intermediates p-coumaric acid (PA) and caffeic acid (CA). Further quantitative analysis revealed that ( Figure 8 ): Compared with a single strain co-expressing a dual-module recombinant plasmid, the dual-strain co-culture system significantly improved the synthesis level of scopoletin, with the yield of the CA11-SPT03 combination being 0.82 mg / L and the CA13-SPT03 combination reaching 0.86 mg / L, which are much higher than the yield of scopoletin synthesized directly using caffeic acid as a substrate.

[0115] The above experimental results show that through the co-cultivation of dual strains of upstream and downstream synthesis modules, the burden of metabolic flow can be effectively shared, the biosynthetic performance of each module can be optimized respectively, the rational allocation of metabolic resources can be promoted, and the synthesis level of scopoletin can be greatly improved.

[0116] Therefore, by selecting the expression vector pGEX 6p-1 carrying the lytic protein GST, selecting AtF6′H2 or IbF6′H2 with higher catalytic activity, fusing Os4CL and AtCOMT genes for co-expression, the scopoletin synthesis pathway was reconstructed and successfully expressed in BL21Star (DE3). Using caffeic acid as a substrate for microbial fermentation, the engineered strain containing AtF6′H2 synthesized scopoletin with a higher yield, ranging from 0.36 mg / L to 0.58 mg / L, and a molar conversion rate of 0.25% to 0.41%. Both single strain culture and double strain co-culture based on the caffeic acid synthesis module and the scopoletin synthesis module can achieve de novo synthesis in BL21Star (DE3). Compared with the yield of a single strain system (0.14 mg / L), the de novo synthesis yield of scopoletin obtained by co-culture of Escherichia coli and Escherichia coli was significantly increased, with the highest content being 0.86 mg / L.

[0117] The above is a detailed introduction to the bacterial strain co-cultivation system and its application for scopoletin synthesis provided by the present invention. The description of the specific embodiment is only used to help understand the method of the present invention and its core idea. It should be pointed out that for ordinary technicians in this technical field, without departing from the principle of the present invention, the present invention can also be improved and modified, and these improvements and modifications also fall within the scope of protection of the claims of the present invention.

[0118] It should be noted that if no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be purchased commercially.

[0119] The above examples are intended to provide a better understanding of the present invention, and are not intended to be limiting of the best implementation mode described herein, nor are they intended to limit the content and protection scope of the present invention. Any product identical or similar to the present invention that is derived by anyone under the inspiration of the present invention or by combining the present invention with features of other prior arts shall fall within the protection scope of the present invention.

Claims

1. A bacterial strain co-cultivation system for scopoletin synthesis, characterized in that: The system comprises a caffeic acid high-yield recombinant strain and a scopoletin-synthesizing recombinant strain. The caffeic acid high-yield recombinant strain and the scopoletin-synthesizing recombinant strain are cultured separately and then mixed and co-cultured.

2. The bacterial strain co-cultivation system according to claim 1, characterized in that: The addition ratio of the caffeic acid high-yield recombinant strain and the scopoletin synthesis recombinant strain is 1:1-10.

3. The bacterial strain co-cultivation system according to claim 1, characterized in that: The culture conditions of the co-culture system are: fermentation at 28-37° C. and 200-300 rpm for 36-72 hours, adding IPTG inducer during fermentation, and adding glucose as the initial raw material.

4. The bacterial strain co-cultivation system according to claim 1, characterized in that: The caffeic acid high-yield recombinant strain comprises the following steps during fermentation culture: S1. Inoculate a single colony of the caffeic acid high-yielding recombinant strain into LB liquid medium and culture overnight until the optical density of the bacterial solution reaches OD 600 Reach 1.0; S2. Inoculate the bacterial solution into new LB liquid medium at a ratio of 1:

100. After continuing to culture for 3-5 hours, collect the bacteria by centrifugation and resuspend the bacterial pellet in M9 liquid medium to a value of OD 0. 600 Reached 1.

0.

5. The bacterial strain co-cultivation system according to claim 4, characterized in that: The caffeic acid high-yield recombinant strain is: BL21 Star (DE3)-pACYC::glnSm-FjTAL-J23101*-EchpaBC or / and BL21Star (DE3)-pACYC::glnSm-FjTAL-J23101*-EchpaBC-J23101*-EchpaBC.

6. The bacterial strain co-cultivation system according to claim 4 or 5, characterized in that: The scopoletin synthetic recombinant strain comprises the following steps during fermentation culture: S3. Pick a single colony of the scopoletin synthesis recombinant strain and inoculate it into LB liquid medium, and culture it overnight until the bacterial liquid OD 600 to 1.0; S4. Inoculate into LB liquid medium at a ratio of 1:100 and continue to culture for 3-5 hours. Collect the cells by centrifugation and resuspend the cell pellet in M9 liquid medium to a value of OD 600 Reached 1.

0.

7. The bacterial strain co-cultivation system according to claim 6, characterized in that: The co-culture and fermentation of the scopoletin synthesis strain comprises the following steps: The caffeic acid high-yielding recombinant strain culture solution of S2 and the scopoletin synthesis recombinant strain culture solution of S4 were inoculated into M9 liquid medium in proportion, and the culture solution OD 600 The final concentration value is 0.1; then IPTG inducer and glucose are added, and fermentation is carried out at 28-37°C and 200-300rpm for 36-72h.

8. The bacterial strain co-cultivation system according to claim 1, characterized in that: The scopoletin synthetic recombinant strain comprises the following steps during synthesis: S5. Using the plasmid containing the synthetic gene of AtF6′H2 as a template, the target fragment AtF6′H2 was amplified using the primer pair AtF6′H2-EcoRI-F and AtF6′H2-AflII-R; S6. The AtF6′H2 treated in step S5 was double-digested with EcoRI and AflII, and ligated to the corresponding position of the pGEX 6p-1 plasmid treated with EcoRI and AflII to construct the intermediate vector pGEX 6p-1::AtF6′H2; S7. Use RBS-Os4CL-AflII-F and Os4CL-XhoI-R primers to perform PCR amplification on the plasmid containing the Os4CL synthetic gene as a template to amplify the target fragment Os4CL; S8. The Os4CL treated in step S7 was double-digested with AflII and XhoI, and then connected to the corresponding position of the intermediate vector pGEX6p-1::AtF6′H2 treated with XhoI and AflII to construct pGEX 6p-1::AtF6′H2-RBS-Os4CL; S9. Using the plasmid containing the AtCOMT synthetic gene as a template, PCR amplify RBS-AtCOMT using the AtCOMT-hm-XhoI-F / R primer pair to obtain the target fragment RBS-AtCOMT; S10. The RBS-AtCOMT treated in step S9 was connected to the corresponding position of the pGEX 6p-1::AtF6′H2-RBS-Os4CL plasmid linearized by XhoI to obtain the recombinant plasmid pGEX 6p-1::AtF6′H2-RBS-Os4CL-RBS-AtCOMT; S11. Transform the recombinant plasmid pGEX 6p-1::AtF6′H2-RBS-Os4CL-RBS-AtCOMT into competent cells to obtain a scopoletin-synthesizing recombinant strain.

9. The bacterial strain co-cultivation system according to claim 8, characterized in that: In the step S11, the competent cells are Escherichia coli.

10. An application of the bacterial strain co-cultivation system for scopoletin synthesis according to any one of claims 1 to 9, characterized in that: Used in the synthesis and production of scopoletin.

Images