A Corynebacterium glutamicum engineered bacterium for producing spermidine and its application

Abstract

The invention discloses an engineered Corynebacterium glutamicum strain for producing spermidine and its application, belonging to the field of synthetic biology. The invention adopts a metabolic engineering transformation method to remove various product inhibitions of the spermidine synthesis pathway, change the spermidine transport system, strengthen the enzyme expression amount of the key pathway, and introduce a new exogenous pathway, thereby obtaining an engineered Corynebacterium glutamicum strain with high spermidine production, and the spermidine concentration in the shake flask supernatant reaches 28.8 g / L, which has good industrial application prospects.

Description

Technical Field

[0001] The invention relates to an engineering bacterium of Corynebacterium glutamicum for producing spermidine and application thereof, belonging to the technical field of bioengineering. Background Art

[0002] Spermidine is a polyamine compound with a linear molecular formula of NH2(CH2)3NH(CH2)4NH2. It plays an important role in organisms. Spermidine is widely present in microorganisms, plants and animals and is an important physiologically active substance. Spermidine can be ingested through diet, mainly from protein and amino acid metabolism in food. Some foods rich in spermidine include soybeans, fermented foods (such as cheese and yogurt), fish, nuts and beans. In recent years, spermidine has become a hot topic in the field of biomedical research. Researchers are exploring its potential applications in anti-aging, nervous system protection, cancer treatment and cardiovascular health.

[0003] The main problem of microbial production of spermidine is the low yield, which is reflected in the following aspects: (1) Substrate limitation: The biosynthesis of spermidine requires substrates such as spermine and propanediamine as starting materials. In many microorganisms, the concentration of these substrates may be relatively low, limiting the production of spermidine; (2) Enzyme catalytic efficiency: The spermidine biosynthesis pathway involves multiple enzyme catalytic steps, each of which may affect the yield. The catalytic efficiency of the enzyme and the affinity of the substrate have an important influence on the yield; (3) Metabolic burden: The introduction of the spermidine biosynthesis pathway into engineered microorganisms may impose a burden on the metabolism of the microorganism, reducing the growth rate and biovolume, thereby limiting the production of spermidine; (4) Byproduct generation: The spermidine biosynthesis pathway may lead to the generation of some byproducts, the accumulation of which will reduce the yield of spermidine. Although various strategies have been adopted to increase the yield, further improvements are still needed to achieve industrial-scale production.

[0004] Corynebacterium glutamicum is a commonly used genetically engineered strain with unique advantages in the production of spermidine. (1) Metabolic pathway applicability: The metabolic pathway and physiological characteristics of Corynebacterium glutamicum make it suitable for the synthesis of spermidine. The strain has a high level of intracellular propanediamine, which is one of the important substrates for the biosynthesis of spermidine. In addition, Corynebacterium glutamicum also has a high ability to synthesize methionine, which can be used to synthesize the precursor of spermidine; (2) Controllable fermentation process: The fermentation process of Corynebacterium glutamicum is relatively easy to control, and production conditions can be optimized by adjusting parameters such as temperature, pH, oxygen concentration and nutrient supply to obtain the best yield and quality; (3) Biosafety: Corynebacterium glutamicum is generally considered to be a relatively safe microorganism that is harmless to human health. This makes it easier to obtain regulatory approval for its use in the production of spermidine or other compounds.

[0005] But there is only one approach for Corynebacterium glutamicum to produce spermidine: directly synthesize spermidine via carboxylated adenosylmethionine and putrescine under the action of spermidine synthetase, and this approach is the approach of more common spermidine synthesis, and the enzyme in the approach is highly regulated, and spermidine yield is low. Prior art (CN113736719B) transforms Corynebacterium glutamicum to produce spermidine from traditional approach, by introducing arginine decarboxylase encoded by exogenous gene peA, agmatine deiminase encoded by speB, spermidine synthetase encoded by speE and ornithine decarboxylase encoded by speC, introduces speD gene encoding S-adenosylmethionine decarboxylase, improves the synthesis of carboxylated S-adenosylmethionine, thereby improves the yield of spermidine. The method has long metabolic pathways, easy shunting metabolism of intermediate products, poor product specificity and the problem of large product inhibition. Therefore, how to transform Corynebacterium glutamicum by genetic engineering technology to obtain efficient production of spermidine is a problem to be solved at present. Summary of the invention

[0006] The present invention relates to a genetically engineered bacterium, which uses Corynebacterium glutamicum as a host and introduces a new approach to synthesizing spermidine. The genetically engineered bacterium expresses exogenous arginine decarboxylase gene, carboxylaminopropyl agmatine dehydrogenase gene, carboxylaminopropyl agmatine decarboxylase gene and aminopropyl agmatine ureahydrolase gene in its genome. These changes enable Corynebacterium glutamicum to show unique ability in synthesizing spermidine.

[0007] The first object of the present invention is to provide a genetically engineered bacterium of Corynebacterium glutamicum, wherein the engineered bacterium is introduced with an exogenous spermidine synthesis pathway, including genes of arginine decarboxylase, carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine ureahydrolase.

[0008] In one embodiment, the arginine decarboxylase may be from any source; alternatively, the arginine decarboxylase may be from Escherichia coli, etc. Further alternatively, the arginine decarboxylase is from Escherichia coli BL21.

[0009] In one embodiment, the carboxyaminopropyl agmatine dehydrogenase can be a carboxyaminopropyl agmatine dehydrogenase from any source; alternatively, it can be a carboxyaminopropyl agmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrio acetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, etc. Further alternatively, it is from Spirochaeta thermophila DSM 6578 or Denitrovibrio acetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobacter coccineus YM16-304.

[0010] In one embodiment, the carboxyaminopropyl agmatine decarboxylase may be a carboxyaminopropyl agmatine dehydrogenase from any source; alternatively, it may be a carboxyaminopropyl agmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrio acetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, etc. Further alternatively, it may be from Spirochaeta thermophila DSM 6578 or Denitrovibrio acetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobacter coccineus YM16-304.

[0011] In one embodiment, the aminopropylagmatine urea hydrolase can be a carboxyaminopropylagmatine dehydrogenase from any source; alternatively, it can be a carboxyaminopropylagmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrioacetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, etc. Further alternatively, it can be from Spirochaeta thermophila DSM 6578 or Denitrovibrio acetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobacter coccineus YM16-304.

[0012] In one embodiment, the engineered bacteria of Corynebacterium glutamicum also has a gene encoding the repressor protein argR knocked out.

[0013] In one embodiment, the engineered bacteria of Corynebacterium glutamicum also uses a strong promoter to replace the natural promoters of lysC, asd, argC, argJ, argB, and argD to enhance the expression of the intermediate enzyme. Optionally, the sequence of the strong promoter is shown in SEQ ID NO.69.

[0014] In one embodiment, the engineering bacteria of Corynebacterium glutamicum also integrates the translocator MdtJI encoding gene into the Corynebacterium glutamicum genome to improve the ability of spermidine to be transported to the extracellular space. Optionally, the translocator MdtJI encoding gene is from Escherichia coli. Further optionally, it is from Escherichia coli BL21.

[0015] In one embodiment, the competing pathways of the spermidine process are weakened, including: the lysine pathway; the glutamate intermediate competing pathway, and the Pro synthesis pathway.

[0016] In one embodiment, homologous recombination is used to integrate and express genes in the genetically engineered bacteria.

[0017] In one embodiment, the gene is knocked out using homologous recombination technology.

[0018] In one embodiment, the gene is knocked out using Crispr / Cas9 gene editing technology.

[0019] The second object of the present invention is to provide an application of a genetically engineered bacterium of Corynebacterium glutamicum in producing spermidine.

[0020] The third object of the present invention is to provide a method for constructing a genetically engineered bacterium of Corynebacterium glutamicum, the method comprising:

[0021] (1) integrating exogenous arginine decarboxylase, exogenous carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine urea hydrolase genes into a plasmid, and integrating the plasmid into Corynebacterium glutamicum;

[0022] (2) constructing a gene knockout plasmid to knock out the argR gene;

[0023] (3) Use the strong promoter trc to replace the natural promoters of argC, argJ, argB, argD, and lysC;

[0024] (4) integrating the trc and transporter protein MdtJI genes into Corynebacterium glutamicum;

[0025] (5) Knock out the lysA gene and point mutate the start codons of the dapA and proB genes.

[0026] Beneficial Effects

[0027] The present invention constructs a Corynebacterium glutamicum that produces spermidine in high yield using glucose as raw material based on synthetic biology methods. The production process is simple, the raw materials are easily available and the cost is low, and it has good prospects for industrial application. The details are as follows:

[0028] (1) The present invention introduces exogenous pathways, and by inserting exogenous genes, including genes of arginine decarboxylase, carboxylaminopropyl agmatine dehydrogenase, carboxylaminopropyl agmatine decarboxylase and aminopropyl agmatine urea hydrolase, Corynebacterium glutamicum can synthesize spermidine by a new approach. Corynebacterium glutamicum hardly produces spermidine when not genetically engineered, and under traditional spermidine synthetic pathway, production efficiency is lower. Relative to traditional production pathways, the Corynebacterium glutamicum genetically engineered bacteria of the present invention can significantly improve the output of spermidine, and only by introducing exogenous pathways, spermidine concentration reaches 8.4g / L.

[0029] (2) The present invention relieves the feedback inhibition and repression of ArgR, and after the relief, the spermidine production of the engineered bacteria of Corynebacterium glutamicum reaches 10.6 g / L.

[0030] (3) The present invention enhances the expression of six enzymes, lysC, asd, argC, argJ, argB and argD, and the yield of spermidine reaches 15.3 g / L.

[0031] (4) The exogenous introduction of the MdtJI gene in the present invention enhances the transport of spermidine and increases the yield of spermidine to 20.3 g / L.

[0032] (5) The present invention weakens the competitive pathways of the spermidine process. In the spermidine synthesis process, the aspartaldehyde intermediate has multiple competitive pathways for the production of amino acids, such as the lysine pathway; there are also competitive pathways for the glutamate intermediate, such as the synthesis of Pro. These pathways are weakened. After weakening the promoters of the lysA, dapA, and proB genes, the spermidine production reaches 28.8 g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The method for synthesizing spermidine by Corynebacterium glutamicum in the present invention is DETAILED DESCRIPTION

[0034] 1. Strains and plasmids involved in the present invention

[0035] pEC-XK99E shuttle plasmid, T19 plasmid, pK18mobsacB shuttle plasmid purchased from Novagen, and Corynebacterium glutamicum ATCC 13032 preserved in our laboratory.

[0036] 2. Fermentation conditions

[0037] (1) Corynebacterium glutamicum seed culture medium LBG (g / L)

[0038] 10g NaCl, 10g peptone, 5g yeast extract, 5g glucose.

[0039] (2) Corynebacterium glutamicum competent cell growth medium LBGT (g / L)

[0040] 5g yeast extract, 10g peptone, 10g NaCl, 30g glycine, 0.1% Tween 80.

[0041] (3) Corynebacterium glutamicum fermentation medium (g / L)

[0042] 100g glucose, 20g corn syrup, 50g (NH4)2SO4, 2.5g MgSO4·7H2O, 1g KH2PO4, 0.5g K2HPO4, 0.5g Na2HPO4, 20mg FeSO4·7H2O, 20mg MnSO4·4H2O, 2g molasses, 1mL Tween 80 and 10g CaCO3. The volume of the medium should not exceed 2 / 3 of the shake flask. If necessary, add 30mg / L carnamycin. The pH of the shake flask fermentation is 7, the temperature is controlled at 30℃, and the fermentation speed is 250r / min.

[0043] (4) CGXⅡ medium: 20 g (NH4)2SO4, 5 g urea, 1 g KH2PO4, 1 g K2HPO4, 0.25 g MgSO4·7H2O, 42 g 3-morpholinopropanesulfonic acid, 10 mg CaCl2, 10 mg FeSO4·7H2O, 10 mg MnSO4·H2O, 1 mg ZnSO4·7H2O, 0.2 mg CuSO4, 0.02 mg NiCl2·6H2O, 0.2 mg biotin (pH 7), 40 g glucose, 0.03 mg protocatechuic acid, and carbachol (50 μg / ml) when necessary.

[0044] 3. Induced expression of recombinant bacteria

[0045] Recombinant Corynebacterium glutamicum was inoculated from agar plates to 50 mL LB seed culture and grown overnight. Cells were collected by centrifugation (4000 rpm, 10 min) and washed once with CGXⅡ minimal medium lacking a carbon source, then inoculated into CGXⅡ minimal medium containing 20 g / L glucose, 25 μg / mL card sodium resistance, (100 μg / mL ampicillin resistance,) in 50 mL, cultured to OD600 to 0.5, and inducing agent IPTG was added to 1 mM. After induction at 20°C for 24 h, supernatant was collected by centrifugation at 4°C, 8000 rpm, and 20 minutes.

[0046] 4. Determination of spermidine content

[0047] Preparation of OPA derivatization reagent: OPA reagent was prepared by Uren method and Karababa (15). 0.20 g of OPA was dissolved in 9.0 mL of methanol, and 1.0 mL of 0.40 M (pH 9.0) borate buffer and 160 μL of 2-mercaptoethanol (reducing agent) were added. OPA reagent was stored at 4°C.

[0048] Spermidine was first derivatized with o-phthalaldehyde (OPA; Sigma, St. Louis, MO). 50 μL of sample and 450 μL of water were added to 400 μL of methanol. After adding 100 μL of OPA reagent, the mixture was filtered through a 0.2-μm filter membrane and 20.0 μL of the filtrate was immediately injected into the HPLC instrument.

[0049] HPLC detection conditions: Spermidine was detected by the method in reference (Qian, ZG, XXXia, and SYLee, Metabolic engineering of Escherichia coli for the production of putrescine: a fourcarbon diamine. Biotechnol Bioeng, 2009. 104 (4): p. 651-662): Luna 5-μm C18 (2) 100A column (250 × 4.6 mm; Phenomenex) operated at 25 ° C and 0.8 mL / min mobile phase was used for all sample separations. The mobile phase consisted of solvent A (55% methanol in 0.1 M sodium acetate, pH 7.2) and solvent B (methanol). The following gradient was applied: 1-6 min, 100% A; 6-10 min, linear gradient of B from 0% to 30%; 10-15 min, linear gradient of B from 30% to 50%; 15-19 min, linear gradient of B from 50% to 100%; 19-23 min, 100% B; 23-25 ​​min, linear gradient of B from 100% to 30%; 25-28 min, linear gradient of B from 30% to 0% (all in vol %).

[0050] 5. Preparation of Competent Cells

[0051] (1) Select a strain of Corynebacterium glutamicum and streak it onto an LBG plate medium, and culture it in a 30°C incubator for 30 to 48 hours;

[0052] (2) Pick a single colony from the plate and inoculate it into the seed medium for 12 to 24 hours. Inoculate it into LBGT medium at a 2% inoculation rate and incubate it in a 30°C incubator for a certain period of time. When the OD600 reaches about 0.9, take the bacterial solution and put it into a centrifuge tube and place it on ice for 15 minutes.

[0053] (3) After the ice bath, collect the cells by centrifugation at 4500 rpm for 10 min at 4°C, and wash the cells four times with 20 mL of pre-cooled 10% glycerol, centrifuging at 4500 rpm for 5 min each time to collect the cells. After washing, resuspend the cells with 500 μL of 10% sterile glycerol and dispense 100 μL into a 1.5 mL centrifuge tube for direct electroporation or storage at -80°C for later use.

[0054] 6. Transformation of Corynebacterium glutamicum Competent Cells

[0055] (1) Add 2-4 μL of plasmid to each tube of competent cells, mix well, and incubate on ice for 10 min.

[0056] (2) Transfer the transformation solution into a pre-cooled electroporation cup and electroporate at 2.5 kV for 4 seconds. Immediately after the electroporation, add it to LBGT growth medium, mix gently, aspirate it, place it in a 1.5 mL centrifuge tube, incubate it in a 46 °C water bath for 5 minutes, and then culture it in a 30 °C shaker for 1.5 hours.

[0057] (3) Centrifuge at 5000 rpm / min for 1 min, discard the supernatant, and keep about 100-150 μL of the bacterial solution. Mix well and spread on a LBGT solid plate containing 40 μg / mL carnamycin, and culture at 30°C for 36-48 h.

[0058] 7. Enzyme digestion, ligation, purification, DNA extraction and other operations

[0059] (1) Enzyme digestion reaction system: 10×Q Cut Buffer 5 μL, DNA 20 μL, ddH2O 33 μL, endonuclease-1 1 μL, endonuclease-2 1 μL, mix well, and heat in a 37°C water bath for 0.5 to 1 h.

[0060] (2) Ligation reaction system: 5 μL of Lightning Cloning Enzyme, 1-2 μL of double-enzyme-cut plasmid (10-100 ng), 4-5 μL of homologous target fragment, add ddH2O to 10 μL, mix well, and heat in a 50°C water bath for 30 min.

[0061] (3) PCR amplification of target gene reaction system (50 μL): DNA template 1 μL, 5× PrimeSTAR Buffer 10 μL, dNTP Mixture 4 μL, amplification primer 1 μL, amplification primer 1 μL, PrimeSTAR HSDNA Polymerase 0.5 μL, ddH2O 32.5 μL. PCR amplification program: 30 cycles (98°C 10 s, 55°C 10 s, 72°C 1 kb / min), 72°C 10 min, 4°C storage.

[0062] (4) Colony PCR reaction system: 2×Fastag PCR SuperMix 25μL, upstream primer (concentration 10μM) 1μL, downstream primer (concentration 10μM) 1μL, ddH2O to 50μL, a small amount of colonies or bacterial liquid as template. PCR amplification program: 30 cycles (98℃10s, 55℃10s, 72℃4kb / min), 72℃10min, 4℃ storage.

[0063] 8. Steps for constructing mutants using the Fast Mutagenesis System kit

[0064] (1) Design mutation primers TB-F and TB-R;

[0065] (2) Mutation amplification PCR system

[0066] TB-F 1 μL, TB-R 1 μL, plasmid 1-10 ng, 2× FastPfu Fly PCR SuperMix 25μL, add ddH2O to 50μL.

[0067] 94°C for 2-5 min, 20-25 cycles (94°C, 20 s; 55°C, 20 s; 72°C, 2-6 kb / min), 72°C, 10 min.

[0068] (3) detecting the target product by electrophoresis;

[0069] (4) Digestion of PCR products;

[0070] Add 1mL DMT enzyme to the PCR product, mix well, and incubate at 37°C for 1h;

[0071] (5) Transformation of competent cells

[0072] ① Add 2-5 μL DMT enzyme digestion product to 50 μL competent cells, flick to mix, and place on ice for 29-30 minutes;

[0073] ② Heat shock in 42℃ water bath for 45s, then immediately place on ice for 2min;

[0074] ③ Add 250 μL of LB medium equilibrated to room temperature, culture at 200 rpm / min and 37°C for 1 h;

[0075] ④ Take 100-200 μL of bacterial solution and spread it evenly on the plate containing resistance, and culture it in a 37°C incubator overnight.

[0076] Example 1: Exogenous expression of spermidine synthesis pathway in Corynebacterium glutamicum

[0077] In Corynebacterium glutamicum, in addition to the synthesis of some essential amino acids, it also has genes related to the synthesis of some polyamines, and can synthesize putrescine and other polyamines. However, the polyamine metabolism of this bacterium has not been carefully studied. For this reason, this embodiment uses Corynebacterium glutamicum ATCC 13032 as a wild bacterium, and on the basis of its production of glutamate, ornithine, arginine, methionine and other amino acids, exogenously integrates genes related to the synthesis of spermidine to construct a polyamine synthesis strain.

[0078] The present invention introduces ADC / CAPADH / CAPADC / APAUH pathways from different microbial strains into Corynebacterium glutamicum ATCC 13032 for heterologous expression. The arginine decarboxylase encoded by ADC decarboxylates arginine to generate agmatine, the carboxyaminopropyl agmatine dehydrogenase encoded by CAPADH directly uses aspartate semialdehyde and agmatine as precursors to synthesize carboxyaminopropyl agmatine, and then decarboxylates to synthesize aminopropyl agmatine under the action of the carboxyaminopropyl agmatine decarboxylase encoded by CAPADC, and finally generates spermidine under the action of the aminopropyl agmatine urea hydrolase encoded by APAUH. Arginine decarboxylase, carboxyaminopropyl agmatine dehydrogenase, carboxyaminopropyl agmatine decarboxylase and aminopropyl agmatine urea hydrolase from multiple different sources are expressed in Corynebacterium glutamicum by plasmids, the enzyme with the highest catalytic efficiency is screened, and then the ADC / CAPADH / CAPADC / APAUH pathway is exogenously integrated. The genome integration position selected by the present invention is upstream of the argB gene of Corynebacterium glutamicum ATCC 13032.

[0079] The specific process is as follows:

[0080] The arginine decarboxylase gene speA was cloned from the genome of Escherichia coli BL21 using amplification primers, and its amino acid sequence is numbered QJZ05082.1 on NCBI; carboxyaminopropylagmatine dehydrogenase genes stcapadh, dacapadh, gscapadh, and iccapadh were cloned from the genomes of Spirochaeta thermophila DSM 6578, Denitrovibrio acetiphilus DSM 12809, Geobacter sulfurreducens KN400, and Ilumatobacter coccineus YM16-304, and their amino acid sequences are accession NOs WP_014623968.1, WP_013011851.1, WP_010943175.1, and WP_015442124.1 on NCBI, respectively; acetiphilus DSM 12809, Geobactersulfurreducens KN400, and Ilumatobacter coccineus YM16-304 genomes were cloned, and the amino acid sequence numbers in NCBI were WP_014623969.1, WP_013011852.1, WP_004513933.1, and WP_015442123.1, respectively; The aminopropylagmatine urea hydrolase genes stapauh, daapauh, lbapauh, and icapauh were cloned from the genome of YM16-304, and the amino acid sequences were numbered WP_014623970.1, WP_013011853.1, WP_015770028.1, and WP_015442122.1 in NCBI, respectively. First, four target genes of arginine decarboxylase, carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase, and aminopropylagmatine urea hydrolase from different strains were connected to the multiple cloning site of the shuttle plasmid pEC-XK99E by homologous recombination to obtain enhanced expression of Corynebacterium glutamicum.

[0081] CAPADH and CAPADC in the above-mentioned microorganisms are located in adjacent positions of a gene cluster. Using stcapadh-EcoRⅠ-F and stcapadc-SacⅠ-R as primers and the Spirochaeta thermophila DSM 6578 genome as a template, the target fragment stcapadh-stcapadc was amplified; the multiple cloning site of the plasmid pEC-XK99E was treated with double enzymes EcoRⅠ and SacⅠ, and after purification of the enzyme digestion product, the cut plasmid was connected with the amplified target fragment stcapadh-stcapadc, and the connection product pEC-XK99E-stcapadh-stcapadc was transferred into JM109 competent cells, and positive clones were selected on the resistance plate card sodium plate, and its correctness was further verified by colony PCR; using EcspeA-XmaⅠ-F and EcspeA-BamHⅠ-R as primers, Escherichia coli BL21 genome was used as a template to amplify the target fragment EcspeA (arginine decarboxylase speA gene); the multiple cloning site of the plasmid pEC-XK99E was treated with double enzymes XmaⅠ and BamHⅠ, and after purification of the enzyme digestion product, the cut plasmid was connected with the amplified target fragment EcspeA, and the connection product pEC-XK99E-EcspeA was transferred into JM109 competent cells, and the positive clones were selected on the resistant plate sodium card plate, and the correctness was further verified by colony PCR. Using stapauh-XbaI-F and stapauh-HindⅢ-R as primers and the Spirochaeta thermophila DSM6578 genome as a template, the target fragment stapauh was amplified, and the second multiple cloning site of the plasmid pEC-XK99E-stcapadh-stcapadc was digested with double enzymes XbaI and HindⅢ. After purification, the digestion product was ligated with the amplified target fragment EcspeA (Escherichia coli speA gene) and stapauh. The ligation product pEC-XK99E-EcspeA-stcapadh-stcapadc-stapauh was transformed into JM109 competent cells, and positive clones were selected on the resistance plate card sodium plate, and its correctness was further verified by colony PCR. Since the expression plasmid pEC-XK99E has only one multiple cloning site, RBS sequences were added upstream of each gene fragment, and the sequences were BBa_B0033 (TCACACAGGAC) and BBa_B0034 (AAAGAGGAGAAA).

[0082] Select the JM109 strain with the correct connection, extract the plasmid pEC-XK99E-EcspeA-stcapadh-stcapadc-stapauh and transform it into the competent cell Corynebacterium glutamicum ATCC 13032 to construct the Corynebacterium glutamicum-EcspeA-stcapadh-stcapadc-stapauh spermidine synthesis strain. The construction method of the remaining strains is similar to that of Corynebacterium glutamicum-EcspeA-stcapadh-stcapadc-stapauh. Arginine decarboxylase, carboxyaminopropyl agmatine dehydrogenase, carboxyaminopropyl agmatine decarboxylase and aminopropyl agmatine urea hydrolase from different strains are connected to the multiple cloning site of the pEC-XK99E plasmid. The connection of other genes is similar to the above. The primer sequences used are shown in Table 1:

[0083] Table 1 Primer sequences (SEQ ID NO. 1-6)

[0084]

[0085]

[0086] The obtained recombinant bacteria were induced to express, and the induction expression method was carried out according to the above steps. The concentration of spermidine in the supernatant was detected by HPLC, as shown in Table 2.

[0087] Table 2 Spermidine content detection

[0088] Recombinant bacteria Spermidine (g / L) C.glutamicum-EcspeA-stcapadh-stcapadc-stapauh 8.4 C.glutamicum-EcspeA-iccapadh-iccapadc-icapauh 6.2 C.glutamicum-EcspeA-dacapadh-dacapadc-daapauh 4.7 C.glutamicum-EcspeA-gscapadh-gscapadc-lbapauh 5.1 C.glutamicum-EcspeA-stcapadh-gscapadc-stapauh 3.6 C.glutamicum-EcspeA-gscapadh-stcapadc-stapauh 2.0 C.glutamicum-EcspeA-stcapadh-dacapadc-stapauh 3.2 C.glutamicum-EcspeA-dacapadh-stcapadc-stapauh 5.3

[0089] The strain C. glutamicum-EcspeA-stcapadh-stcapadc-stapauh with the best effect of inducing expression of spermidine synthesis is selected, and the gene with the best combination is integrated into the genome of Corynebacterium glutamicum ATCC13032. The genome of Corynebacterium glutamicum ATCC 13032 was used as a template to amplify the 2000 bp fragment upstream of the argB gene, and 1000 bp of each fragment was taken as the left and right homologous arms, respectively; pEC-XK99E-EcspeA-stcapadh-stcapadc-stapauh was used as a template for PCR amplification to obtain the EcspeA-stcapadh-stcapadc-stapauh fragment, which was digested and connected with pK18mobsacB to construct the pK18mobsacB-EcspeA-stcapadh-stcapadc-stapauh integration plasmid, and the integration plasmid pK18mobsacB-EcspeA-stcapadh-stcapadc-stapauh was transferred into the competent state of Corynebacterium glutamicum ATCC13023 by electrotransformation. The kanamycin-resistant clones that had produced the first recombination were screened on LB plates containing 25 g / mL kanamycin. Transformants were selected and inoculated into LB medium, and after shaking and culturing overnight at 30°C, they were spread on LB plates containing 10% sucrose to screen clones that had produced the second recombination. Transformants were inoculated on plates containing 25g / mL kanamycin and 10% sucrose to verify the kanamycin and sucrose resistance of the transformants. Among them, clones with sucrose resistance and kanamycin sensitivity were clones with integration, which were verified by PCR, and genes were extracted and sequenced to verify their correctness. A genome-integrated strain C.glutamicum-EcspeA-stcapadh-stcapadc-stapauh was constructed and named C1, which was used as the basic strain for subsequent research.

[0090] The production of C1 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 8.4 g / L.

[0091] Example 2: Knockout of the argR gene to relieve the inhibitory effect of the repressor protein

[0092] The argR gene (the amino acid sequence accession number on NCBI is WP_003858683.1) is a repressor protein in the intermediate pathway. The encoded DNA-binding dual transcriptional regulator inhibits the expression of the arg series genes and the excessive synthesis of the required important intermediates ornithine and arginine. Therefore, in order to ensure the stable and high-rate synthesis of each intermediate, the gene encoding the repressor protein was deleted to increase the metabolic flux, and the engineered bacterium C. glutamicumΔArgR was obtained, which was named C2.

[0093] The specific process is as follows:

[0094] (1) Knockout of the repressor protein ArgR

[0095] The knockout of this gene also uses the overlapping PCR method to construct a plasmid for gene knockout. Using the genomic DNA of Corynebacterium glutamicum as a template, PCR reaction was performed, and argR-1 and argR-2 were used as primers to amplify the 225bp fragment upstream of the argR gene, wherein argR-1 has a BamHⅠ restriction site, and argR-3 and argR-4 were used as primers to amplify the 226bp fragment downstream of the argR gene, wherein argR-4 has a SalⅠ restriction site, and primers argR-2 and argR-3 have a complementary sequence of about 20bp. The two PCR products were recovered from the gel, mixed in equal amounts and used as templates, and the second round of PCR was performed with primers argR-1 and argR-4. Because the two fragments have a complementary sequence of about 20bp, the upstream PCR product and the downstream PCR product form overlapping chains, and the upstream and downstream PCR products are spliced ​​together to obtain a product of 501bp in size. The obtained PCR product was ligated with plasmid pK18mobsacB after double digestion with BamHI and SalⅠ to obtain recombinant plasmid pK18mobsacB-argR.

[0096] The knockout plasmid pK18mobsacB-argR constructed was used to knock out the argR gene. The knockout plasmid pK18mobsacB-argR was transferred into the competent state of Corynebacterium glutamicum ATCC13023 by electrotransformation. The kanamycin-resistant clones that have produced the first recombination were screened on an LB plate containing 25g / mL kanamycin. The transformants were selected and inoculated into LB medium, and after overnight culture at 30°C, they were spread on an LB plate containing 10% sucrose to screen the clones that have produced the second recombination. The transformants were inoculated onto a plate containing 25g / mL kanamycin and a plate containing 10% sucrose, respectively, to verify the kanamycin and sucrose resistance of the transformants. Among them, the clones with sucrose resistance and sensitivity to kanamycin are clones that have been knocked out, and are verified by PCR, and the genes are extracted and sequenced to verify their correctness. Among them, the primer design is shown in Table 3:

[0097] Table 3 Primer sequences (SEQ ID 7-10)

[0098] Primer name Primer sequence 5’-3’ SEQ ID argR-1 TCTAGAGGATCGTGACTCGCACTGCACGC NO.7 argR-2 CAACTGCTCTAAGCAGTAACTGGGCCGACCGCGTAGT NO.8 argR-3 TTTACTGCTTAGAGCAGTTGTTTCTACAGATCATTCCG NO.9 argR-4 CTGCAGGTCGACTTAAGTGGTGCGCCCGCT NO.10

[0099] The production of C2 arginine was verified by shake flask culture, and the arginine concentration in the shake flask supernatant was measured to be 10.6 g / L.

[0100] Example 3: Strong promoter enhances key enzyme expression

[0101] N-acetyl-γ-glutamyl phosphate reductase, acetyl-ornithine aminotransferase, N-acetyl-glutamate kinase and N-acetyl-ornithine 5-aminotransferase encoded by argC, argJ, argB and argD genes are key enzymes in the arginine synthesis pathway. Therefore, the present invention uses a strong promoter trc to replace its natural promoter, strengthen its expression and promote the synthesis of arginine metabolic flux. Wherein, the trc promoter (sequence: SEQ ID NO.69: 5'-TTGACAATTAATCATCCGGCTCGTATAATG-3') is derived from pTrc99a plasmid. Aspartate kinase encoded by lysC gene catalyzes the phosphorylation of aspartate, and aspartate semialdehyde dehydrogenase encoded by asd gene catalyzes the phosphorylated aspartate to generate aspartate semialdehyde. In order to strengthen the enzyme activity and metabolic flux of this metabolic pathway, the strong promoter trc is used to replace its natural promoter, strengthen its expression, and accumulate more target products.

[0102] Using C2 bacteria as the starting bacteria, the key enzymes of the synthesis pathway lysC (the accession number of the amino acid sequence on NCBI is WP_003863352.1), asd (the accession number of the amino acid sequence on NCBI is WP_003863349.1), argC (the accession number of the amino acid sequence on NCBI is AST20632.1), argJ (the accession number of the amino acid sequence on NCBI is WP_003861599.1) and argB (the accession number of the amino acid sequence on NCBI is WP_003858695.1), argD (the accession number of the amino acid sequence on NCBI is WP_060564513.1) were further enhanced, and the strong trc promoter was used to replace the natural promoter of the gene to obtain the engineered bacteria C2-P trc lysC-P trc asd-P trc argC-P trc argJ-P trc argB-P trc argD strain.

[0103] The specific process is as follows:

[0104] According to the lysC of C.glutamicum ATCC13032 in NCBI, Primer Premier5 was used to design the relevant fragment primers (Table 4). Using the C.glutamicum ATCC13032 genome as a template and lysC-KZ-F / R as primers, PCR amplified the target gene fragment lysC, and added restriction sites EcoRI and HindⅢ in the upstream and downstream, respectively, and purified the PCR fragment. The pTrc99a plasmid was double-digested with EcoRI and HindⅢ, the plasmid after restriction digestion was purified, and the purified lysC fragment was connected and transformed into E.coli JM109 competent cells, and the positive transformants were selected. Colony PCR and sequencing were performed using the verification primer lysC-99a-YZ-F / R to verify its correctness. The successfully transformed plasmid pTrc-lysC was extracted and used as a template. BamHI-trc-lysC-F and trc-lysC-SacI-R were used as primers to amplify the target fragment trc-lysC sequence, which was verified to be about 1353bp by gel running and purified. The T19 vector plasmid was double-digested with BamHI and SacI enzymes, and after purification, it was connected and transformed with the trc-lysC fragment. The verification primers trc-lysC-T19-YZF / YZR were used for colony PCR and company sequencing to verify and select the correct positive transformant T19-trc-lysC. Using the lysC genome in C.glutamicum ATCC13032 as a template, lysC-LA-EcoRI and BamHI-lysC-LA were used as primers to amplify the left arm fragment LA, and lysC-RA-XbaI and HindⅢ-lysC-RA were used as primers to amplify the right arm fragment RA. After purification, they were connected to the left and right arms of the double-digested and purified plasmid T19-trc-lysC, respectively, and sent to the company for sequencing to find the plasmid T19-LA-trc-lysC-RA that correctly connected the left and right arms. The plasmid T19-LA-trc-lysC-RA with the left and right arms connected was extracted and used as a template. Using lysC-LA-EcoRI and HindⅢ-lysC-RA as primers, the target fragment LA-trc-lysC-RA was amplified, with a size of about 3400bp. After the PCR product was purified, the restriction endonuclease DpnI was used to eliminate the template effect. The product after enzyme digestion was further purified and then connected with the pK18mobsacB plasmid digested with double enzymes to construct the pK18mobsacB-LA-trc-lysC-RA plasmid, which was transferred into C2 competent cells. The lysC gene with the trc strong promoter in the recombinant plasmid was replaced with the original lysC gene by using the principle of homologous recombination, and the trc strong promoter was integrated to enhance the expression of the operon lysC.LysC-YZ-F and LysC-YZ-R were used to verify and sequence the promoter-enhanced bacteria.

[0105] According to the above method, the promoters of the genes asd and argCJBD were replaced in sequence. trc lysC-P trc asd-P trc argC-P trc argJ-P trc argB-P trc argD, named C3. The primers used are shown in Table 4 below:

[0106] Table 4 Primer sequences (SEQ ID NO.11-52)

[0107]

[0108]

[0109] The production of C3 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 15.3 g / L.

[0110] Example 4: Introducing exogenous transporter to enhance the extracellular transport of spermidine

[0111] Furthermore, the present invention integrates the well-characterized spermidine transporter MdtJI from Escherichia coli to increase the amount of spermidine transported out of the cell. The integration scheme is the same as described in Example 1. First, the target gene cluster mdtJI is cloned from Escherichia coli, and connected to the shuttle plasmid pEC-XK99E to construct the plasmid pEC-XK99E-mdtJI;

[0112] Then, the target fragment trc-mdtJI with a strong promoter was amplified using the plasmid pEC-XK99E-mdtJI as a template, and the fragment was connected to the plasmid pK18mobsacB to construct the integration plasmid pK18mobsacB-trc-mdtJI;

[0113] The integration plasmid pK18mobsacB-trc-mdtJI was transferred into the competent cell C3 of Corynebacterium glutamicum, and the target gene fragment trc-mdtJI was integrated into the genome through the principle of homologous recombination to construct the strain C3-mdtJI, which was named C4.

[0114] The obtained recombinant bacteria C4 were subjected to shake flask fermentation, and the spermidine production in the fermentation broth was detected by HPLC. The spermidine concentration in the shake flask supernatant was measured to be 20.3 g / L. The introduction of the transporter protein significantly improved the ability of Corynebacterium glutamicum to produce spermidine, and transported more intracellular spermidine to the extracellular space.

[0115] Table 5 Primer sequences (SEQ ID NO.53~56)

[0116]

[0117]

[0118] The production of C4 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 20.3 g / L.

[0119] Example 5: Weakening the competitive pathway to reduce the diversion of spermidine synthesis precursors

[0120] Aspartate semialdehyde is an important shunt node material, which can not only flow to the direction of synthesizing spermidine, but also can be converted into dipycolic acid under the action of 4-hydroxy-tetrahydrodipyridine carboxylate synthetase encoded by dapA gene (the accession number of amino acid sequence on NCBI is WP_060565156.1), converted into diaminopimelate under the action of a series of dipycolic acid related enzymes, and finally decarboxylated to form lysine under the action of diaminopimelate decarboxylase encoded by lysA (the accession number of amino acid sequence on NCBI is WP_003861293.1). Therefore, in the process of carboxyl S-adenosylmethionine synthesis, in order to reduce the burden of branch metabolism, the present invention replaces the start codon ATG of encoding 4-hydroxy-tetrahydrodipyridine carboxylate synthetase gene dapA with the start codon UUG of weak expression, then knocks out the lysA gene encoding diaminopimelate decarboxylase, reduces lysine branch metabolism. Its specific steps are as follows:

[0121] The replacement principle of the start codon is the same as that of site-directed mutagenesis. According to the site-directed mutagenesis method, ATG is replaced with UUG, so the operation steps are the same as those described in Example 3. The gene T-dapA with the replaced start codon is integrated into the lysA gene site, and the integration method is the same as that described in Example 1 to construct a new strain C4-△lysA-PUUG:dapA.

[0122] Furthermore, in order to reduce the metabolic flux of glutamate to proline, the present invention transforms the proB gene encoding γ-glutamate kinase (the accession number of the amino acid sequence on NCBI is BAV23967.1). Deleting the gene will cause the growth of Corynebacterium glutamicum to be slow, which may affect defective strains. Therefore, the present invention weakens the expression of the gene and changes its start codon to a rare codon GTG or TTG, thereby reducing the synthesis of glutamate to proline and promoting the large-scale synthesis of ornithine and putrescine. The specific steps are as follows:

[0123] The codon ATG of the proB gene was mutated to TTG, i.e., site-directed mutagenesis, and the transformation was performed according to the site-directed mutagenesis method described in Example 3. The strain C4-△lysA-PTTG:dapA-PTTG:proB with weakened proB gene expression was obtained and named C5.

[0124] The required primers are shown in Table 6:

[0125] Table 6 Primer sequences (SEQ ID NO.57~68)

[0126]

[0127]

[0128] The production of C5 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 28.8 g / L

[0129] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A genetically engineered bacterium of Corynebacterium glutamicum, characterized in that: The engineering bacteria express exogenous arginine decarboxylase, exogenous carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine urea hydrolase.

2. The engineered bacteria according to claim 1, characterized in that The engineered bacteria have knocked out the gene encoding the repressor protein argR.

3. The engineered bacteria according to claim 1, characterized in that The engineered bacteria utilizes a strong promoter to replace the natural promoters of the gene lysC encoding aspartate kinase, the gene asd encoding aspartate semialdehyde dehydrogenase, the gene argC encoding N-acetyl-γ-glutamyl phosphate reductase, the gene argJ encoding acetyl-ornithine aminotransferase, the gene argB encoding N-acetyl-glutamate kinase and the gene argD encoding N-acetyl-ornithine 5-aminotransferase.

4. The engineered bacteria according to claim 2, characterized in that The engineered bacteria utilizes a strong promoter to replace the natural promoters of the gene lysC encoding aspartate kinase, the gene asd encoding aspartate semialdehyde dehydrogenase, the gene argC encoding N-acetyl-γ-glutamyl phosphate reductase, the gene argJ encoding acetyl-ornithine aminotransferase, the gene argB encoding N-acetyl-glutamate kinase and the gene argD encoding N-acetyl-ornithine 5-aminotransferase.

5. The engineered bacteria according to any one of claims 1 to 4, characterized in that The engineered bacteria integrate the transporter MdtJI gene for transferring spermidine to the extracellular space.

6. The engineered bacteria according to any one of claims 1 to 4, characterized in that The engineered strain also knocks out the lysA gene; or, after knocking out the lysA gene, the expression of the dapA gene is further weakened; or, after knocking out the lysA gene and weakening the expression of the dapA gene, the expression of the proB gene is further weakened.

7. The engineered bacterium of Corynebacterium glutamicum according to any one of claims 3 to 6, characterized in that The strong promoter is trc.

8. Use of the engineered bacterium Corynebacterium glutamicum according to any one of claims 1 to 4 in producing spermidine.

9. Use of the engineered bacterium Corynebacterium glutamicum according to any one of claims 5 to 6 in producing spermidine.

10. A method for constructing a genetically engineered bacterium of Corynebacterium glutamicum, characterized in that: The method comprises: (1) integrating exogenous arginine decarboxylase, exogenous carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine urea hydrolase genes into a plasmid, and integrating the plasmid into Corynebacterium glutamicum; (2) constructing a gene knockout plasmid to knock out the argR gene; (3) Use the strong promoter trc to replace the natural promoters of argC, argJ, argB, argD, and lysC; (4) integrating the trc and transporter protein MdtJI genes into Corynebacterium glutamicum; (5) Knock out the lysA gene and point mutate the start codons of the dapA and proB genes.

Images