A recombinant strain expressing Bcf pili and its application

Abstract

The present invention discloses a recombinant strain expressing Bcf pili, and the recombinant strain is obtained by introducing an expression vector containing a Bcf operon gene into an inert carrier bacterium. The Bcf operon gene is inserted into the expression vector pBR322 to obtain a recombinant plasmid, and the recombinant plasmid is introduced into the inert carrier bacterium S9 to obtain the recombinant strain, and the deposit number of the inert carrier bacterium S9 is CGMCC No.17340. The above-mentioned recombinant strain performs better in terms of rapidity, specificity, sensitivity, stability, simplicity and low price, and can meet the requirements of on-site and large-scale, large-volume and rapid detection of Salmonella infection in livestock and poultry groups. It is suitable for large-scale initial screening of Salmonella by targeted detection of multiple serotypes of Salmonella infection. It can also monitor the antibody level after Salmonella vaccination.

Description

Technical Field

[0001] The invention belongs to the technical field of salmonellosis prevention and treatment, and specifically relates to a recombinant strain expressing Bcf pili and an application thereof. Background Art

[0002] Salmonellosis is a general term for various animal and human diseases caused by Salmonella bacteria. Salmonellosis is an important zoonosis that not only causes significant losses to the livestock and poultry farming industry, but also has great public health significance.

[0003] For the diagnosis and detection of salmonellosis, the most convenient and efficient detection method is to collect whole blood or serum from livestock and poultry to be tested for agglutination detection. The antibody is identified by combining the agglutination antigen with the antibody in the test sample to determine whether agglutination is formed within a certain period of time. Agglutination detection is a rapid and relatively simple diagnostic method, which is particularly suitable for large-scale screening. By using Salmonella-specific antigens, possible infected persons can be identified in a short time. Salmonella has the characteristics of multi-host, high infectivity, diverse pathogenicity and environmental survival ability, making it a pathogen that needs to be monitored. The livestock and poultry breeding industry needs to conduct large-scale initial screening of Salmonella. Initial screening of Salmonella helps to identify infected individuals early and prevent the disease from spreading rapidly in the farm, thereby avoiding large-scale outbreaks. It can detect and control infections early, reduce the negative impact of the disease on production, and reduce economic losses.

[0004] Agglutination antigens refer to antigens used as detection targets in agglutination tests. These antigens usually specifically bind to target antibodies to induce agglutination reactions. In the detection of Salmonella, agglutination antigens are usually surface antigens from Salmonella, such as flagella antigens (H antigens) or body antigens (O antigens). However, when using agglutination antigens for Salmonella detection, the existing H antigen (flagella antigen) and O antigen (body antigen), although widely used, each has some limitations and defects. When detecting Salmonella, H antigen (flagellar antigen) is used because the flagellar antigen is composed of flagellar protein, and the flagellar protein gene has a high variability. Therefore, the flagellar antigen of different Salmonella strains may have different variant forms (the same strain may express different flagellar antigens in different growth stages or environmental conditions), which will lead to unstable agglutination reaction results and false negative or false positive results. In addition, since H antigen may also have similar antigenic structures in different Enterobacteriaceae (such as Shigella and some Escherichia coli), this may lead to cross-reactions and reduce the specificity of the test. In this way, other non-target bacteria may be detected in the specific detection of Salmonella, thereby causing misjudgment. At the same time, the expression of flagellar antigen may be affected by environmental conditions (such as temperature, culture medium components), which may affect the reliability of the test results under different conditions. Due to the complexity of the flagellar structure and the possible hiding or change of antigenic epitopes, the performance of H antigen may be inconsistent in different detection environments. O antigen (somatic antigen) is the polysaccharide part of lipopolysaccharide (LPS), which is composed of many repeating units. Slight differences in these structures may lead to antigenic changes between different strains. In different strains, O antigen may show a high degree of heterogeneity (i.e., different strains may have different O antigen types), thus affecting the universality and consistency of detection. In some cases, O antigen may be partially or completely covered by other structures on the surface of Salmonella (such as capsule, polysaccharide layer, etc.), resulting in the ineffective exposure of antigenic epitopes, thereby reducing the sensitivity of detection and causing false negative results. Similar to H antigen, O antigen also has structurally similar polysaccharides in other enterobacteriaceae (such as some Shigella or Escherichia coli), which may lead to cross-reactions with non-Salmonella and affect the specificity of detection.

[0005] Therefore, although H antigen and O antigen are widely used in Salmonella detection, their respective defects affect the specificity, sensitivity and stability of the detection, which is not conducive to large-scale initial screening of Salmonella in livestock and poultry. Obtaining an agglutinating antigen with higher immunogenicity, which has higher sensitivity, stability and specificity, is of great significance in the field of prevention, control, diagnosis and detection of Salmonellosis in livestock and poultry. Summary of the invention

[0006] The present application proposes a recombinant strain expressing Bcf pili and its application, aiming to propose an agglutination antigen based on a recombinant strain expressing Bcf pili, which has better performance in terms of rapidity, specificity, sensitivity, stability, simplicity and low cost, and can meet the requirements of on-site and large-scale, large-batch and rapid detection of Salmonella infection in livestock and poultry herds. By targeted detection of multiple serotypes of Salmonella infection, it is suitable for large-scale initial screening of Salmonella.

[0007] The technical solution adopted by the invention is: a recombinant strain expressing Bcf pili, wherein the recombinant strain is obtained by introducing an expression vector containing a Bcf operon gene into an inert carrier bacterium.

[0008] Furthermore, the Bcf operon gene is inserted into the expression vector pBR322 to obtain a recombinant plasmid, and the recombinant plasmid is introduced into the inert carrier bacteria S9 to obtain the recombinant strain. The deposit number of the inert carrier bacteria S9 is CGMCC No.17340.

[0009] A method for constructing a recombinant strain comprises the following steps: 1) PCR amplifying a Bcf operon gene and connecting it to a T vector, inserting it into an expression vector pBR322 after DNA sequencing to confirm that it is correct, and constructing a recombinant plasmid pBR3322-Bcf; 2) introducing the recombinant plasmid pBR3322-Bcf into an inert carrier S9 to obtain a recombinant strain, wherein the deposit number of the inert carrier bacteria S9 is CGMCC No.17340.

[0010] A recombinant strain is used as an agglutinating antigen in the identification or detection of Salmonella infection.

[0011] An agglutinating antigen produced by a recombinant strain.

[0012] Furthermore, the preparation method of the agglutination antigen includes: culturing the recombinant strain expressing Bcf pili for 12 hours, adjusting the bacterial amount, and then centrifuging, discarding the supernatant and washing with sterile PBS, resuspending the bacteria with PBS containing 0.25% formaldehyde, and placing at 4°C overnight to use as the agglutination antigen.

[0013] Compared with the prior art, the recombinant strain expressing Bcf pili in the present invention has an accurate detection effect on various types of Salmonella, and the detection rate is very high. At the same time, the detection of non-Salmonella is negative, which is specific and can be used for qualitative detection of Salmonella; therefore, the above recombinant strain performs better in terms of rapidity, specificity, sensitivity, stability, simplicity and low cost, and can meet the requirements of on-site and large-scale, large-volume and rapid detection of Salmonella infection in livestock and poultry groups. Through targeted detection of multiple serotypes of Salmonella infection, it is suitable for large-scale initial screening of Salmonella. It can also monitor the antibody level after Salmonella vaccination. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0015] Figure 1 : PCR amplification results of bcf operon gene; Lane M represents Trans 15K DNA marker; Lane 1 represents the PCR amplification product of bcf operon.

[0016] Figure 2 :The results of restriction enzyme digestion identification of pBR322-bcf plasmid. Lane M represents Trans 15K DNA marker; Lane 1 represents pBR322-bcf circular plasmid; Lane 2 represents the linear fragment of pBR322-bcf digested by SphⅠ. DETAILED DESCRIPTION

[0017] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0018] The present invention provides a recombinant strain expressing Bcf pili and its application. The experimental methods used in the following embodiments are all conventional methods unless otherwise specified, and the experimental materials used in the following embodiments are all purchased from conventional biochemical reagent stores unless otherwise specified.

[0019] The Salmonella Gallinarum SG01 strain used in the present invention has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with a deposit address of Beijing, China, a deposit number of CGMCC No.16049, a deposit date of July 2, 2018, and a classification name of Salmonella Gallinarum, with a strain code of SG01.

[0020] The inert carrier bacteria S9 strain used in the present invention has been deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, with a deposit address of CGMCC No.17340 in Beijing, China, a deposit date of March 18, 2019, and a classification name of Salmonella sp., with a strain code of S9.

[0021] Example 1: Amplification and cloning of Salmonella Bcf operon genes

[0022] The genome of Salmonella enterica serovar Gallinarum SG01 strain was used as a template to amplify the bcf operon gene fragment using Roche long fragment amplification system super-fidelity enzyme (purchased from Hoffmann-La Roche Biotechnologies, Switzerland), and its coding sequence is;

[0023] ATGAAAAAGCTGTACTAGCATTAATGGTCTCTGCCATTGCCTTTGGCGGAATGTTGTCCACCGCGCAAGCGG

[0024] ATACTACAACCGTCACTGGCGGTACGGTAAATTTTGTCGGACAGGTCGCTGACGCTGCCTGTTCTGTTTCCGC

[0025] TGACTCTGTCGATCAGACCGTGACATTAGGCCAGGTTCGCGCCAGTAAATTAACCGAGGCCGGTATGGTGGCG

[0026] AATCAAAAAGAAGATTTCACCATCAAACTGGAAGACTGCGATACTCAGACCAGCCAGAATGCGGCGGTGATTT

[0027] TTAATGGCCAACAGGACGCAAACCAGCCGGGGTCGCTGGCGAATACCGCTGGGGCAGGTTCGGCGACGAATGT

[0028] GGCATTACAACTTTATGGACCAGATGGCCAGGCGCTGAATATCGGTGAATCGTCCAGTACTGTTACCTTGAAC

[0029] GATGGCGAAAACGTTATTCCGCTTAGCGTGGATTATATCGCTACCGGTACGGCGACTGCCGGTAATGTTACCG

[0030] AGACGGCGACATTTAGCATGGTTTATTACTGAATGAAAAAAAACGTACCGATTTTCCTTCGATTATTGCTACT

[0031] GCTGTCGGCGGCCGGCCTGTCGTTTGCCGTGCAGGCGGGAGGCATTGCGCTGGGCGCGACCAGGGTGATTTAT

[0032] CCGCAGGGAAGTAAGCAAACCTCCTTGCCGATTATTAATTCTTCTGCCAGCAATGTTTTTTTAATTCAGTCAT

[0033] GGGTCGCCAATGCCGATGGTTCACGCTCGACGGATTTTATCATTACGCCGCCTCTCTTTGTGATCCAGCCTAA

[0034] AAAAGAAAATATATTACGTATTATGTATGTCGGGCCGTCATTACCGACCGATCGCGAAAGCGTATTTTATTTA

[0035] AACAGTAAAGCGATACCCTCTGTCGATAAAAATAAATTGACCGGCAACTCCCTGCAAATTGCGACGCAAAGCG

[0036] TGATTAAGCTATTTATCCGCCCGAAAAATCTGGCGGAGGCGCCAGCTCATGCCCCGTCGACGCTTCGCTGCCG

[0037] TAACGAGCGCGGCCAGCTAACGATTACTAACCCTTCGCCGTACTACGTTTCGATGGTTGAACTGTACAGCGCG

[0038] GGGAAAAAACTGCCGAATACTATGGTACCGCCGAAAGGCGCGATCACTCTCCCGGCGACGCCCGGCCAGGTAT

[0039] CTTTGCGCACGGTAAACGATTTTGGCGCAACGACGCCAGCACGCGTTTGTCCAGCTTCATGAATGCGTAATCA

[0040] GCTTTTCATGACGCGATATTACTCCAGCGTAACTAAACCCGTATTAACCCCGCTGGCGTTGGCTATCGCATTG

[0041] GCGCCTGCGCCGGGGTGGGCGGAAAACTATTTCAACCCGGCATTTCTGTCTGACGACCCGTCTGCGGTGGCCG

[0042] ACCTATCGACCTTTTCCCGTAATGCCCAGGCGGCAGGGATGTATCGCGTTGACGTTTACCTGAACAATACGTT

[0043] TCTCGCGACCAGAGACATTGCCTTCCAGGCGGTGAAAACGACGGGAAAAAGCGCGCCCACCGATGACAGCGGA

[0044] TTACGCGCCTGCCTGACGCCTGAAATGCTTAAAAATATGGGGGTAAACACCGGGGCGTTTCCACTGTTGGCGA

[0045] AGGCGGCGGCGGGAAGTTGCCCTGATCTCGCCAGTGCGATACCGGCCGCCCGGACCCGCTTTGATTTTGCGCA

[0046] GCAACGTCTCGACATTAGCATCCCGCAGGCGGCGATGGTTGCCAGCGCCAGAGGCTATATCCCACCGAAATAC

[0047] TGGGATGAAGGTATTAATGCGTTGCTATTGAATTACACCTTTACCGGCGCGAATAGTCAGGATCGGAGCCCAG

[0048] GCGGCAGTGCGGAGAACAGCTATTTTCTTGGATTGAATAGCGGCCTTAATCTGGGGGCCTGGCGGTTACGCGA

[0049] CTACTCCACATGGAACGCGAATAGCGGCGATCAGAATAGCGACAGCGACTGGCAGCACATCAGTACTTATCTG

[0050] GAACGTGATGTGGTCTTTTTGCAGGGAGAACTGACGGCAGGCGATAGTTATACCCCCTCCGCATTATTCGACA

[0051] GCCTTCCTTTTCGTGGGCTACAACTGGCGTCTGACGACAATATGTTGCCAGACAGCATGAAGGGCTTCGCACC

[0052] GACCATTCACGGCATTGCCAGAAGCAACGCGCAAGTGACCATTCGGCAAAACGGCTACATCATTAATCAGCGC

[0053] TATGTGCCGCCCGGGGCATTTACTATTAATGATCTCTATCCTACCGCCGCCAGCGGCGATTTGACTGTGGAAG

[0054] TCAAAGAGTCCGACGGTTCTATTAATCGCTATAACGTGCTCTATTCCGCCGTGCCGATTCTACAACGAGAAGG

[0055] GCGGCTGAAGTATGCGGCGACGGTGGCGGAGTATCGTAGCGAGAGTAGTCAAAAAGAGAAGGTGAAATTCAGT

[0056] CAGGCGACCTTGATATGGGGGTTACCGCATGGTTTTACGCTGTATGGCGGAACACAACTTTCCAGTCATTATC

[0057] ACGCGCTGGCGATCGGCAGCGGCGCAAATCTGGGCGACTGGGGCGCGGTGTCGCTGGATGTCACCCAGGCTAC

[0058] CAGTACGCTGGCGGATAATAACACCTACCAGGGGCAATCGCTGCGTTTCCTGTATGCCAAATCGCTTGCACAG

[0059] TCAGGAACCAATTTACAGCTTATGGGCTATCGCTATTCAACCTCGGGCTTTTACACGTTGGATGATACCACGT

[0060] GGAAACGGATGAGCGGCTATGACGATGACAGTCGGACTGACAGCGATAAAAGCAGGCCGGAATGGGCGGATTA

[0061] TTACAACCTTTATTACACCAGGAGGGGGAAAGTACAACTCGATATCAATCAACAGCTAGGCGGGTTGGGATCG

[0062] CTTTTTATTACCGGCAGCCAGCAAAGTTACTGGCACACTGATGAAAAGGATTCTTTGTTGCAGGTGGGATACA

[0063] GCGATACGCTGGCGGGTATTGCATGGAGCGTTTCTTACAACAATAACAAATCCGCAGGCGATGCGGAGCGCGA

[0064] TCAAATTTTCGCGCTGAATATCTCGGTGCCGCTAAGTCAATGGCTGCAACACGATGATGAGGTCACGCGCCAT

[0065] CACAATGTTTACGCTACCTTTAGCACCAGTACGGACAAACAGCATAACGTTACGCAGAATGCGGGCCTTAGCG

[0066] GCACACTGCTGGACGAAAACAATCTTAGTTACAACATACAGCAAGGTTATCAGAATCACGGTATTGGCGAAAG

[0067] CGGCGCCGCCAGTCTGGAATACGATGGCGCGAAAGGCAACGCCAACATTGGCTATAACGTTAGCGATAACGGC

[0068] GATTACCAGCAGGTGAATTATGGCCTGAGCGGCGGCCTGGTGGCGCACGCGCATGGAGTGACACTAAGCCAGC

[0069] CGCTGGGCAATACCAATATTTTGATTGCCGCGCCGGGCGCAGCCAACGTCGGCGTTGTCGACCAGCCGGGTAT

[0070] TCATACGGACGCGCGTGGCTATGCGGTGGTGCCGTATGCGACAACATATCGCCAAAACCGTATGGCGCTGGAC

[0071] GTTAACGCCATGGCTGATGATGTCGATATTGATGACGCGGTGACTCGCGTTGTGCCGACCGAAGGCGCGCTGG

[0072] TTCTGGCCCGCTTTAAAGCGCGGGTCGGCGCGCGTGCCCTGGTAACGCTGAATCATAACGGTAAGCCTGTACC

[0073] CTTTGGCGCAACGGTGACGGTGAATGATCGCCATGCGGAGGCGATTGTTGACGAGGCCGGGGAAGTCTATCTT

[0074] TCCGGGTTGTCAGCGCAAGGCGTTCTGCACGTTCGCTGGGGGAACCTGCCGGATCAACAGTGTGTCGCGTCCT

[0075] ATCATCTCTCTTCCTCCCGTCAGATTCTGAGTCGACAACATGCGGAGTGTCATTAAATGAAAATACCTCTTTT

[0076] ATTTGCTCTGCTGGCGGGAAGTGTCGTATCGCAGTACGCCTTCGCAGACGTGTGTAAAAACGTTAACGGCGTG

[0077] CCTTCCAGTATTAATTACGATTTAACGACCACTCTGACGGCAGAACAAAACCAGGTGGGAAAGACGGTTCAAC

[0078] TGGAAAAAAGCCAGGAAGTTAATGTACAGGCGGTGTGTCCCGCCGGCGCGTCGACCTATAGCCAGACTTATCG

[0079] CTCCTATGTGTCGCCATATCCGGTCGTAGAAACGAGCGGTAACTGGAAATATTTAAAGCTGGACCCGGACTAC

[0080] CTTGAAGGCGGAATGCGAATTGAGGATTCTTCGGCGGGCGATATCTATCCGCCAATGAACAACGTTCTGATGG

[0081] GATATGATGAAAATGTGAAAGCGGGTCAACCGTTTTACGTTCGTGACTCAAATCTGGAGTTTCAGCTCAAAAT

[0082] TGTTAAACCGTTCGTCGGCACGGTGAATATTAGTCCTAAGACTATGTTCAATGTTTATGTCATGACCGCCGCA

[0083] GGCGATCCGCTGACAGATGTCGTATACAGCATTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGTGAAA

[0084] TCAACGCCGGACAAACGATTCTGGTAAATTTCGGCGCATTATACAGTGGCAATTTCAACCATGCAGGCCAAAA

[0085] GCCGGAGGGGGTACGAGCGAAAAAATTCAGCGTACCGGTAAAGTGCAGCGGTCTGGATTCGCAGGTCAATTTA

[0086] ACAATGCGTCTTATCGCTACGCCGGATAGCCACGTTCCCCAGGCTATCGCTTCGGATAATGCCGATGTCGGCG

[0087] TAGTGGTCGAAACCGATGAAGGAAACGCGCTTATCCCCAATGATGCACAGAGCGTCGCGCCTTTTATCACCGA

[0088] TAGCGCCGGACGCGCTAACATCACATTGCAAGCCTACCCGGTAAGTACAACAGGCGAAACGCCTGCGGAAGGG

[0089] GCGTTTACCGCACTGGCCAGCCTGCGAGTGGACTTTGACTAAATGAACAGATCACACTGCGCTCTTTTTGCCA

[0090] TGGGACTAATGCTGTGTCCGCAAATCAATGCCAGCGCTGACGACCTCGCTTATAACCTCGAATTTACCGGCAC

[0091] TATTGTGGCGCAAACCTGCGACATAGATATTTCCAGTCTCAGTCAAAGTATTGATTTAGGACAGTTTGCGGTT

[0092] GGCGACTTTCCTTCGACAGGAACAACGACAAAATTTAAGCCCTTTAATATCAACCTCAAAAATTGTTCCCGAG

[0093] GAATTGCCGGGGCGAAGATCTGGTTTACCGGCGAACCCGATCCGGACAATCCCGCGCTACTGGCGATAACCGA

[0094] CACCGGGATGGGAAGCGGAAACATGTTAGCAAGCGGGGTTGGGGTGGAAATTCTGAATGATGATCAGGATACC

[0095] ATCAGTATCAATAATGCCGACTCGGTGGTCTATCCGTTGAAAGCCGGACGCAACACGCTGTCTTTTTATATTC

[0096] GCTATAAATCGACCCGGCCGACGGTCACGTCCGGGAACGCGACGGCGGTCATGTATTTCGATATGCAGTATGA

[0097] ATGAATGCGTAACGATATCCTGTACGGCATCGGGATGCTGCTGGCGGCATCCGGCGTCCAGGCGCACGATGGC

[0098] CGGGTCTATGTTTCCGGAACCATCACGGACAATACGTGTTCGCTCTCTCCTGGCTCGGAAAATATTAACGTGG

[0099] CGATGGGCGCGGTTTCTCAACGGCAGTTTTATCACGCGGGCGACGGTTCCGCATGGCAACCTTTTGCTATCGA

[0100] TTTACAAAACTGCGGCAGCACTGCCAGCGGCGTAACGGTCAGTTTTAGCGGTGCGGCGGACAGCCGTAATACG

[0101] GATTTATTGGCGCTTACCGCAGGGGAAAGCGACGCTTCAGGCATTGGGATTGCGCTTTATGATCAAAATAAAA

[0102] CTTTAATCCCACTGGGGCAAGAGAGTGATGTGGTGACGCTCAGTCCGGGTCAGGCGTCGGCGCATCTGCAATT

[0103] TTACGCGCGTTATCTTGCCGATGGCGGCGCGGTAACGCCCGGGGACGCCAATGCCTCCGCAACCTTCATTCTT

[0104] GCCTATGAATAAATGCCTCCGCAACCTTCATTCTTGCCTATGAATAAGTTCTTTTTACGCTGCGCGATATATT

[0105] GGTGCTTGCTTCCCATATCATGGGCGCAGGCTGGCGTGGTAATTGGCGGTACTCGCTTTATCTATCATGCGGG

[0106] CGCCCCGGCATTAAGCGTACCGGTAAGTAACCATTCAGAAGCGTCCTGGTTAATTGATACGCATATTTTACCT

[0107] GGTGGCCGCTGGCCAGGAACCAAAAACGAAGGGAATATCATGCCCTTCGTGGTCACGCCGCCATTATTTATGC

[0108] TTTCAGCGCGCCAGGAAAACTCAATGCGGGTGGTTTATACCGGCGCACCGCTACCCGCCGACAGGGAAAGTCT

[0109] GTTTACCTTGAGTATCGCCGCTATTCCCTCCGGTAAACCGGAAGCGAACCGTGTACAAATGGCGTTTCGTTCG

[0110] GCTTTAAAATTGCTCTATCGCCCTGAGGGACTCGCCGGCAATCCGCAGCAGGCCTACCGGCATCTGATCTGGT

[0111] CGCTTACCCCCGATGGCGCGACGGTACGCAATCCGACACCCTATTACGTTACGCTCTTTTTATTACGCGCTAA

[0112] CGAGCGCGCCCAGGACAACGCCGGGGTCGTGGCTCCCTTTGCAACGCGTCAAACGGACTGGTGCCGGCACACG

[0113] GTTCGCTGCACTGTGCGCTGGCAAAGTATTAATGACTATGGGCGGGTAATGACAGCGCAAACCGTGGATCTGACGCGTATTCATTAA.

[0114] The upstream and downstream primers for amplifying the sequence are:

[0115] bcf-F:5'- G C TCTAGA C CCT TAT TTT TAT ATT TAA AA GG Ag C-3′;

[0116] bcf-R:5'-CTA GCA TG C TTA ATG AAT ACG CGT CAG ATC C-3'.

[0117] Combination Figure 1 As shown, the underlined marks represent the XbaⅠ and SphⅠ restriction sites respectively.

[0118] The PCR-amplified bcf operon fragment was double-digested with XbaⅠ and SphⅠ, and the pBR322 vector was double-digested with NheⅠ and SphⅠ after purification (XbaⅠ and NheⅠ are a pair of homotypic enzymes, which produce the same sticky ends after cutting, and the XbaⅠ and NheⅠ restriction recognition sites disappear after ligation). Then, they were ligated in vitro with T4 DNA ligase and introduced into Escherichia coli Top10, and positive clones were screened on ampicillin-resistant LB plates. The identification method of the recombinant plasmid was to digest with SphⅠ containing the bcf operon, and then identify it by agarose gel electrophoresis. The target band after digestion was 10681bp ( Figure 2 The recombinant plasmid identified by restriction digestion was named pBR322-bcf.

[0119] Example 2: Expression of Bcf pili and agglutination test based on Bcf pili

[0120] After culturing the inert vector bacteria S9 (pBR322-bcf) expressing Bcf pili for 12 h, the bacterial count was adjusted to 5 billion (5×10 9CFU), then centrifuge at 4000 rpm for 5 min, discard the supernatant and wash twice with sterile PBS (PBS buffer, the most widely used buffer in biochemical research), resuspend the bacteria in PBS containing 0.25% formaldehyde, and place at 4°C overnight to use as agglutination antigen.

[0121] The above-mentioned agglutination antigens were respectively subjected to agglutination reaction tests with 10 clinical Salmonella pullorum-positive chicken sera (numbered 1-10), 10 clinical Salmonella enteritidis-positive sera (numbered 11-20), 20 SPF chicken sera infected with Salmonella typhi (numbered 21-40), 10 SPF chicken sera infected with Salmonella typhimurium (numbered 41-50), 10 SPF chicken sera infected with O1 type Escherichia coli (numbered 51-60), 10 SPF chicken sera infected with O2 type Escherichia coli (numbered 61-70), 10 SPF chicken sera infected with O78 type Escherichia coli (numbered 71-80) and 10 SPF chicken negative sera (numbered 81-90), and the test results are shown in Table 1.

[0122] Table 1. Results of the inert vector S9 expressing Bcf pili for detecting sera infected with multiple serotypes of Salmonella

[0123]

[0124]

[0125]

[0126]

[0127] Note: “+” represents a positive agglutination reaction; “-” represents a negative agglutination reaction.

[0128] According to the test results in Table 1, the inert vector strain expressing Bcf fimbriae can show positive agglutination reaction with 10 clinical Salmonella pullorum-positive chicken sera, 10 clinical Salmonella enteritidis-positive sera, 20 SPF chicken sera infected with Salmonella typhi and 10 SPF chicken sera infected with Salmonella typhimurium, and the detection rate is 100%; at the same time, the inert vector strain expressing Bcf fimbriae will not form visible granular precipitation after being mixed with 10 SPF chicken sera infected with O1 type Escherichia coli, 10 SPF chicken sera infected with O2 type Escherichia coli, 10 SPF chicken sera infected with O78 type Escherichia coli and 10 SPF chicken negative sera, that is, a negative reaction. It can be seen that the recombinant strain expressing Bcf pili proposed in the present invention has an accurate detection effect on various types of Salmonella, and the detection rate is very high. At the same time, the detection of non-Salmonella is negative, and it has specificity, and can be used for qualitative detection of Salmonella; therefore, the above-mentioned recombinant strain performs better in terms of rapidity, specificity, sensitivity, stability, simplicity and low cost, and can meet the requirements of on-site and large-scale, large-batch and rapid detection of Salmonella infection in livestock and poultry herds. Through targeted detection of multiple serotypes of Salmonella infection, it is suitable for large-scale initial screening of Salmonella.

[0129] Example 3: Monitoring serum antibody levels in chickens immunized with Salmonella enterica serovar Gallinarum attenuated live vaccine strain SG01 using an indirect agglutination test based on Salmonella Bcf fimbriae

[0130] After culturing the inert vector bacteria S9 (pBR322-bcf) expressing BCF pili for 12 hours, adjust the bacterial count to 5 billion (5×109 CFU), then centrifuge at 4000rpm for 5 minutes, discard the supernatant and wash twice with sterile PBS, resuspend the bacteria in PBS containing 0.25% formaldehyde, and place at 4°C overnight to use as agglutination antigen.

[0131] The attenuated vaccine strain of Salmonella typhi SG01 was inoculated in SOC liquid culture medium, cultured overnight at 37°C 220rpm, and transferred to fresh SOC liquid culture medium at a ratio of 1:100 the next day. After 12h of culture at 37°C 220rpm, the bacterial amount was adjusted to 5×109 CFU / 200μL, and 10 1-day-old SPF chickens (numbered 1-10) were inoculated orally, and 5 chickens were set as a control group (numbered 11-15), inoculated with 200μL PBS (Ph7.2), and blood was collected weekly from 1 week after immunization until the 10th week, and the agglutination reaction test was performed using the S9 (pBR322-bcf) agglutination antigen prepared above. Specifically, 5μL of separated serum and 5μL of S9 (pBR322-bcf) agglutination antigen were taken on a clean slide, and the agglutination reaction results were observed within 2min after mixing. If agglutinated particles appeared, it was recorded as positive, otherwise it was recorded as negative. After a positive result was obtained, the serum stock solution was diluted by a 2-fold serial dilution method to further determine the serum antibody titer. The serum antibody titer results are shown in Table 2.

[0132] No non-specific agglutination reaction was observed in the sera of the healthy control group chickens (No. 11-15); no agglutination reaction occurred at 1 week and 2 weeks after immunization; at 3 weeks after immunization, sera of 4 chickens (No. 1, 3, 5 and 8) produced agglutination reaction with S9 (pBR322-bcf) agglutination antigen, and the titer was 1:1 (undiluted stock solution); at 4 weeks after immunization, sera of all chickens (10 / 10) had produced a high specific agglutination titer (1:8) and the agglutination titer of sera of 8 chickens (8 / 10) remained at this high level from 4 to 6 weeks; At week 7, the serum antibody titers of 8 chickens (8 / 10) increased again by a gradient (1:16), and the average antibody level of the flock reached a peak; at week 8 after immunization, the serum antibody titers of 9 chickens (9 / 10) remained at the level of week 7, and the serum antibody titer of 1 chicken (No. 9) decreased by a gradient (1:8); at week 9 after immunization, the serum antibody titers of 4 chickens (4 / 10) decreased by a gradient (No. 2, 8, 9 and 10); at week 10 after immunization, the serum antibody titers of 4 chickens (4 / 10) decreased by a gradient (No. 1, 4, 6 and 7).

[0133] Table 2 Results of serum antibody level monitoring after chickens were immunized with Salmonella typhi attenuated live vaccine strain SG01

[0134]

[0135]

[0136] In summary, when the agglutination antigen used was used to measure the serum antibody titer, the antibody titer gradually increased from 1:1 to 1:16 from the third week to the seventh week, and then gradually decreased from the eighth week to the tenth week. This change accurately reflects the progress of the immune response, indicating that the agglutination antigen used can sensitively detect the difference in antibody concentration, thereby being able to evaluate the antibody titer, and the test results for the healthy control group were all negative. The agglutination antigen is specific and can be used to formulate vaccine immunization programs, identify the quality of vaccines, monitor the immune status of poultry and livestock, etc. by monitoring the antibody level after Salmonella vaccination. Moreover, only 5μL of the above test sample and an equal volume of the test reagent are needed, and the reaction results can be observed by naked eyes on site using the glass plate agglutination reaction to accurately determine whether the animal is infected with Salmonella or vaccinated with Salmonella vaccine preparations.

[0137] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A recombinant strain expressing Bcf pili, characterized in that The recombinant strain is obtained by introducing an expression vector containing the Bcf operon gene into an inert carrier bacterium.

2. The recombinant strain according to claim 1, characterized in that The Bcf operon gene is inserted into the expression vector pBR322 to obtain a recombinant plasmid, and the recombinant plasmid is introduced into the inert carrier bacteria S9 to obtain the recombinant strain. The deposit number of the inert carrier bacteria S9 is CGMCC No.17340.

3. A method for constructing a recombinant strain according to claim 1, characterized in that: Includes steps: 1) PCR amplified the Bcf operon gene and connected it to the T vector. After DNA sequencing confirmed that it was correct, it was inserted into the expression vector pBR322 to construct the recombinant plasmid pBR3322-Bcf; 2) The recombinant plasmid pBR3322-Bcf was introduced into the inert vector S9 to obtain the recombinant strain. The deposit number of the inert vector strain S9 is CGMCC No.17340.

4. Use of the recombinant strain as claimed in claim 1 as an agglutinating antigen in the identification or detection of Salmonella infection.

5. An agglutination antigen prepared by the recombinant strain according to claim 1.

6. The agglutination antigen according to claim 5, characterized in that The preparation method of the agglutination antigen comprises: culturing the recombinant strain expressing Bcf pili for 12 hours, adjusting the bacterial amount, then centrifuging, discarding the supernatant and washing with sterile PBS, resuspending the bacteria with PBS containing 0.25% formaldehyde, and placing at 4°C overnight to serve as the agglutination antigen.

Images