Genetically engineered bacterium for producing lactose-N-neotetraose as well as construction method and application of genetically engineered bacterium

Abstract

The invention provides a genetically engineered bacterium for producing lactose-N-neotetraose as well as a construction method and application of the genetically engineered bacterium. The genetically engineered bacterium meets the following conditions: (1) exogenous expression of an MFS transport protein, beta-1, 3-N-acetylglucosamine transferase and beta-1, 4-galactosyl transferase is carried out; (2) carrying out overexpression on galactoside permease and UDP-galactose-4-epimerase (UDP-galactose-4-epimerase); and (3) not expressing or weakening the expression of the setA transporter. Through research, the applicant of the application finds that MFS transporter, beta-1, 3-N-acetylglucosamine transferase and beta-1, 4-galactosyl transferase are exogenously introduced into genetically engineered bacteria, so that the expression quantity of galactosidase and UDP-galactose-4-epimerase in a genome is enhanced, the expression quantity of setA transporter is reduced, and the expression quantity of setA transporter is reduced. The residual quantity of the LNT II in the LNnT synthesis route can be effectively reduced, and the fermentation yield of the LNnT is increased.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a genetically engineered bacterium for producing lactose-N-neotetraose, and a construction method and application thereof. Background Art

[0002] Lactose-N-neotetraose (LNnT), as one of the core components of human milk oligosaccharides, plays an important role in the growth and development of infants and young children. It has been approved by the Food and Drug Administration of the United States and the European Union as a new resource food ingredient to be added to food.

[0003] LNnT production primarily involves chemical synthesis, enzymatic synthesis, and microbial fermentation. Enzymatic synthesis often requires the addition of expensive precursors; biosynthesis, on the other hand, utilizes inexpensive, renewable substrates and offers advantages such as cleanliness, environmental friendliness, and high efficiency, thus offering broader application prospects. Currently, Escherichia coli is often used for LNnT biosynthesis. However, conventional E. coli strains still have several limitations, resulting in low LNnT yields and high byproduct production.

[0004] Therefore, the traditional production method of lactose-N-neotetraose still needs to be improved. Summary of the Invention

[0005] Based on this, one or more embodiments of the present application provide a genetically engineered bacterium with high LNnT production and low LNTII spillover, as well as a construction method and application thereof. The technical solution includes:

[0006] According to a first aspect of the embodiments of the present application, a genetically engineered bacterium for producing lactose-N-neotetraose is provided, wherein the genetically engineered bacterium satisfies the following conditions:

[0007] (1) Exogenous expression of MFS transporter, β-1,3-N-acetylglucosaminyltransferase, and β-1,4-galactosyltransferase;

[0008] (2) overexpression of galactoside permease and UDP-galactose-4-epimerase; and

[0009] (3) The setA transporter protein is not expressed or its expression is weakened.

[0010] In one embodiment, the setA transporter is not expressed or its expression is weakened by knocking out the setA gene.

[0011] In one embodiment, the knockout method comprises at least one of homologous recombination and CRISPR gene editing.

[0012] In one embodiment, the MFS transporter protein includes at least one of bad protein, fred protein, nec protein, marc protein and vag protein.

[0013] In one embodiment, the genetically engineered bacteria satisfies at least one of the following conditions (1) to (5):

[0014] (1) The nucleotide sequence encoding the vag protein is shown in SEQ ID NO: 1;

[0015] (2) The nucleotide sequence encoding the β-1,3-N-acetylglucosamine transferase is shown in SEQ ID NO: 2;

[0016] (3) the nucleotide sequence encoding the β-1,4-galactosyltransferase is shown in SEQ ID NO: 3;

[0017] (4) the gene encoding the galactoside permease is the lacY gene, and the nucleotide sequence encoding the galactoside permease is shown in SEQ ID NO: 4; and

[0018] (5) The gene encoding the UDP-galactose-4-epimerase is the galE gene, and the nucleotide sequence encoding the UDP-galactose-4-epimerase is shown in SEQ ID NO: 5.

[0019] In one embodiment, the genetically engineered bacteria include bacteria;

[0020] Optionally, the bacteria include at least one of Escherichia coli and Bacillus subtilis;

[0021] Further optionally, the Escherichia coli includes Escherichia coli BL21 (DE3).

[0022] In one embodiment, the genetically engineered bacteria contains at least one of the wcaJ gene, lacZ gene, fucIK gene, nagB gene and wecB gene that is not expressed or has weakened expression;

[0023] Optionally, the genetically engineered bacteria contain inactivated or deleted wcaJ gene, lacZ gene and fucIK gene;

[0024] Optionally, the genetically engineered bacteria contain inactivated or deleted nagB gene, wecB gene and lacZ gene.

[0025] According to a second aspect of the embodiments of the present application, a method for constructing a genetically engineered bacterium for producing lactose-N-neotetraose as described above is provided, comprising the following steps:

[0026] The integration vector expressing the MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyl transferase is introduced into the genetically engineered bacteria to be transformed;

[0027] causing the setA transporter protein of the genetically engineered bacteria to be transformed to not be expressed or to be less expressed; and

[0028] The recombinant vector over-expressing galactoside permease and UDP-galactose-4-epimerase is introduced into the genetically engineered bacteria to be transformed to construct the genetically engineered bacteria producing lactose-N-neotetraose.

[0029] According to a third aspect of the embodiments of the present application, a method for preparing lactose-N-neotetraose is provided, comprising the following steps:

[0030] The genetically engineered bacteria are fermented and cultured to prepare lactose-N-neotetraose.

[0031] According to a fourth aspect of the embodiments of the present application, a method for producing a dairy product is provided, comprising the following steps:

[0032] preparing lactose-N-neotetraose by the above-mentioned preparation method; and

[0033] A dairy product is prepared using the lactose-N-neotetraose.

[0034] Compared with traditional technologies, this application has the following beneficial effects:

[0035] The applicant of the present application discovered through research that exogenously introducing MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyl transferase into genetically engineered bacteria, enhancing the expression of galactoside permease and UDP-galactose-4-epimerase in the genome, and reducing the expression of setA protein can effectively reduce the residual amount of LNT II in the LNnT synthesis pathway and increase the fermentation yield of LNnT. DETAILED DESCRIPTION

[0036] In order to make the above-mentioned objects, features and advantages of the present application more clearly understood, the specific embodiments of the present application are described in detail. In the following description, many specific details are set forth to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways than those described herein, and those skilled in the art can make similar improvements without violating the connotations of the present application. Therefore, the present application is not limited to the specific embodiments disclosed below.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art in the technical field of this application. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application. Unless otherwise specified, the various raw materials, reagents, instruments and equipment used in this application can be purchased from the market or can be prepared by existing methods.

[0038] In this application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0039] In this application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be understood as limiting the scope of protection of this application.

[0040] In this application, the terms "optionally," "optional," and "optional" mean optional or dispensable, i.e., they refer to either option being selected from two parallel options: "with" or "without." If a technical solution contains multiple "optional" clauses, each "optional" clause is independent unless otherwise specified and there are no contradictions or constraints.

[0041] In this application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0042] In this application, when referring to a numerical interval (i.e., a numerical range), unless otherwise specified, the optional numerical distribution is considered continuous within the above numerical interval and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical range, as well as each numerical value between the two numerical endpoints. Unless otherwise specified, when a numerical interval refers only to an integer within the numerical interval, it includes the two endpoint integers of the numerical range, as well as each integer between the two endpoints. In this article, it is equivalent to directly listing each integer, such as t is an integer selected from 1-10, indicating that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges included therein.

[0043] In this application, the terms "first," "second," "third," "fourth," etc. in "the first aspect," "the second aspect," "the third aspect," "the fourth aspect," etc. are used for descriptive purposes only and should not be understood as indicating or implying relative importance or quantity, nor should they be understood as implicitly indicating the importance or quantity of the indicated technical features. Furthermore, "first," "second," "third," "fourth," etc. serve only as non-exhaustive enumeration and description, and should be understood not to constitute a closed-ended limitation on quantity.

[0044] Unless otherwise specified, the temperature parameters in this application allow for both constant temperature treatment and temperature fluctuations within a certain temperature range. It should be understood that the constant temperature treatment allows for temperature fluctuations within the accuracy range of instrument control. Fluctuations within ranges such as ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are permitted.

[0045] All documents mentioned in this application are cited as references in this application, just as each document is cited as a reference individually. Unless they conflict with the invention purpose and / or technical solution of this application, the cited documents involved in this application are cited in their entirety and for all purposes. When cited documents are involved in this application, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When cited documents are involved in this application, the examples and preferred embodiments of the cited relevant technical features may also be incorporated into this application as references, but are limited to the ability to implement this application. It should be understood that when the cited content conflicts with the description in this application, the present application shall prevail or be adaptively amended according to the description in this application.

[0046] In this application, "homology" is used interchangeably with "identity" and "similarity". "Homology", "identity" and "similarity" refer to two or more sequences having the same base or amino acid residue at a specific percentage of corresponding positions when the pairwise relationship is maximized in comparison and alignment. The identity of nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. The alignment percentage homology or identity can be determined using any suitable software program known in the art, for example, as described in Current Protocols in Molecular Biology (FM Ausubel, et al, (eds) 1987 Supplement 30, section 7.7.18). Optional programs include the GCGPileup program, such as FASTA (Pearson, et al, 1988 Proc. Natl. Acad. Sci. USA 85: 2444-2448) and BLAST (BLAST Manual, Altschul et al. Natl. Cent Biotechnol. linf.. NatLib Med. (NCIB NLM NIH), Bethesda, Md.. and Altschul et al, 1997 NAR 25: 3389-3402). Another optional alignment program is ALIGN Plus (Scientific and Educational Software, PA), which preferably uses basic parameters. Another optional sequence software program that can be used here is the TFASTA data search program used in the sequence software package Sequence Software Package version 6.0 (Genetics Computer Group, University of Wisconsin, Madison W). Examples of commonly used sequence alignment algorithms include, but are not limited to, CLUSTAL Omega, EMBOSS Needle, MAFFT, or MUSCLE.

[0047] Some embodiments of the present application provide a genetically engineered bacterium for producing lactose-N-neotetraose, which satisfies the following conditions:

[0048] (1) Exogenous expression of MFS transporter, β-1,3-N-acetylglucosaminyltransferase, and β-1,4-galactosyltransferase;

[0049] (2) overexpression of galactoside permease and UDP-galactose-4-epimerase; and

[0050] (3) The setA transporter protein is not expressed or its expression is weakened.

[0051] In some embodiments, the gene encoding the setA transporter is the setA gene. This transporter can efflux glucose, lactose, certain monosaccharides and disaccharides, and inducing molecules such as isopropyl-β-D-thiogalactoside. It also has broad substrate specificity, preferring glycosides or galactosides with alkyl or aryl substituents. It is understood that reducing the expression of the setA transporter in genetically engineered bacteria, or completely eliminating its expression, can effectively reduce the extracellular escape of the intermediate LNT II during the production of lactose-N-neotetraose.

[0052] In the present application, MFS protein refers to the major facilitator superfamily protein, which can promote the transport of substances such as human milk oligosaccharides (HMOs) including lactose-N-neotetraose through the cell membrane.

[0053] In this application, "overexpression" refers to the expression level of a protein being higher than the natural expression level of the genetically engineered bacteria.

[0054] In some embodiments, the setA transporter is not expressed or its expression is reduced by knocking out the setA gene. Optionally, the sequence of the knocked-out setA gene is as shown in SEQ ID NO:45.

[0055] As an example, the method of knockout includes at least one of homologous recombination and CRISPR gene editing.

[0056] The method of gene knockout is not particularly limited in this application, as long as the purpose of this application can be achieved.

[0057] In some embodiments, the genetically engineered bacteria may further comprise overexpressed β-1,4-galactosyltransferase.

[0058] In some embodiments, the gene encoding β-1,3-N-acetylglucosamine transferase is the lgtA gene; alternatively, the nucleotide sequence encoding β-1,3-N-acetylglucosamine transferase is shown in SEQ ID NO: 2.

[0059] In some embodiments, the nucleotide sequence encoding the β-1,3-N-acetylglucosamine transferase has at least 80% homology to SEQ ID NO: 2. For example, it has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology.

[0060] In some embodiments, the gene encoding β-1,4-galactosyltransferase is the lgtB gene; alternatively, the nucleotide sequence encoding β-1,4-galactosyltransferase is shown in SEQ ID NO:3.

[0061] In some embodiments, the nucleotide sequence encoding the beta-1,4-galactosyltransferase has at least 80% homology to SEQ ID NO: 3. For example, it has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology.

[0062] β-1,3-N-acetylglucosaminyltransferase (β-1,4-Galactosyltransferase) and β-1,4-Galactosyltransferase (β-1,3-N-acetylglucosaminyltransferase) are two key glycosyltransferases in the lactose-N-neotetraose synthesis pathway. β-1,3-N-acetylglucosaminyltransferase catalyzes the transfer of N-acetylglucosamine (GlcNAc) from uridine-5'-diphospho-GlcNAc (UDP-GlcNAc) to the 3'-OH position of the terminal N-acetyllactosamine derivative, forming the N-acetyllactosaminoglycan chain. LNT-II is synthesized using lactose as an acceptor and GlcNAc as a donor. β-1,4-Galactosyltransferase (β-1,4-GalT) catalyzes the transfer of a galactosyl group from lactose to LNT-II, synthesizing lactose-N-neotetraose (LNnT) using UDP-galactose and LNT-II as substrates.

[0063] In some embodiments, the amino acid sequence of the galactosyl permease is registered at NCBI (National Center for Biotechnology Information) as NP_414877.1. It is understood that the galactosyl permease can specifically catalyze the decomposition of lactose into galactose and glucose, thereby providing sufficient reaction substrates for the synthesis pathway of lactose-N-neotetraose.

[0064] In some embodiments, the gene encoding the galactoside permease is the lacY gene; alternatively, the nucleotide sequence encoding the galactoside permease is shown in SEQ ID NO:4.

[0065] In some embodiments, the nucleotide sequence encoding the galactoside permease is at least 80% identical to SEQ ID NO: 4. For example, it is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical.

[0066] In some embodiments, the amino acid sequence of UDP-galactose-4-epimerase is registered at NCBI (National Center for Biotechnology Information) with accession number NP_415280.3. It is understood that UDP-galactose-4-epimerase can catalyze the epimerization of UDP-glucose to UDP-galactose, and therefore overexpressing UDP-galactose-4-epimerase in genetically engineered bacteria can increase the accumulation of UDP-galactose. Under the action of β-1,3-N-acetylglucosaminyltransferase, UDP-galactose and the intermediate lactose-N-triose II serve as substrates to generate lactose-N-neotetraose; thereby increasing the consumption of lactose-N-triose II, reducing its residual amount, and increasing the yield of lactose-N-neotetraose.

[0067] In some embodiments, the gene encoding UDP-galactose-4-epimerase is the galE gene; alternatively, the nucleotide sequence encoding UDP-galactose-4-epimerase is shown in SEQ ID NO:5.

[0068] In some embodiments, the nucleotide sequence encoding the UDP-galactose-4-epimerase has at least 80% homology to SEQ ID NO: 5. For example, it has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology.

[0069] In some embodiments, the MFS transporter comprises one or more of bad protein, fred protein, nec protein, marc protein, and vag protein.

[0070] In some embodiments, the amino acid sequence of the vag protein is registered at NCBI (National Center for Biotechnology Information) with accession number WP_048785139.1.

[0071] In some embodiments, the nucleotide sequence encoding the vag protein is as shown in SEQ ID NO: 1. In other examples, the nucleotide sequence encoding the vag protein has at least 80% homology to SEQ ID NO: 1. For example, it has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology.

[0072] It is understandable that the types of integration vectors and expression vectors may also be other integration vectors and expression vectors commonly used in the art, and are not particularly limited in this application.

[0073] In some embodiments, the integration vectors for the MFS transporter, β-1,3-N-acetylglucosaminyltransferase, and β-1,4-galactosyltransferase can be selected from pSPIN.

[0074] In some embodiments, the expression vectors for galactoside permease and UDP-galactose-4-epimerase can be selected from pETDuet-1, pCDFDuet-1 or pRSFDuet-1.

[0075] In the genetically engineered bacteria of the present application, the extracellular transport of LNnT is promoted by introducing an exogenous MFS transporter, the conversion of LNT II to LNnT is promoted by enhancing the expression of UDP-galactose-4-epimerase, and the extracellular escape of LNT II is reduced by reducing the expression of the setA transporter, thereby achieving enhanced LNnT production and reducing the residual amount of LNT II in the product.

[0076] The genetically engineered bacteria of the present application may be any host cell commonly used in the art, and are not particularly limited. Host cells include prokaryotic cells and / or eukaryotic cells. In some optional examples, they may be bacteria or yeast cells, such as Escherichia coli, Bacillus subtilis, etc.; in some optional examples, they may be eukaryotic cells, such as yeast cells, plant cells, insect cells, and animal cells such as mammalian cells (e.g., mouse cells, human cells, etc.). For bacterial host cells, there are no restrictions in principle; they may be true bacteria (Gram-positive bacteria or Gram-negative bacteria) or archaea, as long as they allow the insertion of genetic modification of the gene of interest and can be cultured on a production scale.

[0077] As an example, the bacteria can be Escherichia coli, Klebsiella oxytoca, Anaerobiospirillum succiniciproducens, Actinobacillus succinogenes, Mannheimia succiniciproducens, Rhizobium etli, Bacillus subtilis, Bacillus methanolicus, Corynebacterium glutamicum, Gluconobacter oxydans, Zymomonas mobilis, Lactococcus lactis, Lactobacillus plantarum, Streptomyces coelicolor, coelicolor), Clostridium acetobutylicum, Pseudomonas fluorescens, or Pseudomonas putida. The yeast or fungus may be Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces marxianus, Aspergillus terreus, Aspergillus niger, Pichia pastoris, Rhizopus arrhizus, or Yarrowia lipolytica.

[0078] In some embodiments, the genetically engineered bacteria is Escherichia coli, which may be Escherichia coli BL21 (DE3), or further optionally, Escherichia coli BL21 star (DE3).

[0079] The genetically engineered bacteria of the present application can adapt to a variety of chassis cells, and the transformation of chassis cells tends to be simplified, so that the genetically engineered bacteria can have good stability during subsequent passage and application.

[0080] In some embodiments, the genetically engineered bacteria include inactivation or deletion of one or more of the wcaJ gene, lacZ gene, fucIK gene, nagB gene, and wecB gene. For example, the genome of the genetically engineered bacteria may include inactivation or deletion of one, two, three, four, or five of the wcaJ gene, lacZ gene, fucIK gene, nagB gene, and wecB gene.

[0081] Optionally, the genome of the genetically engineered bacteria includes inactivation or deletion of the wcaJ gene, lacZ gene and fucIK gene.

[0082] Optionally, the genome of the genetically engineered bacteria includes inactivation or deletion of the nagB gene, the wecB gene and the lacZ gene.

[0083] In some embodiments, the genetically engineered bacteria may also include inactivation or deletion of other genes, or overexpression of other genes, as long as the above-mentioned purpose of the present application can be achieved.

[0084] It is understandable that "inactivation" in this application means that the relevant gene is not expressed or the expression activity is reduced; "deletion" means that all or part of the coding fragment of the relevant gene is missing; this application does not specifically limit the method of gene inactivation and gene deletion, which can be any method commonly used in the art.

[0085] By further modifying the chassis cells, the synthesis rate and fermentation yield of lactose-N-neotetraose can be effectively improved.

[0086] It is understood that the genetically engineered bacteria of the present application can be either modified chassis cells or unmodified chassis cells, as long as the technical effects of the present application can be achieved. For example, the genetically engineered bacteria of the present application can also be selected from various chassis cells that have been modified using traditional techniques.

[0087] In some embodiments, the genome of the genetically engineered bacteria may also include expression regulatory elements such as promoters, enhancers, and terminators to achieve the purpose of improving gene expression, expression efficiency, product activity, and other aspects of performance. Any promoter, enhancer, and terminator known in the art may be applicable to the genetically engineered bacteria of this application, as long as they can achieve the technical effects of this application. As an example, the promoter may be a T7 promoter.

[0088] In some embodiments, the genome of the genetically engineered bacteria also includes endogenous nucleic acid fragments, including nucleic acid molecules that have been modified but not removed from the strain; the modification methods include but are not limited to gene replacement, site-specific mutation, etc.

[0089] In some embodiments, the insertion sites of the MFS transporter, β-1,3-N-acetylglucosamine transferase, and β-1,4-galactosyl transferase are yjiP, hlyE, wecB, nagB, lacZ, setA, gloA, ugd, or IS186.

[0090] In a second aspect, the present application provides a method for constructing a genetically engineered bacterium for producing lactose-N-neotetraose according to the first aspect, comprising steps S10, S20, and S30.

[0091] Step S10: introducing the integration vector expressing the MFS transporter protein, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyl transferase into the genetically engineered bacteria to be transformed.

[0092] Step S20: preventing or weakening the expression of the setA transporter protein in the genetically engineered bacteria to be transformed.

[0093] Step S30: introducing the recombinant vector overexpressing galactoside permease and UDP-galactose-4-epimerase into the genetically engineered bacteria to be transformed, so as to construct a genetically engineered bacteria that produces lactose-N-neotetraose.

[0094] This application does not specifically limit the execution order of step S10, step S20 and step S30, as long as the purpose of this application can be achieved.

[0095] It is understood that the definitions of MFS transporter, β-1,3-N-acetylglucosaminyltransferase, β-1,4-galactosyltransferase, galactoside permease and UDP-galactose-4-epimerase are the same as those defined in the first aspect of the present application.

[0096] In some embodiments, the setA gene is knocked out so that the setA transporter protein of the genetically engineered bacteria to be transformed is not expressed or its expression is weakened.

[0097] In some embodiments, the knockout method includes but is not limited to at least one of homologous recombination and CRISPR gene editing.

[0098] The present application does not impose any particular limitation on the method for constructing the expression vector, and any method commonly used in the art, such as double enzyme digestion or homologous recombination, can be used. In the present application, the method for introducing the expression vector into the chassis cells is not particularly limited, as long as the recombinant expression vector can be introduced into the chassis cells. Introduction methods include, but are not limited to, heat shock, electroporation, calcium ion method, and spheroplasting method.

[0099] The third aspect of the present application provides a method for preparing lactose-N-neotetraose, comprising the following steps:

[0100] The genetically engineered bacteria of the first aspect are fermented and cultured to prepare lactose-N-neotetraose.

[0101] It is understandable that the present application does not place any particular limitation on the fermentation culture method and the type of culture medium used for fermentation culture, and any method and culture medium commonly used in the art may be used.

[0102] In some embodiments, the components of the fermentation medium include peptone, yeast extract, (NH4)2SO4, K2HPO4, KH2PO4, glycerol, citric acid, defoaming agent, glucose, MgSO4·7H2O, anhydrous CaCl2, 1000× vitamin B1 and nitrilotriacetic acid.

[0103] The fourth aspect of the present application provides a method for producing a dairy product, comprising the following steps:

[0104] preparing lactose-N-neotetraose by the preparation method of the third aspect; and

[0105] Preparation of dairy products using lactose-N-neotetraose.

[0106] It is understandable that the method for preparing dairy products using lactose-N-neotetraose can be any method commonly used in the art, and this application does not impose any particular limitation thereto.

[0107] The present application will be further described below in conjunction with specific examples and comparative examples, but they should not be construed as limiting the scope of protection of the present application. The raw materials involved in the following specific examples, unless otherwise specified, can all be sourced from commercial sources, the instruments used, unless otherwise specified, can all be sourced from commercial sources, and the processes involved, unless otherwise specified, are all routinely selected by those skilled in the art.

[0108] Example 1:

[0109] (1) Transformation of chassis strains

[0110] Escherichia coli BL21 star (DE3) was selected as the recipient strain, and the lacZ gene, fucIK gene and wcaJ gene in Escherichia coli BL21 star (DE3) were knocked out to obtain the chassis strain BL21 star (DE3) ΔlacZ ΔfucIK ΔwcaJ.

[0111] The detailed steps for knocking out the lacZ gene are as follows:

[0112] (a) A 20-bp sequence with NGG (N is any nucleotide) at the 3' end was selected from the lacZ gene in the Escherichia coli genome as the target site N20 for CRISPR-Cas9 knockout.

[0113] (b) The N20 fragment was inserted into the pGRB vector to obtain the plasmid pGRB-lacZ.

[0114] (c) The recombinant plasmid pGRB-lacZ was transformed into Escherichia coli DH5α using the calcium chloride chemical transformation method. The cells were then plated on LB plates containing ampicillin for screening and culture. After incubation at 37°C overnight, single colonies were picked for colony PCR. Positive clones were expanded in LB liquid culture, plasmids were extracted, and sequencing was performed. The recombinant expression vector with the correct sequencing results was designated as recombinant plasmid pGRB-lacZ.

[0115] (d) Sequences of approximately 300 to 500 bp upstream and downstream of the lacZ gene were taken as knockout homology arms, and after PCR amplification, clean recovery was obtained to obtain the upstream homology arm lacZ-UP (amplified using primers with nucleotide sequences such as SEQ ID NOs: 6 to 7) and the downstream homology arm lacZ-DOWN (amplified using primers with nucleotide sequences such as SEQ ID NOs: 8 to 9).

[0116] SEQ ID NO: 6 (lacZ-UP-F): gcccgagtttgtcagaaagc.

[0117] SEQ ID NO: 7 (lacZ-UP-R): atactgtcgttcaacatcagccgctacagt.

[0118] SEQ ID NO: 8 (lacZ-DOWN-F): ctgatgttgaacgacagtatcggcctcagg.

[0119] SEQ ID NO: 9 (lacZ-DOWN-R): cccaatacgcaaaccgcctc.

[0120] (e) The upstream homology arm lacZ-UP and the downstream homology arm lacZ-DOWN were fused by overlap extension PCR to obtain the homology repair template Homo-lacZ.

[0121] (f) Preparation of knockout chassis electroporation competent cells: pREDCas9 plasmid was introduced into chassis cells BL21 star (DE3) to obtain BL21 star (DE3)-Cas9 cells, and BL21 star (DE3)-Cas9 cells were inoculated into 5 mL of LB liquid medium containing streptomycin resistance and cultured at 30°C and 200 rpm for 16 h. BL21 star (DE3)-Cas9 cells were inoculated into 200 mL of LB liquid medium containing streptomycin resistance at a ratio of 1% (v / v) and cultured until OD 600When the OD reaches 0.1, add 1 mM IPTG and continue to culture until the OD 600 =0.4. Immediately place the cultured bacterial solution in an ice bath for 15 minutes. Collect the cells by centrifugation at 5000 rpm for 10 minutes in a pre-cooled 4°C centrifuge. Rinse the cells with sterile water and resuspend them in 2 mL of pre-cooled 10% glycerol to obtain BL21star(DE3)-Cas9 competent cells.

[0122] (g) Chassis strain lacZ gene knockout: The homologous repair template Homo-lacZ and the recombinant plasmid pGRB-lacZ were introduced into BL21 star(DE3)-Cas9 competent cells, and single clones were selected using plates containing streptomycin and ampicillin. Positive clones were screened by colony PCR and verified using the primer pair with the nucleotide sequences shown in SEQ ID NOs: 10-11.

[0123] SEQ ID NO: 10 (lacZ-yz-F): aacggcgcaaacatcactaac.

[0124] SEQ ID NO: 11 (lacZ-yz-R): gctgttgcccgtctcactgg.

[0125] The fucIK and wcaJ genes were knocked out using the same method as for the lacZ knockout, resulting in the construction of lacZ, fucIK, and wcaJ knockout strains. The specific primer pairs and DNA sequence information used are listed below.

[0126] SEQ ID NO: 12 (fucIK-UP-F): tgtttcggacattgcagctttc.

[0127] SEQ ID NO: 13 (fucIK-UP-R): gtcagttcactcatcaggattcctcatctc.

[0128] SEQ ID NO: 14 (fucIK-DOWN-F): atcctgatgagtgaactgactgaatgccac.

[0129] SEQ ID NO: 15 (fucIK-DOWN-R): gcgctgttctgtagcgtacc.

[0130] SEQ ID NO: 16 (fucIK-yz-F): cacgtcattaagcgccaacactcc.

[0131] SEQ ID NO: 17 (fucIK-yz-R): cggtatgccaacgggtaagc.

[0132] SEQ ID NO: 18 (wcaJ-UP-F): acctgttggtggcgctgattac.

[0133] SEQ ID NO: 19 (wcaJ-UP-R): gaactcgacgctcgaccagttgttgcagattg.

[0134] SEQ ID NO: 20 (wcaJ-DOWN-F): actggtcgagcgtcgagttcgaccttgagt.

[0135] SEQ ID NO: 21 (wcaJ-DOWN-R): ggatcaccacaaacgccagc.

[0136] SEQ ID NO: 22 (wcaJ-yz-F): ccggactatggctggtttgc.

[0137] SEQ ID NO: 23 (wcaJ-yz-R): ccgcgctggtttcgatcatg.

[0138] (2) Transposition integration of lgtA2-lgtB2-vag

[0139] (a) A 32-bp sequence (N32) with a CC end at the 5' end at the yjiP target site on the Escherichia coli genome was selected as a sgRNA. The sgRNA was cloned into the BsaI restriction site of the pSPIN vector to obtain pSPIN-N32.

[0140] (b) The artificially synthesized lgtA2-lgtB2-vag fragment (i.e., the fragment obtained by sequentially connecting the fragments of the nucleotide sequences shown in SEQ ID NO: 2, 3, and 1) was cloned into the XhoI / PstI site of pSPIN-N32 by enzyme digestion and ligation to obtain the transposition integration plasmid pSPIN-N32-lgtA2-lgtB2-vag.

[0141] SEQ ID NO: 1 (vag):

[0142] atgaagagcctgctgacccgtaaacgtcgcattaatccggtgtttctggcctttatggcagcaagctttatgattggcgttgcaggcgcactgcag

[0143] gcaccgaccctgagcctgtttctgacccgtgaagtgcaggcccgtccgctgtgggttggcctgttttttaccgtgaatgccattgcaggtattgtgg

[0144] tgagcatgctggttgccaaacgcagcgatagccgcggcgatcgtcgtaccctgattctgttttgctgcgcaatggcattttgcaatgcactgctgtt

[0145] tgcatttacccgccattatctgaccctgattaccctgggcgtgctgctgagcgcactggcaagcgttagcatgccgcagatttttgccctggcacg

[0146] cgaatatgcagatcagagcgcccgcgaagcagttatgtttagcagtgtgatgcgcgcacagctgagcctggcctgggtgattggtccgccgct

[0147] gagctttgcactggcactgaattttggttttgttaccctgtttctggtggcagcagcactgtttctggtttgcattctgctgattaaatttaccctgccga

[0148] gcgtgccgcgcgccgaacctttaatgcgtagcggcggcatgccgctgagcggctggagagatcgtgatgttcgtctgctgtttattgccagtgtt

[0149] accatgtggacctgcaataccatgtatattattgatatgccgctgtatatcagtgtgaccctgggcctgccggaaaaactggcaggcctgctgatg

[0150] ggcaccgcagccggtctggaaattccggtgatgctgctggcaggtcattatgcaaaacgtgtgggcaaacgtaatctgatgctgattgccgtgg

[0151] cagccggtgttctgttttatgccggcctggccatgtttgccagccagaccgccctgatggccctgcagctgtttaatgcagtgtttattggcattattg

[0152] ccggtattggcatgctgtggtttcaggatctgatgccgggtcgcccgggtgcagccacaaccatgtttaccaatagcattagtaccggtatgattct

[0153] ggcaggcgttattcagggtaccctgagcgaacgctttggtcatattgccgtgtattggctggccctgggtctggcagttgccgcatttgccatgagcgcacgtgttaaaaatgtttaa。

[0154] SEQ ID NO:2(lgtA2):

[0155] atgggcagcagccatcaccatcatcaccacagccaggatccgatgccgagcgaagcctttcgtcgtcatcgtgcatatcgcgaaaataaactgc

[0156] agccgctggtgagcgtgctgatttgtgcatataatgtggaaaaatacttcgcccagagtctggccgccgttgtgaatcagacctggcgtaatctgg

[0157] atattctgattgttgatgatggtagtaccgatggcaccctggccattgcccagcgttttcaggaacaggatggccgtattcgcattctggcacagcc

[0158] gcgtaatagcggtctgattccgagtctgaatattggtctggatgaactggccaaaagcggtggcggcggtgaatatattgcacgcaccgatgcc

[0159] gatgatattgccgccccggattggattgaaaaaattgttggtgaaatggaaaaggatcgtagcattattgccatggggcgcctggctggaagttctg

[0160] agcgaagaaaaagatggtaatcgtctggcccgccatcatgaacatggcaaaatttggaaaaaaccgacccgtcatgaagatattgccgattttttt

[0161] ccgtttggtaatccgattcataataataccatgattatgcgtcgcagcgtgattgatggcggtctgcgctataataccgaacgtgattgggccgaag

[0162] attatcagttttggtatgatgttagcaaactgggtcgcctggcatattatccggaagcactggtgaaatatcgcctgcatgcaaatcaggttagtagt

[0163] aaatatagcattcgtcagcatgaaattgcacagggcattcagaaaaccgcccgcaatgattttctgcagagtatgggctttaaaaacccgctttgata

[0164] gcctggaatatcgccagattaaagccgtggcctatgaactgctggaaaaacatctgccggaaagattttgaacgtgcacgccgttttctgtatc

[0165] agtgctttaaacgtaccgataccctgccggccggcgcctggttagattttgcagcagatggccgtatgcgtcgtctgttttaccctgcgccagtattttggcattctgcatcgcctgctgaaaaatcgctaa。

[0166] SEQ ID NO:3(lgtB2):

[0167] atgcgtgtttttatcatcagcctgaatcagaaagtttgcgatacctttggcctggtgtttcgcgataccaccaccctgctgaataatattaatgccacc

[0168] catcatcaggcacagatttttgatgcaatttatagtaagaccttcgaaggtggtctgcatccgctggtgaaaaaacatctgcatccgtattttattacc

[0169] cagaatattaaggatatgggcattaccaccaatctgattagtgaagttagcaaattttactacgcactgaaatatcatgcaaaatttatgagtctggg

[0170] cgaactgggttgttatgccagccattatagcctgtgggaaaaatgtattgaactgaatgaagccatttgtattctggaagatgatattaccctgaaag

[0171] aagattttaaggaaggcctggattttctggaaaaacatattcaggaactgggctatgtgcgtctgatgcatctgctgtatgatccgaatgttaaaagt

[0172] gaaccgctgaatcataaaaatcatgaaattcaggagcgcgttggcattattaaagcatatagccatggtgttggcacccagggttatgttattaccc

[0173] cgaaaattgcaaaagtttttaagaaacacagccgcaaatgggtggtgccggttgataccattatggatgccacctttattcatggcgttaaaaatct

[0174] ggtgctgcagccgtttgtgattgcagatgatgaacagattagcaccattgcacgtaaagaagaaccgtatagcccgaaaattgccctgatgcgtgaactgcattttaaatatctgaaatactggcagttcgtgtaa.

[0175] (c) Transposition integration: The transposition integration plasmid pSPIN-N32-lgtA2-lgtB2-vag was transformed into the chassis cells obtained in step (1) by electroporation, spread on LB plates containing kanamycin, and cultured at 37°C overnight; transformants were randomly picked for colony PCR verification, and homozygous genotype strains with only integration bands were screened for sequencing verification, and the loss of the transposition plasmid was verified using resistance culture medium.

[0176] (3) Knockout of the setA gene: The setA gene of the chassis cells in step (2) was knocked out using the same method as the lacZ gene knockout in step (1). The specific primer pairs and DNA sequence information used are as follows. The sequence of the knocked-out setA gene is shown in SEQ ID NO:41.

[0177] SEQ ID NO: 24 (setA-UP-F): gtctttaaccgaggcttacgccgatcccag.

[0178] SEQ ID NO: 25 (setA-UP-R): ttaccgcgacagcgaagttg.

[0179] SEQ ID NO: 26 (setA-DOWN-F): aacttcggctgtggctcttc.

[0180] SEQ ID NO: 27 (setA-DOWN-R): cgtaagcctcggttaaagacgtttgatgacgtgg.

[0181] SEQ ID NO: 28 (setA-yz-F): tgttgcagacgagcagatgg.

[0182] SEQ ID NO: 29 (setA-yz-R): cgcagtatcagggcgcttcc.

[0183] SEQ ID NO:30

[0184] tggttggcaaaacgttctgacagtcagggcgatcggcgaaaactgattatattttgctgtttgatggctatcggcaatgcgctattgtttgcatttaatcgtcattatctgacgcttatcacctgtggtgtgcttctggcatctctggccaatacggcaatgccacagttatttgctctggcgcgggaatatgcggataactcggcgcgagaagtggtgatgtttagctcggtgatgcgtgcgcagctttctctggcatgggttatcggtccaccgttggcctttatgctggcgttgaattacggctttacggtgatgttttcgattgccgccgggatattcacactcagtctggtattgattgcatttatgcttccgtctgtggcgcgggtagaactgccgtcggaaaatgctttatcaatgcaaggtggctggcaggatagtaacgtacggatgttatttgtcgcctcgacgttaatgtggacctgcaacaccatgtacattattgatatgccgttgtggatcagtagcgagttaggattgccagacaaactggcgggtttcctgatggggacggcagctggtctggaaataccagcaatgattctggctggctactatgtcaaacgttatggtaagcggcgaatgatggtcatagcagtggcggcaggagtactgttttacaccggattgattttatttcatagccgtctggcgttgatgacgctgcaactttttaacgctgtatttatcggcattgttgcgggtattgggatgctatggtttcaggatttaatgcctggaagagcgggggcagctaccaccttatttactaacagtatttctaccggggtaattctggctggcgttattcagggagcaattgcacaaagttgggggcactttgctgtctactgggtaattgcggttatttctgttatcgcattatttttaaccgcaaa。

[0185] (4) Construction of lacY and galE overexpression plasmids

[0186] (a) The lacY gene was amplified by PCR using the Escherichia coli BL21(DE3) genome as a template (amplification primers are shown in SEQ ID NOs:31-32). The nucleotide sequence of the amplified lacY gene fragment is shown in SEQ ID NO:4. The lacY gene fragment was cloned into the NcoI and HindIII sites of the pETDuet-1 vector to generate the recombinant expression vector pET-lacY.

[0187] SEQ ID NO:4 (lacY gene fragment)

[0188] ctttaagaaggagatataccatggatgtattacctaaaaaacacaaatttttggatgttcggcttgttcttctttttctacttctttatcatgggcgcgtact

[0189] tcccgtttttcccgatttggctgcatgatattaaccacatttccaaatcggacacacggtattatttttgcggcaattagcctcttcagcttgctgttccaa

[0190] ccgctgtttggcctgctgagtgataaactgggcttgcgcaaatatctcctttggattatcaccggtatgctggtgatgttcgctccgttctttatcttcat

[0191] ctttggtccgctgctgcaatataacattctggtaggcagcattgttggtggtatttatttaggttttgcttcaacgctggtgctccggcggtggaagc

[0192] ctttatcgaaaaagttagccgtagaagcaatttcgagttcggccgtgcgcgtatgttcggctgcgtgggctgggcactgtgtgcatccatcgtggg

[0193] tatcatgttcaccataaacaaccagtttgtcttctggctgggttccgggtgcgcacttatcttggcggtgctgctgtttttcgctaaaaccgacgcacc

[0194] gagcagcgcgacggttgcgaatgctgtgggtgcgaatcatagcgcgttttcccttaagttggcgttggagctcttccgccaaccgaagttatggtt

[0195] tctctctctgtacgtgatcggtgtttcttgtacctacgacgtttttgatcagcaatttgcgaacttttttacttccttcttcgccaccggcgagcagggtac

[0196] gcgtgtttttggctatgttaccaccatgggcgaactgttgaatgcgagcatcatgtttttcgcgcctctgatcatcaaccgtattggcggtaaaaacg

[0197] ccttgctgttggcgggtacgatcatgtccgtgcgcatcatcggctcgagctttgcgacttctgcgcttgaggtagttatcctcaagaccctgcacat

[0198] gttcgaggttccgttcctgttggttggttgctttaagtacattacctcgcaatttgaggtgcgttttagtgccacgatttacttggtctgtttctgcttcttc

[0199] aagcagctggctatgattttcatgagcgttctggctggtaacatgtatgaatctattggctttcagggcgcgtacctggtgctgggcttagtggcact

[0200] gggtttcaccctgatcagcgtctttaccctgagcggtccgggtccactgagcctgctgcgtcgccaggttaatgaagtggcctaaaagcttgcggccgcataatg。

[0201] SEQ ID NO:31(lacY-cz-F):ctttaagaaggagatataccatggatgtattacctaaaaaacac。

[0202] SEQ ID NO: 32 (lacY-cz-R): cattatgcggccgcaagcttttaggccacttcattaacctgg.

[0203] (b) Using the artificially synthesized galE gene fragment (nucleotide sequence shown in SEQ ID NO: 5) as a template, amplification was performed using the primer pair shown in SEQ ID NO: 33-34 to obtain the galE fragment; the galE fragment was cloned into the NdeI and AvrⅡ sites of the pET-lacY vector to obtain the recombinant expression vector pET-lacY-galE. The recombinant expression vector pET-lacY-galE was introduced into the chassis cells constructed in step (3).

[0204] SEQ ID NO: 5 (artificially synthesized galE gene fragment)

[0205] gaaggagatatacatatgaacatcctggtgaccggtggcaccggttttattggcagccataccgtggtgagtctgctgaaaagtggccatcaggt

[0206] tgttatctggataatctgtgcaatagcagcattaatattctgccgcgtctgaaaaccattaccggtcaggaaattccgttttatcagggtgatattcgt

[0207] gatcgcgaaattctgcgtcgtatttttgcagaaaatcgcattgatagcgttattcattttgcaggtctgaaagccgtgggcgaaagtgttgccgaacc

[0208] gattaaatattatgataataacgtgagcggcagcctggtgctggcagaagaaatggcccgcgcaggtgtgtttagcattgtgtttagtagtagtgc

[0209] aaccgtgtatggcgatccgggtaaagttccgtataccgaagatatgccgccgggcgataccaccagcccgtatggtgccagcaaaagcatggt

[0210] tgaacgcattctgaccgatattcagaaagcagatccgcgctggagcatgattctgctgcgttattttaatccgattggcgcccatgaaagcggtctg

[0211] attggtgaacagccgaatggcattccgaataatctgctgccgtatatttgccaggttgcagcaggcaaactgccgcagctggcagtttttggtgat

[0212] gattatccgaccccggatggcaccggtatgcgtgattatattcatgtgatggatctggccgaaggccatgttgccgcaatgcaggccaaaagtaa

[0213] tgttgcaggtacccatctgctgaatctgggtagtggtcgcgccagcagtgttctggaaattattcgtgcatttgaagcagccagcggcctgaccatt

[0214] ccgtttgaaattaaaccgcgccgcgccggcgatctggcctgtttttatgccgatccgagttataccaaagcacagattggttggcagacccagcgtgatctgacccagatgatggaagatagttggcgctgggttagcaatcatccgaatggttatgatgattaacctaggctgctgccaccg.

[0215] SEQ ID NO: 33 (galE-cz-F): gaaggagatatacatatgaacatcctggtgaccggtg.

[0216] SEQ ID NO: 34 (galE-cz-R): cggtggcagcagcctaggttaatcatcataaccattcgg.

[0217] The genetically engineered bacteria finally constructed in this example contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector and the pET-lacY-galE expression vector, and the setA gene, lacZ gene, fucIK gene and wcaJ gene in the chassis strain are knocked out.

[0218] (5) Fermentation yield verification

[0219] (a) The constructed genetically engineered bacteria were inoculated into LB medium for activation culture to obtain seed liquid.

[0220] (b) transferring the seed solution obtained in step (a) into a fermentation tank containing fermentation medium, with an initial culture temperature of 37° C., a rotation speed of 250 rpm, a ventilation volume of 35 NL / min, a tank pressure of 0.06 MPa, and controlling the dissolved oxygen content to be greater than 2 mg / L.

[0221] The fermentation medium formula includes: 150 g peptone, 50 g yeast extract powder, 100 g (NH4)2SO4, 230 g K2HPO4, 205 g KH2PO4, 250 g glycerol, 7.5 g citric acid, 5 mL defoamer, 250 g glucose, 50 g MgSO4·7H2O, 0.5 g anhydrous CaCl2, 25 mL 1000× vitamin B1, 250 mL nitrilotriacetic acid, and ddH2O to 20 L; the pH value is 6.8.

[0222] (c) After the initial glycerol content in the fermentation culture was completely consumed, glycerol was added to the fermentor at a rate of 3.4 g / L / h. The culture temperature was 30°C.

[0223] (d) After the carbon source in the base material is consumed and the dissolved oxygen rises, the carbon source is replenished. Four hours after the carbon source replenishment, the inducer IPTG is added, and lactose is fed. The lactose content and consumption are monitored to control the lactose content in the fermentation broth to 10 g / L to 20 g / L.

[0224] (e) The production of LNnT and the residual amount of LNT II in the fermenter after 112 h of cultivation were determined by HPLC. The results are shown in Table 1. The specific detection parameters and methods are as follows.

[0225] Reagents: sulfuric acid (chromatographic grade), pure water.

[0226] Instrument: High performance liquid chromatography with differential index detector (HPLC-RID).

[0227] Liquid phase conditions: Bio-Rad column ( HPX-87H chromatographic column, 4.6×250mm, 5-Micron), column temperature was 60℃, 5mmol sulfuric acid aqueous solution was used as mobile phase for isocratic elution, running time was 20min, flow rate was 0.5mL / min, detector temperature was 40℃, and injection volume was 20μL.

[0228] Preparation of standard solution: Accurately weigh 50 mg (accurate to 0.1 mg) of LNnT / LNTⅡ standard into a 50 mL volumetric flask, dilute to volume with purified water, and shake well. Use a pipette to pipette 4 μL, 20 μL, 100 μL, 500 μL, and 1000 μL of the standard into 1.5 mL injection vials, respectively. Then, add 996 μL, 980 μL, 900 μL, 500 μL, and 0 μL of purified water to the corresponding injection vials, respectively. Mix thoroughly and load onto the analyzer. The corresponding standard curve range is 4 μg / mL to 1000 μg / mL.

[0229] Sample preparation: Centrifuge 10 ml of fermentation broth at 12,000 rpm for 15 minutes and collect the supernatant. Dilute the supernatant with pure water to within the standard curve range. Pass the mixed sample through a 0.22 μm water filter before testing.

[0230] Example 2:

[0231] Compared with the genetically engineered bacteria constructed in Example 1, the genetically engineered bacteria constructed in this example further comprise an lgtB overexpression vector. The construction and introduction methods of the lgtB overexpression vector are as follows:

[0232] An artificially synthesized lgtB gene fragment (shown in SEQ ID NO: 3) was used as a template and the primer pair shown in SEQ ID NO: 35-36 was used to amplify the lgtB fragment. The lgtB fragment was cloned into the NcoI and AvrⅡ sites of the vector pCDFDuet-1 to obtain the recombinant expression vector pCDFDuet-lgtB.

[0233] SEQ ID NO: 35 (lgtB-cz-F): ctttaataaggagatataccatgcgtgtttttatcatcagcc.

[0234] SEQ ID NO: 36 (lgtB-cz-R): cggtggcagcagcctaggttacacgaactgccagtatttc.

[0235] The genetically engineered bacteria finally constructed in this example contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector, the pET-lacY-galE expression vector, and the pCDFDuet-lgtB overexpression vector, and the setA gene, lacZ gene, fucIK gene, and wcaJ gene are knocked out in the chassis strain.

[0236] Example 3:

[0237] Compared with the genetically engineered bacteria constructed in Example 1, the only difference is that the chassis cells are different. Specifically, the chassis cells used in this example are BL21 star (DE3) ΔnagB ΔwecB ΔlacZ. The modification method of BL21 star (DE3) ΔnagB ΔwecB ΔlacZ refers to step (1) of the example, wherein the knockout steps of the nagB and wecB genes refer to the lacZ gene. The specific primer pairs and DNA sequence information used are as follows.

[0238] SEQ ID NO: 37 (nagB-UP-F): accatgatcgcttttggatgctgaacgcattgatacgattg.

[0239] SEQ ID NO: 38 (nagB-UP-R):cctgggcaataaacgcaac.

[0240] SEQ ID NO: 39 (nagB-DOWN-F): gcctgattcggatgttttgc.

[0241] SEQ ID NO: 40 (nagB-DOWN-R): caatcgtatcaatgcgttcagcatccaaaagcgatcatggt.

[0242] SEQ ID NO: 41 (nagB-yz-F): cggaccaacggttataggct.

[0243] SEQ ID NO: 42 (nagB-yz-R): gccagggtcactttggtaatg.

[0244] SEQ ID NO: 43 (wecB-UP-F): cctgaccatcaccatacgggcccttccagaatccgacag.

[0245] SEQ ID NO: 44 (wecB-UP-R): gtccaatgctccaggctcg.

[0246] SEQ ID NO: 45 (wecB-DOWN-F): cggcgtcataccaccaatc.

[0247] SEQ ID NO: 46 (wecB-DOWN-R): ctgtcggattctggaagggcccgtatggtgatggtcagg.

[0248] SEQ ID NO: 47 (wecB-yz-F): ccgccggatgaacagtattg.

[0249] SEQ ID NO: 48 (wecB-yz-R): aggcgaatcagttcccagac.

[0250] The genetically engineered bacteria finally constructed in this example contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector and the pET-lacY-galE expression vector, and the setA gene, lacZ gene, nagB gene, and wecB gene in the chassis strain are knocked out.

[0251] Example 4:

[0252] Compared with the genetically engineered bacteria constructed in Example 1, the only difference is that the chassis cells are different. Specifically, the chassis cells used in this example are unmodified BL21 star (DE3).

[0253] The genetically engineered bacteria finally constructed in this example contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector and the pET-lacY-galE expression vector, and the setA gene in the chassis strain is knocked out.

[0254] Comparative Example 1:

[0255] Compared with the genetically engineered bacteria constructed in Example 2, the only difference is that the setA gene is not knocked out in the chassis strain.

[0256] The genetically engineered bacteria finally constructed in this comparative example contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector, the pET-lacY-galE expression vector and the pCDFDuet-lgtB overexpression vector, and the lacZ gene, the fucIK gene and the wcaJ gene in the chassis strain are knocked out.

[0257] Comparative Example 2:

[0258] Compared with the genetically engineered bacteria constructed in Example 2, the only difference is that the pET-lacY-galE expression vector is replaced by the pET-lacY expression vector; the specific construction method is referred to Example 1.

[0259] The genetically engineered bacteria finally constructed in this comparative example contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector, the pET-lacY expression vector, and the pCDFDuet-lgtB overexpression vector, and the setA gene, lacZ gene, fucIK gene, and wcaJ gene in the chassis strain are knocked out.

[0260] Comparative Example 3:

[0261] In the genetically engineered bacteria constructed in this comparative example, the chassis cells were untransformed Escherichia coli BL21 star (DE3); and the genetically engineered bacteria with transposition-integrated lgtA2-lgtB2 were constructed according to the method described in step (3) of Example 1.

[0262] The genetically engineered bacteria finally constructed in this comparative example only contain the pSPIN-N32-lgtA2-lgtB2 integration vector.

[0263] Comparative Example 4:

[0264] In the genetically engineered bacteria constructed in this comparative example, the chassis cells are untransformed Escherichia coli BL21 star (DE3); the genetically engineered bacteria with transposition-integrated lgtA2-lgtB2-vag were constructed according to the method described in step (3) of Example 1.

[0265] The genetically engineered bacteria finally constructed in this comparative example only contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector.

[0266] Comparative Example 5:

[0267] Compared with the genetically engineered bacteria constructed in Example 1, the only difference is that the pSPIN-N32-lgtA2-lgtB2-vag integration vector is replaced by the pSPIN-N32-lgtA2-lgtB2 integration vector; the specific construction method refers to Example 1.

[0268] The genetically engineered bacteria finally constructed in this comparative example contain the pSPIN-N32-lgtA2-lgtB2 integration vector and the pET-lacY-galE expression vector, and the setA gene, lacZ gene, fucIK gene and wcaJ gene in the chassis strain are knocked out.

[0269] Comparative Example 6:

[0270] Compared with the genetically engineered bacteria constructed in Example 1, the only difference is that the pET-lacY-galE expression vector is replaced by the pET-lacY expression vector; the specific construction method is referred to Example 1.

[0271] The genetically engineered bacteria finally constructed in this comparative example contain the pSPIN-N32-lgtA2-lgtB2 integration vector and the pET-lacY expression vector, and the setA gene, lacZ gene, fucIK gene and wcaJ gene in the chassis strain are knocked out.

[0272] The final product yield and intermediate product residue of the genetically engineered bacteria constructed in Examples 1 to 4 and Comparative Examples 1 to 6 were detected according to the method described in step (5) of Example 1. The results are shown in Table 1.

[0273] Table 1

[0274]

[0275]

[0276] The genetically engineered bacteria constructed in Comparative Example 1 differed only from those constructed in Example 2 in that the setA gene was not deleted. When these genetically engineered bacteria were used for LNnT fermentation, the LNnT fermentation yield in Comparative Example 1 decreased, and the residual LNT II content significantly increased. Comparative Examples 2 and 6, which did not overexpress galE, resulted in a decreased LNnT fermentation yield and a significant increase in the residual LNT II content. Comparative Example 3, which did not overexpress galE and lacY, did not contain vag, and did not undergo any modification to the chassis strain, resulted in a significant decrease in LNnT fermentation yield. Comparative Example 4, which did not overexpress galE and lacY, and did not undergo any modification to the chassis strain, resulted in a significant decrease in LNnT fermentation yield and a significant increase in the residual LNT II content. Comparative Example 5, which did not contain vag protein, resulted in a significant decrease in LNnT fermentation yield and a significant increase in the residual LNT II content.

[0277] As shown in Table 1 above, the genetically engineered bacteria constructed in Examples 1 to 4 of the present application, while overexpressing the galE gene, knocked out the setA gene, which significantly increased the fermentation yield and fermentation rate of LNnT and reduced the residual amount of LNT II in the final product.

[0278] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0279] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art may make various modifications and improvements without departing from the spirit of the present application, and these modifications and improvements fall within the scope of protection of the present application. Therefore, the scope of protection of the present application shall be determined by the appended claims.

Claims

1. A genetically engineered bacterium for producing lactose-N-neotetraose, characterized in that: The genetically engineered bacteria meet the following conditions: (1) Exogenous expression of MFS transporter, β-1,3-N-acetylglucosamine transferase, and β-1,4-galactosyltransferase; (2) overexpression of galactoside permease and UDP-galactose-4-epimerase; and (3) The setA transporter protein is not expressed or its expression is weakened.

2. The genetically engineered bacteria for producing lactose-N-neotetraose according to claim 1, characterized in that: The setA transporter protein is not expressed or its expression is weakened by knocking out the setA gene.

3. The genetically engineered bacteria for producing lactose-N-neotetraose according to claim 1, characterized in that: The knockout method includes at least one of homologous recombination and CRISPR gene editing.

4. The genetically engineered bacteria for producing lactose-N-neotetraose according to claim 1, characterized in that: The MFS transporter protein includes at least one of bad protein, fred protein, nec protein, marc protein and vag protein.

5. The genetically engineered bacteria for producing lactose-N-neotetraose according to claim 4, characterized in that: The genetically engineered bacteria meets at least one of the following conditions (1) to (5): (1) The nucleotide sequence encoding the vag protein is shown in SEQ ID NO: 1; (2) The nucleotide sequence encoding the β-1,3-N-acetylglucosamine transferase is shown in SEQ ID NO: 2; (3) The nucleotide sequence encoding the β-1,4-galactosyltransferase is shown in SEQ ID NO: 3; (4) the gene encoding the galactoside permease is the lacY gene, and the nucleotide sequence encoding the galactoside permease is shown in SEQ ID NO: 4; and (5) The gene encoding the UDP-galactose-4-epimerase is the galE gene, and the nucleotide sequence encoding the UDP-galactose-4-epimerase is shown in SEQ ID NO:

5.

6. The genetically engineered bacteria for producing lactose-N-neotetraose according to any one of claims 1 to 5, characterized in that: The genetically engineered bacteria include bacteria; Optionally, the bacteria include at least one of Escherichia coli and Bacillus subtilis; Further optionally, the Escherichia coli includes Escherichia coli BL21 (DE3).

7. The genetically engineered bacteria for producing lactose-N-neotetraose according to any one of claims 1 to 5, characterized in that: The genetically engineered bacteria contain at least one of the wcaJ gene, the lacZ gene, the fucIK gene, the nagB gene and the wecB gene which is inactivated or deleted; Optionally, the genetically engineered bacteria contain inactivated or deleted wcaJ gene, lacZ gene and fucIK gene; Optionally, the genetically engineered bacteria contain inactivated or deleted nagB gene, wecB gene and lacZ gene.

8. The method for constructing a genetically engineered bacterium for producing lactose-N-neotetraose according to any one of claims 1 to 7, characterized in that: The steps include: The integration vector expressing the MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyl transferase is introduced into the genetically engineered bacteria to be transformed; making the setA transporter protein of the genetically engineered bacteria to be transformed not expressed or attenuated; and The recombinant vector over-expressing galactoside permease and UDP-galactose-4-epimerase is introduced into the genetic engineering bacteria to be transformed to construct the genetic engineering bacteria producing lactose-N-neotetraose.

9. A method for preparing lactose-N-neotetraose, characterized in that: The steps include: The genetically engineered bacteria according to any one of claims 1 to 7 are fermented and cultured to prepare lactose-N-neotetraose.

10. A method for producing a dairy product, characterized in that: The steps include: Using the preparation method of claim 9 to prepare lactose-N-neotetraose; and A dairy product is prepared using the lactose-N-neotetraose.

Images