Escherichia coli engineering bacterium for producing astaxanthin by using yhaK gene as well as construction method and application of escherichia coli engineering bacterium

Abstract

The invention provides an Escherichia coli engineering bacterium for improving the yield of astaxanthin by using yhaK as well as a construction method and application of the Escherichia coli engineering bacterium. The engineering bacterium comprises a recombinant plasmid containing a yhaK gene, a crtS gene for coding astaxanthin synthetase, a crtR gene for coding cytochrome reductase, a crtYB gene for coding lycopene cyclase and a gene segment for coding farnesyl / geranyl pyrophosphate synthase IspA, the escherichia coli engineering strain ELZSS02 E.coli Bl21 (DE3): pTrc low-MvaE-MvaS / pET-RPlyc-crtS / pACYC-crtR-crtYB-IspA-yhaK is finally obtained, compared with wild escherichia coli, the expression quantity of MEP pathway genes in the engineering strain is remarkably increased, the yield of astaxanthin is also remarkably increased, and the escherichia coli engineering strain has good application value.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and molecular biology, and specifically relates to an astaxanthin-producing Escherichia coli engineering bacterium constructed by seamless cloning, and a construction method and application thereof. Background Art

[0002] Astaxanthin is a powerful antioxidant whose antioxidant activity far exceeds that of common antioxidants such as vitamin C and vitamin E.

[0003] This property makes astaxanthin play an important role in resisting oxidative stress and protecting cell health.

[0004] In addition to its antioxidant properties, astaxanthin also has multiple biological activities such as anti-inflammatory, anti-cancer, and immunity enhancement.

[0005] These activities make astaxanthin have broad application prospects in the fields of medicine, health care products, cosmetics, etc.

[0006] For example, astaxanthin can inhibit tumor occurrence, enhance immunity, and eliminate free radicals in the body. With the advancement of technology and the growth of market demand, the astaxanthin industry is showing a rapid development trend.

[0007] Microorganisms synthesize astaxanthin mainly through the MEP pathway, which is a metabolic pathway that uses pyruvate and 3-phosphoglyceraldehyde as raw materials and synthesizes isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) through a series of enzymatic reactions.

[0008] These products are precursors for the biosynthesis of isoprenoids and their derivatives (such as carotenoids, astaxanthin, etc.).

[0009] Currently, no genes regulating the MEP pathway have been reported.

[0010] The specific biological function of the Pirin-like protein YhaK encoded by the yhaK gene has not yet been fully clarified.

[0011] However, since the Pirin protein family is usually associated with a variety of biological processes, such as cell metabolism, redox reactions, etc., it can be speculated that yhaK protein may also play an important role in this MEP pathway. Summary of the invention

[0012] The invention provides an astaxanthin-producing Escherichia coli engineering bacterium utilizing yhaK and a construction method and application thereof.

[0013] The invention improves the yield of astaxanthin produced by Escherichia coli fermentation by overexpressing gene yhaK, astaxanthin operon lyc, crtS gene encoding astaxanthin synthase, crtR gene encoding cytochrome reductase, crtYB gene encoding lycopene cyclase and gene fragment encoding farnesyl / geranyl pyrophosphate synthase IspA.

[0014] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions: Furthermore, an Escherichia coli with high astaxanthin production is provided, characterized in that the engineered Escherichia coli is constructed from an expression vector containing a carotenoid operon gene fragment and a gene fragment encoding astaxanthin synthase, a gene fragment encoding cytochrome reductase, a gene fragment encoding lycopene cyclase and an expression vector of the yhaK gene.

[0015] Furthermore, the engineered Escherichia coli is characterized in that the carotenoid operon gene fragment is a lyc gene fragment with a nucleotide sequence as shown in SEQ ID NO.1, which comes from Rhodopseudomonas palustris.

[0016] Furthermore, the engineered Escherichia coli is characterized in that the gene fragment encoding astaxanthin synthase is a crtS gene fragment with a nucleotide sequence as shown in SEQ ID NO.2, which comes from Escherichia coli.

[0017] Furthermore, the engineered Escherichia coli is characterized in that the gene fragment encoding cytochrome reductase is a gene fragment of crtR with a nucleotide sequence as shown in SEQ ID NO.3, which comes from Phaffia rhodozyma.

[0018] Furthermore, the engineered Escherichia coli is characterized in that the gene fragment encoding lycopene cyclase is a gene fragment of crtYB with a nucleotide sequence as shown in SEQ ID NO.4, which is derived from Phaffia rhodozyma.

[0019] Furthermore, the engineered Escherichia coli is characterized in that the expression vector also includes a gene fragment IspA encoding farnesyl / geranyl pyrophosphate synthase, which is derived from Phaffia rhodozyma.

[0020] Furthermore, the engineered Escherichia coli is characterized in that the gene fragment of yhaK is a nucleotide sequence as shown in SEQ ID NO.5, which is derived from Escherichia coli.

[0021] Furthermore, the method for constructing the Escherichia coli engineered bacteria is characterized by comprising the following steps: (1) After amplifying the gene fragment crtS encoding astaxanthin synthase, it was ligated with the recombinant plasmid pET-RPlyc (cited from patent application number 202110912377.4) fragment, and the ligation product was transformed into competent cells. After resistance screening and positive cloning, the recombinant plasmid pET-RPlyc-crtS was obtained.

[0022] (2) Amplify the gene fragment crtR encoding cytochrome reductase, the gene fragment crtYB encoding lycopene cyclase, and the gene fragment IspA encoding farnesyl / geranyl pyrophosphate synthase, overlap and connect the three, transform the ligation product into competent cells, and obtain the recombinant plasmid pACYC-crtR-crtYB-IspA after resistance screening and positive cloning.

[0023] (3) The amplified gene fragment yhaK was ligated with the pACYC-crtR-crtYB-IspA plasmid fragment. The ligation product was transformed into competent cells. After resistance screening and positive cloning, the recombinant plasmid pACYC-crtR-crtYB-IspA-yhaK was obtained.

[0024] (4) The recombinant plasmids pET-RPlyc-crtS and pACYC-crtR-crtYB-IspA were co-transformed into competent E. coli cells containing the pTrc-low-MvaE-MvaS plasmid to obtain the E. coli engineered strain ELZSS01; Alternatively, the recombinant plasmids pET-RPlyc-crtS and pACYC-crtR-crtYB-IspA-yhaK are co-transformed into competent E. coli cells containing the pTrc-low-MvaE-MvaS plasmid to obtain the E. coli engineering strain ELZSS02.

[0025] Furthermore, the engineered E. coli strain is characterized in that the yhaK gene has a positive regulatory effect on the MEP pathway.

[0026] Furthermore, the engineered Escherichia coli is used to synthesize and / or increase the yield of astaxanthin.

[0027] Furthermore, the application is characterized in that the steps of using Escherichia coli in synthesizing astaxanthin are as follows: the engineered strains ELZSS01 and ELZSS02 are cultured overnight in LB liquid medium (chloramphenicol kanamycin resistance) and then transferred to ZYM induction medium for 13 h, the cells are collected, resuspended with M9 transformation liquid, 3 mL of the cells are transformed at 30°C for 24 h, and the OD is measured. 600 , take 1 mL of the bacteria and extract with 1 mL of anhydrous ethanol for 4 h, then take the supernatant and filter it into a chromatographic vial for HPLC detection.

[0028] Furthermore, the application is characterized in that the method for detecting the astaxanthin production is HPLC, and the conditions are as follows: the HPLC detector is (ShimadzuHPLC, System Model LC-20A, the chromatographic column is ZORBAXSB-C18 3.5 μm, 4.6x150 mm, Agilent, USA), the mobile phase A is methanol, the mobile phase B is ethyl acetate, and the analysis time for each sample is 16 minutes. From 0 to 10 minutes, the concentration of mobile phase B increases from 0 to 40% at a rate of 3% per minute, and from 10 to 16 minutes, the concentration of mobile phase B is always controlled at 0, and the total flow rate is 1 mL / min. UV: 475 nm.

[0029] Compared with the prior art, the present invention has the following advantages and beneficial effects: The present invention utilizes the transcription factor yhaK to increase the expression of MEP pathway genes, and can further increase the astaxanthin production, thereby providing a new idea for fermentation production of astaxanthin, which has practical application significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the plasmid map of the suicide plasmid pRE112-ykgH-MvaES.

[0031] Figure 2 This is the plasmid map of the overexpression vector pET-RPlyc-crtS.

[0032] Figure 3 This is the plasmid map of the suicide plasmid pRE112-ΔyhaK.

[0033] Figure 4 This is the plasmid map of the overexpression vector pACYC-yhaK.

[0034] Figure 5 This is the regulatory effect of yhaK on genes related to the MEP pathway.

[0035] Figure 6 This is the plasmid map of the overexpression vector pACYC-crtR-crtYB-IspA.

[0036] Figure 7 This is the plasmid map of the overexpression vector pACYC-crtR-crtYB-IspA-yhaK.

[0037] Figure 8 These are the results of astaxanthin production by engineered Escherichia coli strains. DETAILED DESCRIPTION

[0038] The present invention is further described below in conjunction with specific embodiments, but the present invention is not limited by the embodiments.

[0039] If no specific techniques or conditions are specified in the examples, the process is carried out according to the techniques described in the literature in the art or according to the product instructions.

[0040] The reagents or instruments used without indicating the manufacturer are all common products that can be purchased.

[0041] Example 1: Strains E. coli Construction of BL21(DE3)::pTrc low-MvaE-MvaS (1) Using the Enterococcus faecalis genome as a template, primers MvaES-R and MvaES-F were used to amplify the MvaE and MvaS fragments by polymerase chain reaction (PCR).

[0042] The PCR amplification system is as follows: template 100 ng MvaES-R 0.5 μM MvaES-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 60ºC for 15 s, 72ºC for 1 min 40 s); 72ºC for 5 min; 16 ºC ∞.

[0043] The primer sequences are as follows: MvaES-R:5'-CATGCTTCATATTTAGTTTCGATAAGAGCGAACGGTATT -3'; MvaES-F:5'-ACTCACTATAGGGCCCCTGTAGAAATAATTTTGTTTAACTTTAATAAGG -3'; (2) Using the E. coli genome as a template, primers ykgH-up-F and primer ykgH-up-R were used to amplify the ykgH fragment by PCR reaction.

[0044] The PCR amplification system is as follows: template 100 ng ykgH-up-R 0.5 μM ykgH-up-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 65ºC for 15 s, 72ºC for 1 min); 72ºC for 5 min; 16 ºC ∞.

[0045] The primer sequences are as follows: ykgH-up-F:5'-TCTTCCGGAGACTGTCATACGCGTGGTTATGCTGCTCTTCTGTAAATATCCT -3'; ykgH-up-R:5'-CTACAGGGGCCCTATAGTGAGTCGTATTACCAGTATTCATGATGCGGGC -3'; (3) Using the E. coli genome as a template, primers ykgH-down-R and primer ykgH-down-F were used to amplify the ykgH downstream fragment by PCR reaction.

[0046] The PCR amplification system is as follows: template 100 ng ykgH-down-R 0.5 μM ykgH-down-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 65ºC for 15 s, 60ºC for 1 min); 72ºC for 5 min; 16 ºC ∞.

[0047] The primer sequences are as follows: ykgH-up-F:5'-TCTTCCGGAGACTGTCATACGCGTGGTTATGCTGCTCTTCTGTAAATATCCT -3'; ykgH-up-R:5'-CTACAGGGGCCCTATAGTGAGTCGTATTACCAGTATTCATGATGCGGGC -3'; (4) Using the amplified yhaK upstream and downstream fragments and mvaES fragment as templates and ykgH-down-R and ykgH-up-F as primers, overlapping fragments were obtained by overlapping PCR amplification.

[0048] ykgH upstream fragment 100 ng ykgH downstream fragment 100 ng mvaES fragment 100ng ykgH-down-R 0.5 μM ykgH-up-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC 3 min; 30 cycles × (95ºC 15 s, 65ºC 15 s, 72ºC 2 min20 s); 72ºC 5 min; 16 ºC ∞.

[0049] (5) Using the pRE112 plasmid as a template and primers pRE112-F and pRE112-R, a PCR reaction was performed to amplify the vector. The base sequence of the pRE112 vector is shown in SEQ ID NO.8.

[0050] The PCR amplification system is as follows: template 100 ng pRE112-R 0.5 μM pRE112-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 62ºC for 15 s, 72ºC for 1 min 20 s); 72ºC for 5 min; 16 ºC ∞.

[0051] The primer sequences are as follows: pRE112-F:5'- GGTACCTCTAGAAGAAGCTTGG -3'; pRE112-R:5'- GAGCTCTCCCGGGAATTCAT -3'; (6) PCR products were connected by seamless cloning using 2×Clon Express Mix (Vazyme, Catalog No. C115). The system is as follows: pRE112 vector 0.03 pmol ykgHmvaES overlapping fragment 0.06 pmol 2×Clon Express Mix 5 μL Ultrapure water Make up to 10 μL The system was incubated at 50 ºC for 30 min.

[0052] The product was transformed into competent cells and spread onto LB solid plates containing 50 mg / L chloramphenicol. Positive clones were screened by PCR, and the recombinant plasmid pRE112-ykgH-mvaES ( Figure 1 ), transformed into BL21(DE3)::pTrc low by conjugative transfer (cited from Cheng Tao, Guang Zhao, Mo Xian, Congxia Xie. Improvedcis-Abienol production through increasing precursor supply in Escherichiacoli. Scientific Reports, 2020, 10, 16791), PCR screening of positive clones, so far BL21(DE3)::pTrc low-MvaES has been constructed, use the competent cell preparation kit (Takara, cat. no. 9139) to prepare competent cells.

[0053] Example 2: Construction of pET-RPlyc-crtS expression vector (1) Using the rhodotorula genome as a template, primers crtS-F and crtS-R were used to amplify the crtS fragment by PCR.

[0054] The PCR amplification system is as follows: template 100 ng crtS-F 0.5 μM crtS-R 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 60ºC for 15 s, 72ºC for 2 min); 72ºC for 5 min; 16 ºC ∞.

[0055] The primer sequences are as follows: crtS-F:5'-CCCGCTTTACTGCCACTCACCATATGTTTATTCTGGTGCTGCTGACCGG-3'; crtS-R: 5'-GGTCGCGGATCCGAATTCCACCGGTTTCACTTGCAGGCGC-3'; (2) Using pET-Rplyc plasmid as template, primers lyc-F and lyc-R were used to amplify the linear vector by PCR.

[0056] The PCR amplification system is as follows: template 100 ng lyc-F 0.5 μM lyc-R 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 60ºC for 15 s, 72ºC for 10 min); 72ºC for 5 min; 16 ºC ∞.

[0057] The primer sequences are as follows: lyc-F:5'-GAATTCGGATCCGCGACCCATTTG-3'; lyc-R:5'-ATGGGTGAGTGGCAGTAAAGCGGG -3'; (3) PCR products were connected by seamless cloning using 2×Clon Express Mix (Vazyme, Catalog No. C115). The system is as follows: pET-Rplyc linearized vector 0.03 pmol crtS fragment 0.06 pmol 2×Clon Express Mix 5 μL Ultrapure water Make up to 10 μL The system was incubated at 50°C for 30 min.

[0058] The product was transformed into competent cells and plated on LB solid plates containing kanamycin. Positive clones were screened by PCR, and the recombinant plasmid pET-RPlyc-crtS ( Figure 2 ).

[0059] Example 3: Construction of BL21(DE3)ΔyhaK (1) Using the Escherichia coli genome as a template, primers yhaK-down-R and primer yhaK-down-F were used to amplify the yhaK downstream fragment by polymerase chain reaction (PCR). The base sequence of the yhaK downstream fragment is shown in SEQ ID NO.8.

[0060] The PCR amplification system is as follows: template 100 ng yhaK-down-R 0.5 μM yhaK-down-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 60ºC for 15 s, 72ºC for 1 min); 72ºC for 5 min; 16 ºC ∞.

[0061] The primer sequences are as follows: yhaK-down-F:5'-CAAGAATTATGTAGTTGTTTTTACAGGGAGATGATGA-3'; yhaK-down-R:5'-AAGCTTCTTCTAGAGGTACCCCATTGTGATTCGTACCAGC-3'; (2) Using the Escherichia coli genome as a template, primers yhaK-up-F and primers yhaK-up-R were used to perform a PCR reaction to amplify the yhaK upstream fragment. The base sequence of the yhaK upstream fragment is shown in SEQ ID NO.9.

[0062] The PCR amplification system is as follows: template 100 ng yhaK-up-R 0.5 μM yhaK-up-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 62ºC for 15 s, 72ºC for 1 min 20 s); 72ºC for 5 min; 16 ºC ∞.

[0063] The primer sequences are as follows: yhaK-up-F:5'-ATGAATTCCCGGGAGAGCTCTTCGACCATAGGATACGGCA-3'; yhaK-up-R:5'-AACAACTACATAATTCTTGACCTCTCTTTACTTCC-3'; (3) Using the amplified upstream and downstream fragments of yhaK as templates and yhaK-down-R and yhaK-up-F as primers, overlapping fragments were obtained by overlapping PCR amplification.

[0064] yhaK upstream fragment 100 ng yhaK downstream fragment 100 ng yhaK-up-F 0.5 μM yhaK-down-R 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 65ºC for 15 s, 72ºC for 1 min); 72ºC for 5 min; 16 ºC ∞.

[0065] (4) Using the pRE112 plasmid as a template and primers pRE112-F and pRE112-R, perform PCR reaction to amplify the vector.

[0066] The PCR amplification system is as follows: template 100 ng pRE112-R 0.5 μM pRE112-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 62ºC for 15 s, 72ºC for 1 min 20 s); 72ºC for 5 min; 16 ºC for ∞ The primer sequences are as follows: pRE112-F:5'- GGTACCTCTAGAAGAAGCTTGG -3'; pRE112-R:5'- GAGCTCTCCCGGGAATTCAT -3'; (5) PCR products were connected by seamless cloning using 2×Clon Express Mix (Vazyme, Catalog No. C115). The system is as follows: pRE112 vector 0.03 pmol yhaK upstream and downstream overlapping fragments 0.06 pmol 2×Clon Express Mix 5 μL Ultrapure water Make up to 10 μL The system was incubated at 50 ºC for 30 min.

[0067] The product was transformed into competent cells and spread onto LB solid plates containing 50 mg / L chloramphenicol. Positive clones were screened by PCR, and the recombinant plasmid pRE112-ΔyhaK ( Figure 3 ), the recombinant plasmid was transformed into BL21(DE3) competent cells, and positive clones were screened by PCR. At this point, BL21(DE3)ΔyhaK was constructed.

[0068] Example 4: Construction of BL21(DE3)-yhaK (1) Using the Escherichia coli genome as a template, primers yhaK-R and yhaK-F were used to amplify the yhaK gene fragment by polymerase chain reaction (PCR).

[0069] The PCR amplification system is as follows: template 100 ng yhaK-R 0.5 μM yhaK-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 60ºC for 15 s, 72ºC for 1 min); 72ºC for 5 min; 16 ºC ∞.

[0070] The primer sequences are as follows: yhaK-F:5'- GAAGGAGATATACATATGCTAGACAGGCAAATCTATCAGCAAAGC-3'; yhaK-R: 5'-GTAAAGAGAGGTCAAGAATTATGATTACTACCCGAACT-3'; (2) Using the pACYC-Duet plasmid as a template, primers pACYC-R and primers pACYC-F, perform polymerase chain reaction (PCR) to amplify the expression vector. The PCR amplification system is as follows: template 100 ng pACYC-R 0.5 μM pACYC-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 60ºC for 15 s, 72ºC for 5 min); 72ºC for 5 min; 16 ºC ∞.

[0071] The primer sequences are as follows: pACYC-F:5'- AATTCTTGACCTCTCTTTACTTCCTTTTATGGTA -3'; pACYC-R: 5'-CATATGTATATCTCCTTCTTATACTTAACTAATATACTAAGATGGGG -3'; (3) PCR products were connected by seamless cloning using 2×Clon Express Mix (Vazyme, Catalog No. C115). The system is as follows: pACYC vector 0.03 pmol yhaK fragment 0.06 pmol 2×Clon Express Mix 5 μL Ultrapure water Make up to 10 μL The system was incubated at 50 ºC for 30 min.

[0072] The product was transformed into competent cells and spread onto LB solid plates containing 50 mg / L chloramphenicol. Positive clones were screened by PCR, and the recombinant plasmid pACYC-yhaK ( Figure 4 ), the recombinant plasmid was transformed into BL21(DE3) competent cells, and positive clones were screened by PCR. Thus, BL21(DE3)-yhaK was constructed.

[0073] Example 5: Analysis of the regulation of MEP pathway gene expression in engineered bacteria by yhaK RNA extraction, reverse transcription and quantitative analysis of MEP pathway genes were performed on BL21(DE3), BL21(DE3)-ΔyhaK and BL21(DE3)-yhaK. The quantitative results are shown in Figure 5 As shown, yhaK can positively regulate the expression of MEP pathway genes to increase astaxanthin production.

[0074] (1) Total RNA extraction: RNA from BL21(DE3)-ΔyhaK, BL21(DE3)-yhaK, and BL21(DE3) was extracted using the Trizol method.

[0075] Take 1 mL of overnight activated bacterial solution and centrifuge to remove the supernatant. Add 100 μL TE Buffer to the precipitate and mix by pipetting.

[0076] Add 1 mL Trizol to each 100 μL sample and mix thoroughly until the liquid is clear, then let stand at room temperature for 5 min. Add 300 μL chloroform and shake thoroughly for 15 s, then carefully transfer 400 μL of the supernatant to a new 1.5 mL centrifuge tube.

[0077] Add 300 μL of isopropanol, mix by inversion, and leave at room temperature for 10 min to precipitate RNA. Centrifuge at 1000×g for 1 min at 4°C and discard the supernatant.

[0078] Add 1 mL of 75% ethanol to the precipitate and mix by pipetting.

[0079] Centrifuge at 1000×g for 5 min at 4°C and carefully aspirate all the supernatant.

[0080] Wash the precipitate again with 1 mL of 75% ethanol and discard the supernatant completely.

[0081] Open the centrifuge tube cap and dry at room temperature for 10 min.

[0082] Add 30-40 μL RNase free water to the pellet and incubate at 57°C for 10 min to dissolve the RNA. Measure the RNA concentration using Nanodrop.

[0083] (2) Convert total RNA into cDNA by reverse transcription The first-strand cDNA was reverse transcribed using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa): (a) Removal of genomic DNA: The reaction mixture was prepared on ice according to the ingredients in the following table. The PCR reaction procedure was: 42°C, 2 min.

[0084] The genome elimination system in RNA is as follows (b) Reverse transcription reaction: The reverse transcription PCR reaction procedure is: 37°C, 15 min, 85°C, 5 s; stored at 4°C. The reverse transcription reaction system is as follows: (3) Gene expression analysis Using gadph as an internal reference, the expression levels of genes related to the MEP pathway were analyzed.

[0085] Using gadph as an internal reference, the expression of genes related to the MEP pathway was analyzed. The primer sequences are as follows: GadpH-F: 5'-TGCCCCACACAAATCAA-3' <h2 style=";text-align:left;direction:ltr">GadpH-R:5'-CGAACTGCGCCGCTATTTAC-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Dxs-F: 5'-TGCCCCACACACAAATCAA-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Dxs-R: 5'-CGAACTGCGCCGCTATTTAC-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Dxr-F: 5'-TTGAGCAAAATTGGCGTGGTG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Dxr-R:5'-ATCGACCAGTTCGGATGACG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IspD-F: 5'-GATGGATGGTTCGGGTGAGG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IspD-R: 5'-TGAAGGCGCGACTATTACCG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IspE-F: 5'-CCCCCGAACAAAGACAGGAA-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IspE-R: 5'-ACGGTCCTGGTGGCATTAAA-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IspF-F: 5'-CACGTCCGGTAAATCCCAGT-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IspF-R: 5'-GTTGCCGCACATTCCACACAAA-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IspH-F: 5'-TTATGACCCAGACCACGCTG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IspH-R:5'-GATGTCATCTTTGCGCGGAC-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IspG-F: 5'-GGTGACCGCCGAGTGTAGAAA-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IspG-R: 5'-TCACTCCGATGGACGTTTCG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IDI-F: 5'-GGAGAAAGCAACGAAGACGC-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IDI-R: 5'-GCGGTAGCGAAAGTCAGGAT-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IspA-F: 5'-TGCTCAAGACCCAGAAGTGC-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IspA-R: 5'-TCCTGGATGTGGTGGGAGAT-3'<h2 style=";text-align:left;direction:ltr"> RT-qPCR reaction system (20 μL): SYBR Master Mix 10 μL, upstream and downstream primers 0.4 μL each, cDNA 2 μL, ddH2O 7.2 μL, reaction program: 95°C, 5 min; 95°C 10 s, 60°C 10 s, 72°C 20 s, 45 cycles, the experiment was repeated 3 times, and the relative expression level was calculated using the 2-ΔΔCT method for the obtained data.

[0086] Example 6: Construction of pACYC-crtR-crtYB-IspA expression vector (1) Using the pACYC-Duet plasmid as a template and primers pACYC-F and pACYC-R, PCR was performed to amplify the pACYC linearized vector. The PCR amplification system is as follows: template 100 ng pACYC-R 0.5 μM pACYC-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 60ºC for 15 s, 72ºC for 5 min); 72ºC for 5 min; 16 ºC ∞.

[0087] The primer sequences are as follows: pACYC-F:5'- AATTCTTGACCTCTCTTTACTTCCTTTTATGGTA -3'; pACYC-R: 5'-CATATGTATATCTCCTTCTTATACTTAACTAATATACTAAGATGGGG -3'; (2) Using the genome of Phaffia rhodotorula as a template, primers crtR-R and crtR-F were used to amplify the crtR fragment by polymerase chain reaction (PCR).

[0088] The PCR amplification system is as follows: template 100 ng crtR-R 0.5 μM crtR-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 65ºC for 15 s, 72ºC for 2 min 20 s); 72ºC for 5 min; 16 ºC ∞.

[0089] The primer sequences are as follows: crtR-F:5'-ATGAGCGGCTGGGAAGGTCAGATGGCGACCCTGAGCGATCT-3'; crtR-R: 5'GTAAAGAGAGGTCAAGAATTGCTCCACACATCCATCAGCAG-3'; (3) Using the genome of Phaffia rhodotorula as a template, primers crtYB-R and crtYB-F were used to amplify the crtYB fragment by polymerase chain reaction (PCR).

[0090] The PCR amplification system is as follows: template 100 ng crtYB-R 0.5 μM crtYB-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 65ºC for 15 s, 72ºC for 2 min); 72ºC for 5 min; 16 ºC ∞.

[0091] The primer sequences are as follows: crtYB-F:5'- GACTACATCATCCAGCGTAATAAATAAATGACCGCGCTGGCGT-3'; crtYB-R:5'-GAATCACCAGATCGCTCAGGGTCGCCATCTGACCTTCCCAGCCGCTCA-3'; (4) Using the E. coli genome as a template, primers IspA-R and IspA-F were used to amplify IspA by polymerase chain reaction (PCR).

[0092] The PCR amplification system is as follows: template 100 ng IspA-R 0.5 μM IspA-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 65ºC for 15 s, 72ºC for 1 min); 72ºC for 5 min; 16 ºC ∞.

[0093] The primer sequences are as follows: IspA-F:5'- GAAGGAGATATACATATGATGGACTTTCCGCAGCAACTC-3'; IspA-R:5'- TAATACGCCAGCGCGGTCATTTATTTATTACGCTGGATGATGTAGTCCG-3'; (5) PCR products were connected by seamless cloning using 2×Clon Express Mix (Vazyme, Catalog No. C115). The system is as follows: Vector digested fragment 0.03 pmol PCR fragments inserted into each gene 0.06 pmol 2×Clon Express Mix 5 μL Ultrapure water Make up to 10 μL The system was incubated at 50 ºC for 30 min.

[0094] The product was transformed into competent cells and spread onto LB solid plates containing 50 mg / L chloramphenicol. Positive clones were screened by PCR, and the recombinant plasmid pACYC-crtR-crtYB-IspA ( Figure 6 ), and then identified by restriction enzyme digestion and sequencing.

[0095] Example 7: Construction of pACYC-crtR-crtYB-IspA-yhaK expression vector (1) Using plasmid pACYC-crtR-crtYB-IspA as template, primers pACYC-R and primer pccI-F, polymerase chain reaction (PCR) was performed to amplify the linearized vector.

[0096] The PCR amplification system is as follows: template 100 ng pACYC-R 0.5 μM pccI-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 60ºC for 15 s, 72ºC for 10 min); 72ºC for 5 min; 16 ºC ∞.

[0097] The primer sequences are as follows: pccI-F:5'-ACACTGCCTGGCAGTTCGGGTAGTAATCATATGGACTTTCCGCAGCAACTCGAAGCCTGCG-3'; pACYC-R: 5'-CATATGTATATCTCCTTCTTATACTTAACTAATATACTAAGATGGGG -3'; (2) Using the Escherichia coli genome as a template, primers yhaK-R and yhaK-F were used to amplify the yhaK fragment by polymerase chain reaction (PCR).

[0098] The PCR amplification system is as follows: template 100 ng yhaK-R 0.5 μM yhaK-F 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme p525) 25 μL Ultrapure water Make up to 50 μL The PCR program was: 95ºC for 3 min; 30 cycles × (95ºC for 15 s, 65ºC for 15 s, 72ºC for 1 min 20 s); 72ºC for 5 min; 16 ºC ∞.

[0099] The primer sequences are as follows: yhaK-F:5'-GAAGGAGATATACATATGCTAGACAGGCAAATCTATCAGCAAAGC-3'; yhaK-R:5'-TCGAGTTGCTGCGGAAAGTCCATATGATTACTACCCGAACTGCC-3'; (3) PCR products were connected by seamless cloning using 2×Clon Express Mix (Vazyme, Catalog No. C115). The system is as follows: Vector digested fragment 0.03 pmol PCR fragments inserted into each gene 0.06 pmol 2×Clon Express Mix 5 μL Ultrapure water Make up to 10 μL The system was incubated at 50 ºC for 30 min.

[0100] The product was transformed into competent cells and spread onto LB solid plates containing 50 mg / L chloramphenicol. Positive clones were screened by PCR, and the recombinant plasmid pACYC-crtR-crtYB-IspA-yhaK ( Figure 7 ), and then identified by restriction enzyme digestion and sequencing.

[0101] Example 8: Construction of engineered Escherichia coli strains The recombinant plasmid pET-RPlyc-crtS and the recombinant plasmid pACYC-crtR-crtYB-IspA were co-transformed into BL21(DE3)::Trc-low-MvaE-MvaS competent cells and spread on LB solid plates containing 50 mg / L kanamycin to obtain positive clones, thereby obtaining the engineered strain ELZSS01.

[0102] The recombinant plasmid pET-RPlyc-crtS and the recombinant plasmid pACYC-crtR-crtYB-IspA-yhaK were co-transformed into BL21(DE3)::Trc-low-MvaE-MvaS competent cells and spread on LB solid plates containing 50 mg / L kanamycin to obtain positive clones, thereby obtaining the engineered strain ELZSS02.

[0103] Example 9: Production of astaxanthin by E. coli fermentation The engineered strains ELZSS01 and ELZSS02 were induced and cultured in ZYM medium. After the strains grew completely, the bacteria were subjected to biotransformation using M9 culture medium. The substrate was 10 g glucose. The method for inducing expression and biotransformation was as follows: (1) All the obtained engineered strains were streaked on LB solid plates with corresponding resistance using the four-zone streak method and cultured overnight at 37°C to obtain single clones.

[0104] (2) Pick a single clone from each plate and place it in resistant LB liquid culture medium, culture it overnight, and inoculate it into a flask containing 30 mL ZYM medium (containing a final concentration of 0.2% arabinose) at a ratio of 1%, and culture it at 30°C, 200 r / min, for 13 h to 15 h.

[0105] (3) Take 100 μL of the induced bacterial solution and dilute it 30 times. Take 200 μL of the diluted bacterial solution and measure its concentration using a spectrophotometer (Shimadzu) and keep a record.

[0106] (4) Calculate the concentration of the original bacterial solution, centrifuge the bacterial solution at 4000 r / min for 10 min in a 50 mL centrifuge tube, discard the supernatant, add a certain amount of M9 mixed solution (including 1xM9, 10 g of glucose), and use a pipette to resuspend the bacterial cells.

[0107] (5) Take 3 mL of the resuspended cells and add them to clean test tubes. Place them in a shaker at 30℃ and 200 rpm for transformation for 24 h.

[0108] (6) Take 100 μL of the transformed bacterial solution and dilute it 50 times. Measure the concentration using a spectrophotometer (Shimadzu) and record the data.

[0109] Example 10: Extraction and detection of astaxanthin HPLC (1) Astaxanthin extraction method: The engineered strains ELZSS01 and ELZSS02 were cultured overnight in LB liquid medium (streptomycin resistance) and then transferred to ZYM induction medium for 13 h. The cells were collected and resuspended in M9 transformation solution. 3 mL of the cells were transformed at 30°C for 24 h, and the OD was measured. 600 , take 1 mL of the bacteria and extract it with 1 mL of anhydrous ethanol for 4 h, then take the supernatant and filter it into a chromatographic vial for HPLC detection, and use HPLC to measure the astaxanthin production.

[0110] (2) The method for detecting astaxanthin production is HPLC, and the conditions are as follows: HPLC detector (ShimadzuHPLC, System, Model LC-20A, chromatographic column ZORBAXSB-C18 3.5μm, 4.6x150mm, Agilent, USA) mobile phase A is methanol, mobile phase B is ethyl acetate, and the analysis time for each sample is 16 min. From 0 to 10 min, the concentration of mobile phase B increases from 0 to 40% at a rate of 3% per minute. From 10 to 16 min, the concentration of mobile phase B is always controlled at 0, and the total flow rate is 1 mL / min. UV: 475 nm.

[0111] The fermentation results are as follows Figure 8As shown in the figure, the astaxanthin production of the two strains ELZSS01 and ELZSS02 in the same fermentation cycle was analyzed, and it was found that ELZSS02 had a higher production. Further observations showed that with the extension of fermentation time, the astaxanthin production of ELZSS01 changed relatively slowly, while ELZSS02 showed a significant production growth trend, indicating that ECLYC02 has better fermentation performance and potential in astaxanthin production.

[0112] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. An Escherichia coli with high astaxanthin production, characterized in that: The Escherichia coli engineered bacteria is constructed by an expression vector containing a carotenoid operon gene fragment (lyc) and a gene fragment encoding astaxanthin synthase (crtS), a gene fragment encoding cytochrome reductase (crtR), a gene fragment encoding lycopene cyclase (crtYB) and an expression vector of the yhaK gene.

2. The Escherichia coli engineered bacteria according to claim 1, characterized in that The carotenoid operon gene fragment is a lyc gene fragment with a base sequence as shown in SEQ ID NO.1, which comes from Rhodopseudomonas palustris.

3. The engineered Escherichia coli according to claim 1, characterized in that: The gene fragment encoding astaxanthin synthase is a crtS gene fragment with a base sequence as shown in SEQ ID NO.2, which comes from Phaffia rhodozyma.

4. The engineered Escherichia coli according to claim 1, characterized in that: The gene fragment encoding cytochrome reductase is a gene fragment of crtR with a base sequence as shown in SEQ ID NO.3, which comes from Phaffia rhodozyma.

5. The engineered Escherichia coli according to claim 1, characterized in that: The gene fragment encoding lycopene cyclase is a gene fragment of crtYB with a base sequence as shown in SEQ ID NO.4, which is derived from Phaffia rhodozyma.

6. The engineered Escherichia coli according to claim 1, characterized in that: The expression vector also includes a gene fragment base sequence encoding farnesyl / geranyl pyrophosphate synthase, such as IspA shown in SEQ ID NO.5, which is from Escherichia coli.

7. The engineered Escherichia coli according to claim 1, characterized in that: The gene fragment of yhaK is a nucleotide sequence shown in SEQ ID NO.6, and the nucleotide sequence encoded by it is shown in SEQ ID NO.7, which is derived from Escherichia coli.

8. The method for constructing an engineered Escherichia coli according to claims 1-7, characterized in that: The specific steps include: (1) After amplifying the gene fragment crtS encoding astaxanthin synthase, it was ligated with the recombinant plasmid pET-RPlyc (cited from patent application number 202110912377.4) fragment, and the ligation product was transformed into competent cells. After resistance screening and positive cloning, the recombinant plasmid pET-RPlyc-crtS was obtained.

9. (2) Amplify the gene fragment crtR encoding cytochrome reductase, the gene fragment crtYB encoding lycopene cyclase, and the gene fragment IspA encoding farnesyl / geranyl pyrophosphate synthase, connect the three, transform the ligation product into competent cells, and obtain the recombinant plasmid pACYC-crtR-crtYB-IspA after resistance screening and positive cloning.

10. (3) The amplified gene fragment yhaK was fused with the pACYC-crtR-crtYB-IspA plasmid fragment, and the product was transformed into competent cells. After resistance screening and positive cloning, the recombinant plasmid pACYC-crtR-crtYB-IspA-yhaK was obtained.

11. (4) The recombinant plasmids pET-RPlyc-crtS and pACYC-crtR-crtYB-IspA were co-transformed into Escherichia coli BL21(DE3)::pTrc low-MvaE-MvaS competent cells to obtain the Escherichia coli engineered strain ELZSS01; Alternatively, the recombinant plasmids pET-RPlyc-crtS and pACYC-crtR-crtYB-IspA-yhaK are co-transformed into Escherichia coli BL21 (DE3)::pTrc low-MvaE-MvaS competent cells to obtain the Escherichia coli engineering strain ELZSS02.

12. The Escherichia coli engineered strain according to claim 8 is characterized in that The yhaK gene has a positive regulatory effect on the MEP pathway.

13. Use of the engineered Escherichia coli according to claim 8 in synthesizing and / or increasing the yield of astaxanthin.

14. The use according to claim 10, characterized in that: The steps of synthesizing astaxanthin by Escherichia coli are as follows: the engineered strains ELZSS01 and ELZSS02 are cultured overnight in LB liquid medium (chloramphenicol and kanamycin resistance), then transferred to ZYM induction medium for 13 h, the cells are collected, resuspended in M9 transformation liquid, 3 mL of the cells are transformed at 30° C. for 24 h, and the OD 600 , extract 1 mL of the bacteria with 1 mL of anhydrous ethanol for 4 h, then filter the supernatant into a chromatographic vial for HPLC detection.

15. The use according to claim 11, characterized in that: The method for detecting astaxanthin production is HPLC, and the conditions are as follows: HPLC detector (ShimadzuHPLC, System Model LC-20A, chromatographic column ZORBAXSB-C18 3.5 μm, 4.6x150mm, Agilent, USA), mobile phase A is methanol, mobile phase B is ethyl acetate, and the analysis time for each sample is 16 minutes. From 0 to 10 minutes, the concentration of mobile phase B increases from 0 to 40% at a rate of 3% per minute. From 10 to 16 minutes, the concentration of mobile phase B is always controlled at 0, and the total flow rate is 1 mL / min. UV: 475 nm.

Images