Construction and application of a recombinant constitutive lactic acid bacteria expressing N-GPV VP2 protein

Abstract

The present invention is applicable to the field of biotechnology and provides a construction and application of a recombinant constitutive lactic acid bacteria fusion-expressing N-GPV VP2 protein. The construction method comprises the following steps: <h2 style=";text-align:left;direction:ltr">VP2 Genes and <h2 style=";text-align:left;direction:ltr"> 3LysM Anchor gene cloning, sequencing, linearization of Lactococcus lactis constitutive plasmid pMG36e, and the purified enzyme digestion product, <h2 style=";text-align:left;direction:ltr"> VP2 Genes and <h2 style=";text-align:left;direction:ltr"> 3LysM The anchor gene is homologously recombined by seamless cloning technology; the recombinant plasmid pMG36e-VP2-3LysM identified by sequencing is electrotransformed into MG1363 lactococcus competent cells, cultured after transformation, and the positive constitutive lactic acid strain pMG36e-VP2-3LysM / MG1363 is obtained by sequencing identification. The recombinant constitutive lactic acid bacteria prepared by the present invention can effectively enhance the immunity of ducklings, which is of great significance for the effective prevention and control of duck short beak-dwarfism syndrome.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to the construction and application of a recombinant constitutive lactic acid bacteria fusion-expressing N-GPV VP2 protein. Background Art

[0002] At present, the waterfowl parvovirus family mainly includes goose parvovirus (GPV), Muscovy ducking parvovirosis (MDPV), novel Muscovy duck parvovirus (N-MDPV) and novel goose parvovirus (N-GPV). Among them, Short beak and dwarfism syndrome (SBDS) caused by N-GPV is one of the waterfowl infectious diseases that has seriously affected my country's duck farming industry in recent years. The incidence rate of the disease is usually 80-100%, and the main manifestations are poor development of ducklings, short beaks, bent leg bones, feather loss, etc. The elimination rate of stunted ducks is as high as 80%, which has brought huge economic losses to my country's duck farming industry. The capsid protein of N-GPV is composed of three structural proteins: VP1, VP2 and VP3. Among them, VP2 protein can assemble virus particles autonomously and is the main surface antigen of N-GPV. Its immunogenicity is stronger than that of VP1 and VP3 proteins, and it can induce the body to produce a higher level of antibody response. The lack of an effective N-GPV vaccine is the main reason for the high incidence of the disease. Although GPV vaccines and anti-GPV yolk antibodies are commonly used in clinical practice to prevent and control SBDS, there are key amino acid sequence differences between N-GPV and GPV in the genome, which reduces the ability of related biological products for the prevention and control of GPV to protect ducks from SBDS. In view of this, it is particularly important to develop a safe and efficient N-GPV vaccine.

[0003] As a host bacteria for the expression of foreign proteins, lactic acid bacteria are safe and non-toxic, do not contain endotoxins, can colonize and survive in the digestive tract, and the foreign proteins expressed by them can be taken orally together with the bacteria without purification, thereby inducing the body to produce local mucosal immunity and systemic immunity. Mucosal immunity is an important part of the entire immune network of the body, and it is also an independent immune system with unique structure and function. It plays an extremely important role in resisting infection. The mucosal surface is in direct contact with external antigens and is the first line of defense for the body to resist infection. Lactic acid bacteria can not only act as nonspecific immune regulatory factors, activate host immune cells, and increase the activity of phagocytes, thereby improving the body's immunity. Lactic acid bacteria can also serve as a carrier for presenting protective antigens, which can not only induce the body to produce specific antibodies, stimulate the body's specific immune response, enhance the levels of IgA, IgM and IgG on the mucosal surface and in the serum to enhance humoral immunity, promote the proliferation of T and B lymphocytes, and enhance cellular immunity, but also can well induce cytotoxic T lymphocyte responses and the expression of cytokines IL-2 and IFN-γ. In view of the fact that lactic acid bacteria have the characteristics of adhesion, colonization and non-pathogenicity in other mucosal sites such as the gastrointestinal tract, the construction of recombinant genetically engineered lactic acid bacteria containing virus protective antigens has become a research hotspot. This recombinant genetically engineered lactic acid bacteria can secrete and express protective antigen proteins outside the cell or anchor them on the peptidoglycan of the bacteria, activate the immune system, stimulate the production of specific mucosal immune effector factor sIgA, and make it possible to serve as a live carrier for mucosal immune antigen presentation. In view of this, the present invention proposes the construction and application of a recombinant constitutive lactic acid bacteria that fusion-expresses N-GPV VP2 protein. Summary of the invention

[0004] The purpose of the present invention is to provide a construction and application of a recombinant constitutive lactic acid bacteria fusion-expressing N-GPV VP2 protein, aiming to solve the problems raised in the above-mentioned background technology.

[0005] To achieve the above object, the present invention provides the following technical solutions: A recombinant constitutive lactic acid bacterium expressing N-GPV VP2 protein, which is a novel goose parvovirus VP2 Lactococcus lactis MG1363 3Lys The anchor gene is inserted into a lactic acid bacteria expression vector and then transformed into lactic acid bacteria to obtain the product.

[0006] A method for constructing a recombinant constitutive lactic acid bacteria according to the above-mentioned method does not require the addition of an inducer for expression, and the promoter can transcribe and translate the target protein under suitable conditions, thereby simplifying the operation steps of protein expression and reducing production costs. The method comprises the following steps: Step 1: Amplify the novel goose parvovirus using PCR VP2 Lactococcus lactis MG1363 3Lys Anchor genes; Step 2: Use XB and Hind Ⅲ The constitutive plasmid pMG36e of Lactococcus lactis was linearized by restriction endonuclease, and the amplified plasmid in step 1 was cloned into VP2 Gene fragments and 3Lys The gene fragment and the purified enzyme-digested product were homologously recombined by seamless cloning technology, and the tandem sequence was VP2-3LysM, thereby obtaining the recombinant plasmid pMG36e-VP2-3LysM; Step 3: electrotransform the recombinant plasmid pMG36e-VP2-3LysM into MG1363 lactococcus lactis competent cells, and screen for positive constitutive lactic acid bacteria pMG36e-VP2-3LysM / MG1363; Step 4: Extract the recombinant plasmid from the positive constitutive lactic acid bacteria pMG36e-VP2-3LysM / MG1363, identify it by restriction enzyme digestion, and sequence the inserted sequence.

[0007] Furthermore, in step 1, amplification VP2 The PCR primer pair of the gene includes VP2-F and VP2-R, and the nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0008] Furthermore, in step 1, amplification 3Lys The PCR primer pair for the anchor gene includes 3LysM-F and 3LysM-R, and the nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0009] Further, in step 2, the restriction endonuclease used is XB and Hind Ⅲ .

[0010] A use of the recombinant constitutive lactic acid bacteria described above or the recombinant constitutive lactic acid bacteria constructed by the construction method described above in the preparation of immunomodulatory biological products.

[0011] Furthermore, the recombinant constitutive lactic acid bacteria is used to prepare a vaccine against a novel goose parvovirus.

[0012] Compared with the prior art, the present invention has the following beneficial effects: The present invention first constructed pMG36e-VP2-3LysM / MG1363 recombinant constitutive lactic acid bacteria. The foreign gene was verified by SDS-PAGE and Western blotting analysis. VP2It has been successfully expressed in Lactococcus lactis, and the expression product has reactogenicity. In further studies, oral immunization tests were conducted on one-day-old ducklings. The results showed that oral administration of the recombinant constitutive lactic acid bacteria can not only stimulate the humoral and cellular immune responses of ducklings, but also produce mucosal immunity locally. These results show that the recombinant constitutive lactic acid bacteria prepared by the present invention can effectively enhance the immunity of ducklings, which is of great significance for the effective prevention and control of duck short beak-dwarfism syndrome. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Preparation of pMG36e-VP2-3LysM recombinant plasmid; wherein A is VP2 Gene PCR amplification results; B is 3Lys Anchor gene PCR amplification results; C is the double restriction enzyme digestion of pMG36e-VP2-3LysM recombinant plasmid ( Xba I, Hind III ) identification.

[0014] Figure 2 Western blot analysis of the recombinant constitutive lactic acid bacteria VP2 protein fusion expression in pMG36e-VP2-3LysM / MG1363.

[0015] Figure 3 This is the growth curve of pMG36e-VP2-3LysM / MG1363 recombinant constitutive lactic acid bacteria.

[0016] Figure 4 The results show that: (A) is the level of specific VP2 antibodies in serum after immunization; (B) is the level of IFN-γ cytokine in serum after immunization; (C) is the level of IL-2 cytokine in serum after immunization; (D) is the level of tracheal mucosa-specific sIgA antibodies after immunization; (E) is the level of intestinal mucosa-specific sIgA antibodies after immunization.

[0017] Figure 5 The effect of oral administration of pMG36e-VP2-3LysM / MG1363 recombinant constitutive lactic acid bacteria on the weight growth of ducklings. DETAILED DESCRIPTION

[0018] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0019] The specific implementation of the present invention is described in detail below in conjunction with specific embodiments. Unless otherwise specified, the reagents and consumables used in the present invention are all commercially available. The experimental techniques and methods in the embodiments are all conventional methods and methods recommended by the reagent instructions.

[0020] The materials and instruments involved in the following examples are as follows: 1. Experimental materials: The N-GPV strain was isolated and preserved by our laboratory; JM109 Escherichia coli competent cells, DH5α competent cells and pMD18-T cloning vector were purchased from Beijing Angyu Biotechnology Co., Ltd.; MG1363 Lactococcus lactis and pMG36e constitutive plasmid were purchased from Hangzhou Baosai Plasmid Strain Resource Company; homologous recombination kit was purchased from Jiangsu Best Biotechnology Co., Ltd.; SDS-PAGE and Western blot related reagents were purchased from Xinsaimei Biotechnology Co., Ltd.; goat anti-mouse IgG-HRP was purchased from Solebao Technology Co., Ltd.; PCR primers were synthesized by BGI.

[0021] The RNA extraction kit was TransGen, cat. no. EC301-11; the RNA reverse transcription kit was HiFiScript cDNA Synthesis Kit (KANGWEI, cat. no. CW2569M); the DNA gel extraction kit was Omega Bio-tek, cat. no. D2500-02; the plasmid extraction kit was TIANprep Mini Plasmid Kit (TIANGEN, cat. no. DP105); duck interleukin 2 (IL-2) ELISA kit, duck gamma interferon (IFN-γ) ELISA kit and duck secretory immunoglobulin A (sIgA) enzyme-linked immunosorbent assay kit were all purchased from Fankewei Biotechnology Co., Ltd.

[0022] 2. Experimental instruments: Nucleic acid electrophoresis instrument; protein electrophoresis instrument; Kechuangruixin gel imaging system (Gel K8160); chemiluminescence imaging system, etc.

[0023] Example 1: Preparation of pMG36e-VP2-3LysM recombinant plasmid; (1) Primer design and synthesis; The tandem sequence of the recombinant plasmid is VP2-3LysM. Using CE Design software, N-GPV VP2 Lactococcus lactis MG1363 3Lys The homology arm primers were designed for anchoring genes. The primer sequences were synthesized by BGI. The primer pair gene sequences are as follows: N-GPV(VP2)-F: 5'-GCCCGGGGATCGATCC tctaga CATCATCACCATCACCAT acggctcctgcaaaaaaaaatacag-3' (SEQ ID NO. 1); N-GPV(VP2)-R: 5'-CGTTTTCAGACTTTGC aagctt cagattttgagttagatatctggttccaatcaatc-3' (SEQ ID NO. 2); 3LysM-F: 5'-AACTCAAAATCTGGC aagctt G actacttataccgtcaaatc-3' (SEQ IDNO.3); 3LysM-R: 5′-ATATCGTAGCGCCGG ggtacc ttttattcgtagatactg-3' (SEQ ID NO. 4); Note: The ununderlined uppercase bases are homology arms; the lowercase italic bases are restriction sites; the underlined uppercase bases are His tags; the lowercase bases are the corresponding specific primers; the double underlined uppercase bases are protective bases.

[0024] (2) VP2 Genes and 3Lys Cloning of anchor genes; Obtained from the GenBank database of the National Center for Biotechnology Information (NCBI) VP2 gene (OQ784256.1) and 3Lys The nucleotide sequence of the anchor gene (AM406671.1) was determined, and the corresponding protein amino acid sequences were designed. VP2 The nucleotide sequence of the gene is shown in SEQ ID NO.5, and the amino acid sequence of the protein encoded by it is shown in SEQ ID NO.6; NCBI GenBank: AM406671.1, 3Lys The nucleotide sequence of the anchor gene is shown in SEQ ID NO.7, and the amino acid sequence of the protein encoded by it is shown in SEQ ID NO.8.

[0025] Using the extracted viral DNA as a template, PCR amplification of VP2-F / VP2-R was performed using primers. After 1% agarose gel electrophoresis imaging analysis, a specific target band of 1764 bp was obtained ( Figure 1 Middle A).

[0026] Using the total DNA of Lactococcus lactis MG1363 as a template, PCR amplification was performed using primers 3LysM-F / 3LysM-R. After 1% agarose gel electrophoresis imaging analysis, a specific target band of 585 bp was obtained ( Figure 1 Middle B).

[0027] The PCR products were identified by 1% agarose gel electrophoresis and then purified by gel recovery. After recovery, the products were stored at -20°C for future use.

[0028] (3) Linearization of the expression vector pMG36e; According to the gene sequence of expression vector pMG36e, select XB and Hind Ⅲ The expression vector pMG36e was double-digested by two restriction enzyme sites. The restriction enzyme system is as follows: Table 1. Double enzyme digestion system

[0029] The reaction was carried out in a metal bath at 37°C for 45 min. After the reaction, all the enzyme-digested products were added to 1% agarose gel for nucleic acid electrophoresis detection, and the target bands were cut out for purification. After the products were recovered, they were stored at -20°C for future use.

[0030] (4) Synthesis and identification of the recombinant expression vector pMG36e-VP2-3LysM; The above-mentioned recycled VP2 Genes and 3Lys The secretory peptide fragment was mixed with the pMG36e vector linearized by enzyme digestion at a fragment concentration ratio of 3:1:1, and homologous recombination was performed in a 50°C metal bath for 60 min using seamless cloning technology to obtain the ligation product. The homologous recombination reaction system is as follows: Table 2. Homologous recombination reaction system

[0031] The ligation product was transformed into JM109 competent cells and then plated on LB culture plates containing erythromycin resistance for screening and culture. The cloned strains were identified by PCR using universal primers for pMG36e vector (F: ATATATTCAAGGCAATCTGCCTCC, as shown in SEQ ID NO.9; R: GCAGCTGATCTCAACAATGTG, as shown in SEQ ID NO.10), and the positive strains were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The correctly sequenced strains were added to liquid LB medium containing resistance at a ratio of 1:100, expanded and cultured at 200 r / min for 12 h, and the recombinant plasmid was extracted according to the instructions of the plasmid mini-extraction kit.

[0032] After the recombinant plasmid is extracted, use Xba Ⅰ and Hind Ⅲ The restriction endonuclease was used for double digestion verification. The digestion system is shown in Table 1. The reaction was carried out in a metal bath at 37°C for 45 min. After the reaction, the digestion products were subjected to nucleic acid electrophoresis in 1% agarose gel. The results showed that fragments of 3371 bp and 2395 bp were obtained ( Figure 1 The recombinant plasmid was named pMG36e-VP2-3LysM.

[0033] Example 2: Preparation of pMG36e-VP2-3LysM / MG1363 recombinant constitutive lactic acid bacteria and its expression analysis; (1) The recombinant plasmid pMG36e-VP2-3LysM was electroporated into MG1363 Lactococcus lactis. The specific steps are as follows: a. Take out the prepared MG1363 competent cells stored at -80°C, thaw them in an ice-water mixture, add 10.0 ng of the recombinant plasmid pMG36e-VP2-3LysM, and mix them by gently pipetting.

[0034] b. Use a 200 μL micropipette to transfer the mixture to a 2.0 mm electroporation cup that has been pre-cooled on ice, adding as much as possible to the bottom to avoid creating bubbles.

[0035] c. Place the cuvette on ice for 10 min.

[0036] d. Set the electroporator program parameters: resistance 400 Ω, pulse 25 μF, voltage 2000 V.

[0037] e. After the ice bath is over, take out the electroporation cup, dry the remaining water on the surface of the electroporation cup with a paper towel, and then put it into the electroporation tank. After making sure everything is ready, click Start.

[0038] f. After electroporation, remove the electroporation cup and immediately add 1 mL of pre-cooled GM17MC recovery medium. Mix by pipetting and transfer to a clean 1.5 mL centrifuge tube. Resuscitate in liquid culture at 30°C incubator for 120 min.

[0039] g. After the recovery culture is completed, centrifuge at room temperature, set the centrifugal speed to 4000 r / min, and the centrifugal time to 5 min. Aspirate 1.0 mL of the supernatant medium, resuspend the bacteria with the remaining approximately 100 μL of medium, transfer the resuspended bacterial liquid to GM17 solid medium containing 2.0 μg / mL erythromycin, spread it evenly with a sterile applicator, and then culture it upright in a 37°C incubator for 1 h, and then culture it in an inverted state in a 30°C incubator for 72~96 h.

[0040] h. Pick a single colony and place it in 5 mL EGM17 liquid medium, and incubate it in a 30°C incubator for 12 hours. Extract the total DNA of the recombinant constitutive lactic acid bacteria according to the above-mentioned Gram-positive bacteria DNA extraction method, and use the pMG36e-F / R universal primers for bacterial liquid PCR identification.

[0041] i. The positive strain confirmed by identification was named pMG36e-VP2-3LysM / MG1363.

[0042] (2) Expression of recombinant constitutive lactic acid bacteria pMG36e-VP2-3LysM / MG1363; The pMG36e-VP2-3LysM / MG1363 recombinant constitutive lactic acid bacteria were added into 10 mL of EGM17 liquid medium at a ratio of 1:100 and placed in an incubator at 30°C for expression for 12 h.

[0043] (3) Western blotting analysis of expression products; The induced samples were centrifuged at 12000 r / min for 15 min at 4°C, the supernatant was discarded, the cells were washed with PBS buffer and then centrifuged again, and the washing was repeated twice. Then ultrasonic disruption was performed with a disruption power of 200 w, working for 2 s, resting for 3 s, for a total of 15 min. SDS gel loading buffer was added in proportion and mixed, and boiled for 10 min, and protein electrophoresis analysis was performed on 12% SDS-PAGE. After the electrophoresis, the proteins on the gel were transferred to the NC membrane and blocked in 5% skim milk powder at 4°C overnight. TBST was added to wash 3 times, 5 min each time. Mouse anti-His monoclonal antibody was used as the primary antibody and incubated at 4°C overnight. TBST was added to wash 3 times, 5 min each time. HRP-labeled goat anti-mouse IgG was added as the secondary antibody and incubated at room temperature for 1 h. TPST was added to wash 3 times, 5 min each time. Using ultrasensitive ECL chemiluminescent reagent for light-protected color development, it was found that pMG36e-VP2-3LysM / MG1363 had specific protein expression at 90.1 kDa ( Figure 2 ), which is consistent with the expected result.

[0044] (4) Growth curve of pMG36e-VP2-3LysM / MG1363 recombinant constitutive lactic acid bacteria; The pMG36e-VP2-3LysM / MG1363 recombinant constitutive lactic acid bacteria and MG1363 lactococcus were cultured under the same conditions, and the OD600 of the bacterial solution was measured every 1 h. The results showed that both the pMG36e-VP2-3LysM / MG1363 recombinant constitutive lactic acid bacteria and MG1363 lactococcus could reach a stable phase within 12 h ( Figure 3 ), and their growth patterns were almost the same, indicating that the recombinant constitutive lactic acid bacteria could grow normally.

[0045] Example 3: Evaluation of the immunomodulatory effect of pMG36e-VP2-3LysM / MG1363 recombinant constitutive lactic acid bacteria after oral administration in ducklings; Healthy one-day-old ducklings were selected and randomly divided into three groups, each with 20 ducks: PBS group (control), pMG36e / MG1363 group, and pMG36e-VP2-3LysM / MG1363 group. The immunization method was oral immunization, once every 7 days, for a total of 3 times, each immunization lasted for 3 consecutive days, and the immunization dose was 1 × 10 11 CFU / 200 μL / duck / d. Blood, intestinal mucosa and tracheal mucosa were collected on the 5th day after immunization.

[0046] First, the serum was separated and the level of specific VP2 antibody in the serum was detected using the N-GPV VP2 protein indirect ELISA method established in the laboratory. The results showed that the pMG36e-VP2-3LysM / MG1363 group induced the secretion of specific IgG in the body at a certain level, which was significantly higher than that in the PBS group ( Figure 4 (A) This indicates that the recombinant constitutive lactic acid bacteria successfully induced the body's specific immune response to VP2 protein.

[0047] Then, the levels of IFN-γ and IL-2 cytokines in serum were detected by ELISA. The results showed that IFN-γ ( Figure 4 B) and IL-2 ( Figure 4 (C) The cytokine levels in the two groups were significantly higher than those in the PBS group, indicating that the recombinant constitutive lactic acid bacteria not only induced humoral immunity, but also promoted the production of cellular immune responses.

[0048] In addition, the ELISA method was used to detect the levels of tracheal mucosa and intestinal mucosa-specific sIgA antibodies. The results showed that the tracheal mucosa of ducklings in the pMG36e-VP2-3LysM / MG1363 group ( Figure 4 Middle D) and intestinal mucosa ( Figure 4The specific sIgA antibody levels in the E) group were significantly higher than those in the PBS group. This further confirmed the high efficiency of recombinant constitutive lactic acid bacteria in mucosal immunity, especially in respiratory and intestinal mucosal immunity.

[0049] In summary, this example successfully verified the immunomodulatory effect of pMG36e-VP2-3LysM / MG1363 recombinant constitutive lactic acid bacteria in ducklings through oral immunization. The recombinant constitutive lactic acid bacteria can not only effectively induce specific humoral immunity and cellular immune response, but also significantly improve the level of mucosal immunity, providing a strong experimental basis for subsequent vaccine development and immune strategy research.

[0050] Example 4: Evaluation of immune protection of ducklings orally administered pMG36e-VP2-3LysM / MG1363 recombinant constitutive lactic acid bacteria; Healthy one-day-old ducklings were randomly divided into 4 groups, 15 in each group, named normal group, control group, pMG36e / MG1363 group and pMG36e-VP2-3LysM / MG1363 group. Immunization and challenge were performed by oral route. The normal group was not immunized or challenged and was kept in isolation; the control group was challenged only; the pMG36e / MG1363 group was orally administered with pMG36e / MG1363 Lactococcus lactis; the pMG36e-VP2-3LysM / MG1363 group was orally administered with pMG36e-VP2-3LysM / MG1363 recombinant constitutive lactic acid bacteria; the oral dose was 1 × 10 11 CFU / 200 μL / duck / d, once a day. Immunization started at 1 day old and continued for 7 days. The ducklings were challenged with N-GPV newly isolated in the laboratory at 4 days old, and the virus solution was orally administered at 0.1 mL / duck. The weight changes of ducklings in each group at 1, 5, 9 and 14 days old, as well as the mortality and feather shedding of each group at 14 days old were recorded to evaluate the immune protection effect of the recombinant constitutive lactic acid bacteria.

[0051] The results are as follows: Table 3. Protective effect of recombinant constitutive lactic acid bacteria

[0052] As can be seen from Table 3, after infection (14 days old), the mortality rate and feather shedding rate of the pMG36e-VP2-3LysM / MG1363 group and the pMG36e / MG1363 group were improved, and the improvement of mortality and feather shedding in the pMG36e-VP2-3LysM / MG1363 group was more significant.

[0053] from Figure 5It can be seen that after the virus attack (5 days old), the weight gain of ducklings in the pMG36e-VP2-3LysM / MG1363 group and the pMG36e / MG1363 group was significantly higher than that in the control group (PBS group).

[0054] From the above results, it can be seen that oral lactic acid bacteria are beneficial to the growth of ducklings.

[0055] The above are only preferred embodiments of the present invention. It should be pointed out that, for those skilled in the art, several modifications and improvements can be made without departing from the concept of the present invention. These should also be regarded as the protection scope of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.

Claims

1. A recombinant constitutive lactic acid bacterium expressing N-GPV VP2 protein, characterized in that: Goose parvovirus VP2 Lactococcus lactis MG1363 3Lys The anchor gene is inserted into a lactic acid bacteria expression vector and then transformed into lactic acid bacteria to obtain the product.

2. A method for constructing a recombinant constitutive lactic acid bacteria according to claim 1, characterized in that: The following steps are involved: Step 1: Amplify the novel goose parvovirus using PCR VP2 Lactococcus lactis MG1363 3Lys Anchor genes; Step 2: Linearize the constitutive plasmid pMG36e of Lactococcus lactis using restriction endonucleases and amplify the plasmid pMG36e in step 1. VP2 Gene fragments and 3Lys The gene fragment and the purified enzyme-digested product were homologously recombined by seamless cloning technology to obtain the recombinant plasmid pMG36e-VP2-3LysM; Step 3: electrotransform the recombinant plasmid pMG36e-VP2-3LysM into MG1363 lactococcus lactis competent cells, and screen for positive constitutive lactic acid bacteria pMG36e-VP2-3LysM / MG1363; Step 4: Extract the recombinant plasmid from the positive constitutive lactic acid bacteria pMG36e-VP2-3LysM / MG1363, identify it by restriction enzyme digestion, and sequence the inserted sequence.

3. The construction method according to claim 2, characterized in that: In step 1, amplification VP2 The PCR primer pair of the gene includes VP2-F and VP2-R, and the nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

4. The construction method according to claim 2, characterized in that: In step 1, amplification 3Lys The PCR primer pair for anchoring gene includes 3LysM-F and 3LysM-R, and the nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively.

5. The construction method according to claim 2, characterized in that: In step 2, the restriction endonuclease used is XB and Hind Ⅲ .

6. Use of the recombinant constitutive lactic acid bacteria according to claim 1 or the recombinant constitutive lactic acid bacteria constructed by the construction method according to any one of claims 2 to 5 in the preparation of immunomodulatory biological products.

7. The use according to claim 6, characterized in that: The recombinant constitutive lactic acid bacteria is used for preparing a vaccine against a novel goose parvovirus.

Images