Application of PTPRM in early warning, diagnosis and / or treatment of altitude sickness

Abstract

The present invention relates to the field of biomedicine technology, and specifically to the application of PTPRM in early warning, diagnosis and / or treatment of altitude sickness. The present application found that the expression level of PTPRM in the lung tissue, pulmonary artery and / or pulmonary artery endothelial cells of rats was significantly reduced in a simulated plateau environment. Further taking mice as an example, it was found that increasing the expression level of PTPRM can significantly alleviate the increase in pulmonary artery pressure caused by the plateau environment. Therefore, PTPRM can be used as a diagnostic marker or therapeutic target for altitude sickness.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the application of PTPRM in early warning, diagnosis and / or treatment of altitude sickness. Background Art

[0002] PTPRM (Protein Tyrosine Phosphatase Receptor Type M) is a protein tyrosine phosphatase receptor M. It is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes. For example, in cancer, the expression and function of the PTP family in cancer are complex. It can participate in the occurrence and development of cancer by acting on different substrates and various signaling pathways, producing tumor suppressor or tumor promoter effects. Some receptor-type PTPs play an important role in inhibiting or controlling growth and may be tumor suppressors, such as PTPRO, PTPRD, PTPRJ, PTPRK, PTPRM, PTPRT, and PTPRS, while some PTPs may play a carcinogenic function, such as PTPRA, PTPRB, and PTPRZ, or both, such as PTPRH, PTPRF, and PTPRG.

[0003] In the prior art, PTPRM has been used as a target for treating diseases. For example, patent document (CN115025110A) discloses the use of si-Ptprm in improving liver collagen deposition; another example is patent document (CN118203587A) discloses the use of PTPRM inhibitors in the preparation of drugs for treating liver fibrosis. However, there are no reports on the relationship between PTPRM and altitude sickness in the prior art. Therefore, the present invention is proposed. Summary of the invention

[0004] The PTPRM described in the present application is the abbreviation of Protein Tyrosine Phosphatase Receptor Type M, which means protein tyrosine phosphatase receptor M.

[0005] In a first aspect, the present invention provides a cell, tissue or organ, wherein the cell, tissue or organ overexpresses PTPRM.

[0006] Preferably, the overexpression is to change the original non-expression into expression.

[0007] Preferably, the overexpression means that the expression level is higher or significantly higher than the original expression level.

[0008] Preferably, the overexpression is at least 1.5 times the original expression amount, for example at least 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times or more.

[0009] Preferably, cells, tissues or organs overexpressing PTPRM are prepared by introducing a PTPRM coding sequence and / or regulating the expression of endogenous PTPRM.

[0010] Preferably, the genome of the cell, tissue or organ contains a PTPRM coding sequence, or the cell, tissue or organ contains a vector carrying the PTPRM coding sequence, or the cell, tissue or organ contains a vector carrying a sequence that regulates PTPRM expression.

[0011] Preferably, the sequence that regulates the expression of PTPRM includes saRNA (i.e., small activating RNA) or a sequence transcribed into saRNA.

[0012] Preferably, the sense strand of the saRNA comprises SEQ ID NO: 2; and the antisense strand comprises SEQ ID NO: 3.

[0013] Preferably, the cells are one or more of lung tissue cells, heart cells or spleen cells, and more preferably pulmonary artery endothelial cells.

[0014] Preferably, the tissue is one or more of lung tissue, heart tissue or spleen tissue.

[0015] Preferably, the organ is one or more of the lung, heart or spleen.

[0016] Preferably, the PTPRM coding sequence is derived from human or non-human animals, such as mice or rats. In a specific embodiment of the present invention, the accession number of the PTPRM coding sequence in NCBI is NM_008984.2.

[0017] Preferably, the vector comprises a viral vector or a non-viral vector.

[0018] Preferably, the viral vector comprises a lentiviral vector, a pseudoviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes simplex viral vector or a cytomegalovirus vector.

[0019] The second aspect of the present invention provides a method for constructing a cell, tissue or organ, wherein the cell, tissue or organ overexpresses PTPRM.

[0020] Preferably, the construction method comprises introducing a PTPRM coding sequence into a cell, tissue or organ, and / or regulating the expression of endogenous PTPRM.

[0021] Preferably, the construction method comprises: constructing a vector comprising a PTPRM coding sequence, and transfecting the vector into cells, tissues or organs.

[0022] Preferably, the construction method comprises: constructing a vector comprising a sequence for regulating the expression of PTPRM, and transfecting the vector into a cell, tissue or organ. Preferably, the sequence for regulating the expression of PTPRM comprises saRNA or a sequence transcribed into saRNA. Preferably, the sequence transcribed into saRNA comprises SEQ ID NO: 1.

[0023] Preferably, the construction method comprises: constructing a vector comprising a PTPRM coding sequence and a vector comprising a sequence for regulating the expression of PTPRM, and transfecting the above-mentioned vector into cells, tissues or organs.

[0024] Preferably, the construction method comprises: constructing a vector, wherein the vector comprises a PTPRM coding sequence and a sequence for regulating PTPRM expression, and transfecting the vector into cells, tissues or organs.

[0025] Preferably, the accession number of the PTPRM coding sequence at NCBI is NM_008984.2.

[0026] Preferably, the sense strand of the saRNA comprises SEQ ID NO: 2; and the antisense strand comprises SEQ ID NO: 3.

[0027] Preferably, the vector comprises a viral vector or a non-viral vector.

[0028] Preferably, the viral vector comprises a lentiviral vector, a pseudoviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes simplex viral vector or a cytomegalovirus vector.

[0029] In a specific embodiment of the present invention, the vector is an adeno-associated virus vector, such as GV478 (U6-MCS-CAG-EGFP).

[0030] The third aspect of the present invention provides the use of PTPRM as a target or the above-mentioned cells, tissues or organs or the cells, tissues or organs obtained by the above-mentioned construction method in the preparation of products for the treatment and / or prevention of altitude sickness.

[0031] Preferably, the product for treating and / or preventing altitude sickness comprises an agent expressing PTPRM, preferably an agent overexpressing PTPRM.

[0032] Preferably, the reagent for expressing PTPRM includes one or more of a vector, a factor promoting transcription of the PTPRM gene, or a PTPRM protein agonist.

[0033] Preferably, the vector contains a PTPRM coding sequence and / or a sequence for regulating PTPRM expression.

[0034] Further preferably, the accession number of the PTPRM coding sequence at NCBI is: NM_008984.2.

[0035] Further preferably, the sequence regulating the expression of PTPRM comprises saRNA. Preferably, the sense strand of the saRNA comprises SEQ ID NO: 2; and the antisense strand comprises SEQ ID NO: 3.

[0036] In a specific embodiment of the present invention, the sequence transcribed into saRNA comprises SEQ ID NO: 1.

[0037] Preferably, the vector comprises a viral vector or a non-viral vector.

[0038] Preferably, the viral vector comprises a lentiviral vector, a pseudoviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes simplex viral vector or a cytomegalovirus vector.

[0039] In a specific embodiment of the present invention, the vector is an adeno-associated virus vector, preferably GV478 (U6-MCS-CAG-EGFP).

[0040] Preferably, the treatment and / or prevention of altitude sickness comprises increasing the function or expression of PTPRM in heart tissue, lung tissue, pulmonary artery or cells.

[0041] Preferably, the cells are pulmonary artery endothelial cells or cardiac cells.

[0042] Preferably, the treatment and / or prevention of altitude sickness includes reducing hemoglobin content (concentration), reducing pulmonary circulation-right heart pressure, alleviating right ventricular hypertrophy and arterial vascular remodeling (such as arteriolar vascular remodeling), and the like.

[0043] Preferably, the altitude sickness includes diseases caused in a plateau environment, preferably including acute altitude sickness or chronic altitude sickness.

[0044] Further preferably, the acute mountain sickness includes one or more of plateau coma, high altitude pulmonary edema, high altitude cerebral edema, pulmonary hypertension, or a mixed disease in which abnormal brain and lung symptoms coexist.

[0045] Further preferably, the chronic altitude sickness includes one or more of altitude heart disease, altitude polycythemia, altitude hypertension or altitude hypotension.

[0046] In a specific embodiment of the present invention, the altitude sickness includes pulmonary hypertension.

[0047] Preferably, the plateau environment includes a plateau environment with an altitude of 2500m or more; preferably, the plateau environment is a plateau environment with an altitude of 5500m or more, for example, a plateau environment with an altitude of 2500, 3000, 3500, 4000, 4500, 5000 or 5500m or more.

[0048] Preferably, the product comprises a medicine.

[0049] A fourth aspect of the present invention provides a use of a PTPRM as a biomarker in the preparation of a product for early warning and / or diagnosis of altitude sickness.

[0050] Preferably, the early warning and / or diagnosis of altitude sickness includes detecting the PTPRM gene mRNA or its protein expression level or protein concentration.

[0051] Preferably, the product for early warning and / or diagnosis of altitude sickness includes a reagent for detecting the expression level or protein concentration of the PTPRM gene mRNA or its protein.

[0052] Preferably, the PTPRM is a PTPRM in lung tissue, pulmonary artery or cells.

[0053] Preferably, the cells are pulmonary artery endothelial cells.

[0054] Preferably, the reagents include one or more of reagents required for reverse transcription, reagents required for PCR, reagents required for BCA method (Bicinchoninic Acid Assay), reagents required for Western Blot method, reagents required for sequencing or reagents required for mass spectrometry.

[0055] Preferably, the early warning and / or diagnosis of altitude sickness includes comparing the PTPRM gene mRNA or its protein expression level or protein concentration with a threshold value, and the threshold value is obtained through preliminary experiments, that is, the threshold value is determined by analyzing the degree of difference in the PTPRM gene mRNA or its protein expression level or protein concentration between altitude sickness and healthy people through experiments and experimental data.

[0056] Preferably, when the PTPRM gene mRNA or its protein expression level or protein concentration is different or significantly different from the threshold value (the difference is statistically significant, such as p < 0.05, p < 0.01, p < 0.001, p < 0.0001), a warning of possible illness or diagnosis of illness is given. For example: when the PTPRM gene mRNA or its protein expression level or protein concentration is lower than the threshold value or significantly lower than the threshold value, an early warning and / or diagnosis of the occurrence of altitude sickness is given.

[0057] Preferably, the altitude sickness includes diseases caused in a plateau environment, preferably including acute altitude sickness or chronic altitude sickness.

[0058] Further preferably, the acute mountain sickness includes one or more of plateau coma, high altitude pulmonary edema, high altitude cerebral edema, pulmonary hypertension, or a mixed disease in which abnormal brain and lung symptoms coexist.

[0059] Further preferably, the chronic altitude sickness includes one or more of altitude heart disease, altitude polycythemia, altitude hypertension or altitude hypotension.

[0060] Preferably, the altitude sickness includes pulmonary hypertension.

[0061] Preferably, the plateau environment includes a plateau environment with an altitude of more than 2500m; preferably, the plateau environment is a plateau environment with an altitude of more than 5500m.

[0062] Preferably, the product comprises one or more of a diagnostic or early warning kit, a chip or a test strip.

[0063] In a fifth aspect of the present invention, a saRNA is provided, wherein the sense strand of the saRNA comprises SEQ ID NO: 2; and the antisense strand comprises SEQ ID NO: 3.

[0064] In a sixth aspect of the present invention, a vector is provided comprising the saRNA described in the fifth aspect or transcribed into the saRNA described in the fifth aspect, wherein the vector comprises SEQ ID NO: 1.

[0065] Preferably, the vector comprises a viral vector or a non-viral vector.

[0066] Preferably, the viral vector comprises a lentiviral vector, a pseudoviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes simplex viral vector or a cytomegalovirus vector.

[0067] In a specific embodiment of the present invention, the vector is an adeno-associated virus vector, preferably GV478 (U6-MCS-CAG-EGFP).

[0068] In the seventh aspect of the present invention, a cell, tissue or organ comprising the saRNA described in the fifth aspect and / or the vector described in the sixth aspect is provided.

[0069] Preferably, the cells are one or more of lung tissue cells, heart cells or spleen cells, and more preferably pulmonary artery endothelial cells.

[0070] Preferably, the tissue is one or more of lung tissue, heart tissue or spleen tissue.

[0071] Preferably, the organ is one or more of the lung, heart or spleen.

[0072] In the eighth aspect of the present invention, a drug is provided, which comprises the cells, tissues or organs described in the first aspect and / or the seventh aspect, the cells, tissues or organs obtained by the construction method described in the second aspect, the saRNA described in the fifth aspect, or the vector described in the sixth aspect.

[0073] The ninth aspect of the present invention provides a drug, wherein the drug comprises a vector, wherein the vector comprises a PTPRM coding sequence and / or a sequence regulating the expression of PTPRM. The relevant limitations on the vector are the same as those in the third aspect of the present invention.

[0074] Preferably, the drug contains pharmaceutically acceptable excipients.

[0075] Preferably, the pharmaceutically acceptable excipients include one or more of a diluent, an absorbent, a wetting agent, a binder, a disintegrant, a lubricant, a pH adjuster, an antioxidant, a metal ion chelator, an antibacterial agent or an isotonicity adjuster.

[0076] Preferably, the drug can be in any suitable dosage form, including but not limited to tablets, pills, powders, granules, capsules, lozenges, syrups, emulsions, suspensions, injections, sprays, aerosols, powder sprays, lotions, ointments, pastes, patches, eye drops, nasal drops, suppositories, effervescent tablets, pills or gels, etc. Preferably, the various dosage forms of the drug can be prepared according to conventional production methods in the pharmaceutical field.

[0077] Preferably, the drug can be administered by any suitable route, such as enteral administration (e.g. oral administration) or parenteral administration (e.g. intravenous injection, intramuscular injection, subcutaneous injection, intradermal injection, nasal drops, eye drops, intrathecal administration, transdermal administration, etc.).

[0078] Preferably, the drug may contain an active substance (e.g., the above-mentioned vector containing the PTPRM coding sequence and / or the vector containing a sequence for regulating PTPRM expression) in an amount of 0.01-99.5% (0.01%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99% or 99.5%) by weight or volume.

[0079] Preferably, the drug is for human or veterinary use.

[0080] In the tenth aspect of the present invention, a method for treating and / or preventing altitude sickness is provided, the method comprising administering to a subject an effective amount of the cells, tissues or organs described in the first and / or seventh aspects, the cells, tissues or organs obtained by the construction method described in the second aspect, the saRNA described in the fifth aspect, the vector described in the sixth aspect, or the drug described in the eighth and / or ninth aspect.

[0081] In an eleventh aspect of the present invention, a method for treating and / or preventing altitude sickness is provided, wherein the method comprises overexpressing PTPRM.

[0082] Preferably, the overexpression of PTPRM comprises the use of a vector, and the relevant limitations on the vector are the same as those in the third aspect of the present invention.

[0083] In the twelfth aspect of the present invention, a diagnostic or early warning kit, a chip or a test strip is provided, wherein the diagnostic or early warning kit, the chip or the test strip comprises a reagent for detecting PTPRM, preferably a reagent for detecting the expression level or protein concentration of the PTPRM gene mRNA or its protein.

[0084] Preferably, the reagents include one or more of reagents required for reverse transcription, reagents required for PCR, reagents required for BCA method, reagents required for Western Blot method, reagents required for sequencing or reagents required for mass spectrometry.

[0085] The thirteenth aspect of the present invention provides an application of overexpressing PTPRM in the preparation of a drug for treating and / or preventing pulmonary hypertension by reducing hemoglobin content (concentration), reducing pulmonary circulation-right heart pressure, alleviating right ventricular hypertrophy and / or arterial vascular remodeling (such as arteriolar vascular remodeling).

[0086] The fourteenth aspect of the present invention provides an application of overexpressing PTPRM in the preparation of a drug for reducing hemoglobin content (concentration), reducing pulmonary circulation-right heart pressure, alleviating right ventricular hypertrophy and / or arterial vascular remodeling (such as arteriolar vascular remodeling).

[0087] The term "prevention" as used herein refers to a method implemented to prevent or delay the occurrence of a disease, disorder or symptom in an organism.

[0088] As used herein, "treating" means slowing, interrupting, preventing, controlling, stopping, alleviating or reversing the progression or severity of a sign, symptom, disorder, condition or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions or disorders.

[0089] The "early warning" mentioned in the present invention refers to finding out whether the patient is likely to get sick or have symptoms in the future, or finding out the possible future progression of the disease.

[0090] The term "diagnosis" as used herein refers to finding out whether a patient has had a disease or condition in the past or at the time of diagnosis, or to finding out the progression of a disease.

[0091] The "effective amount" of the present invention refers to the amount or dosage of the product of the present invention that provides the desired treatment after administration to a subject in single or multiple doses.

[0092] The "subject" described in the present invention can be a human or a non-human animal, or a cell, tissue or organ of a human or non-human animal, and the non-human animal can be a wild animal, a zoo animal, an economic animal, a pet or an experimental animal, etc. Preferably, the non-human animal includes but is not limited to pigs, cattle, sheep, donkeys, foxes, minks, jackals, camels, dogs, cats, rabbits, mice (such as rats, mice, guinea pigs, hamsters, gerbils, chinchillas or squirrels, etc.) or monkeys, etc.

[0093] The "method" or "application" described in the present invention may be for therapeutic purposes or non-therapeutic purposes.

[0094] The term "include" or "comprising" as used in the present invention is an open description, which contains the specified components or steps described, as well as other specified components or steps that will not be substantially affected. When used to describe a protein or nucleic acid sequence, the protein or nucleic acid may consist of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the same or similar activity as the original sequence.

[0095] The "and / or" described in the present invention includes all combinations of items connected by the term, and each combination should be deemed to have been listed separately in the present application. For example, "A and / or B" includes "A", "B" and "A and B"; another example is "A, B and / or C", which includes "A", "B", "C", "A and B", "A and C", "B and C" and "A and B and C".

[0096] The term "pharmaceutically acceptable" as used herein refers to a substance that neither significantly irritates an organism nor inhibits the biological activity and properties of the active substance of the administered product. BRIEF DESCRIPTION OF THE DRAWINGS

[0097] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:

[0098] Figure 1 : The expression level of PCNA protein in HPAECs cells after simulating high altitude environment, where β-actin was used as internal reference;

[0099] Figure 2 : The expression level of PTPRM protein in HPAECs cells after simulating plateau environment, where β-actin was used as an internal reference;

[0100] Figure 3 : Model construction results, where A is the result of red blood cell (RBCs) counting, B is the hemoglobin concentration (HGB), C is the hematocrit (HCT), D is the result of mean pulmonary artery pressure (mPAP), E is the result of right ventricular systolic pressure (RVSP), F is the result of right ventricular hypertrophy index (RVHI=RV(LV+S)), and G is the result of evaluating arterial media thickness, vascular muscularization degree and cell proliferation rate by immunofluorescence and immunohistochemical staining; where ns means no significant difference, * means p<0.05, ** means p<0.01, *** means p<0.001; right heart hypertrophy index RVHI=RV(LV+S), where RV represents right ventricle, LV represents left ventricle, and S represents ventricular septum tissue;

[0101] Figure 4 : The expression level of PTPRM in rat pulmonary artery after simulated plateau environment;

[0102] Figure 5 : The expression level of PTPRM in mouse lung tissue after simulating high altitude environment, where β-actin was used as internal reference;

[0103] Figure 6 : The detection results of mean pulmonary artery pressure after overexpression of PTPRM, ns means the difference is not statistically significant, ** means p < 0.01, *** means p < 0.001;

[0104] Figure 7 : The expression level of PCNA protein after overexpression of PTPRM, where β-actin was used as the internal reference;

[0105] Figure 8 : The expression level of Caspase3 protein after overexpression of PTPRM, where β-actin was used as an internal reference;

[0106] Fig. 9 : The expression level of PTPRM protein, wherein β-actin was used as the internal reference, NC-1 and NC-2 were two experimental repetitions of the first group, and AAV-1 and AAV-2 were two experimental repetitions of the second group. DETAILED DESCRIPTION

[0107] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0108] Some of the materials and methods used in this application are as follows:

[0109] 1. Materials and methods

[0110] 1.1 Animals

[0111] SD rats (about 250 g, male, clean grade) and C57BL / 6Jnifdc mice were purchased from Beijing Weitonglihua Experimental Animal Co., Ltd., license number: SCXK (Beijing) 2016-0006. They were raised in a hypobaric oxygen chamber and fed with complete nutritional feed at room temperature of 22-25°C and humidity of 30%-50%.

[0112] 1.2 Instruments

[0113] Small animal hypobaric oxygen chamber (Binglun Hyperbaric Oxygen Chamber Co., Ltd.); small animal ventilator (kent scientific); multi-function physiological instrument (Millar); small animal ultrasound (Visual Sonics Inc); personalized cell precision control system (Avatar); Q-PCR instrument (Bio-Rad).

[0114] 1.3 Animal index detection method and tissue separation method

[0115] 3% sodium pentobarbital, 0.2mL / 100g, was intraperitoneally injected to anesthetize rats / mice, and ultrasound detection was performed. The rats / mice were then fixed in a supine position on the operating table, the trachea was cut, the ventilator was connected, the chest was opened, the heart was exposed, and the catheter was inserted into the right ventricle for right heart catheter detection. The rats / mice were killed, the heart was removed, the atrial tissue and attached fat were removed, the left and right ventricles were separated, the lung tissue was taken, the water was absorbed by filter paper, and the weights were weighed separately, and the pulmonary artery was separated.

[0116] 1.4 PTPRM gene expression detection method

[0117] Aspirate the cell culture medium or animal tissue blocks, wash the cells / tissues twice with ice-cold PBS, extract RNA according to the requirements of the RNA extraction kit, and measure the concentration. According to the requirements of the RNA reverse transcription kit, reverse transcribe the RNA into cDNA and store it at -80°C. After diluting the cDNA 10 times, establish a 20ul system according to the requirements of the Q-PCR kit, set up the standard reaction mode and dissolution curve, and run the program.

[0118] 1.5. PTPRM protein expression detection method

[0119] Aspirate the cell culture medium or animal tissue blocks, wash the cells / tissues twice with ice-cold PBS, extract proteins with RIPA protein lysis buffer, and determine protein concentration using the BCA method. Detect PTPRM protein expression using Western Blot.

[0120] 1.6 Statistical methods

[0121] All data are expressed as x±s, and the comparison among groups was performed by one-way analysis of variance, *p<0.05; **p<0.01; ***p

[0122] <0.001, and SPSS19.0 software package was used for statistical analysis.

[0123] Example 1: Marker screening

[0124] Through KEGG enrichment analysis, we selected mRNAs differentially expressed in hypoxia-related signaling pathways such as HIF-1, PI3K-Akt, and Wnt, and found that PTPRM was involved in multiple signaling pathways such as adhesion junctions and CAMs, and participated in multiple biological processes, including endothelial cell proliferation, apoptotic cell clearance, and cell differentiation. Therefore, we speculated that PTPRM may be involved in the cell proliferation and apoptosis process of pulmonary hypertension, and play an important role in the development of pulmonary hypertension.

[0125] Example 2: Cell level validation

[0126] 1. Cell experiment design: Pulmonary artery endothelial cells (HPAECs) were cultured in DMEM medium containing 10% fetal bovine serum and randomly divided into 2 groups. One group was placed in an individualized cell precision control system with oxygen concentration adjusted to 1% and oxygen partial pressure to 0.6PSI to simulate the plateau environment (Hyp group), and the other group of cells was cultured in a normal pressure and normoxic CO2 cell culture incubator for 24 h (Nor group).

[0127] 2. Results

[0128] Hypobaric and hypoxic treatment simulates the oxygen concentration and pressure of the plateau. Compared with the Nor group, the expression of PCNA protein (proliferating cell nuclear antigen) in HPAECs cells in the Hyp group was significantly increased after 24 hours of hypobaric and hypoxic treatment. Figure 1 This indicates that after low pressure and low oxygen treatment, HPAECs cells show a proliferative phenotype, indicating the symptoms of altitude sickness (especially pulmonary hypertension).

[0129] In addition, after HPAECs cells were cultured in a low-pressure and low-oxygen environment for 24 h, the expression of PTPRM in HPAECs cells in the Hyp group was significantly downregulated compared with that in the Nor group (P < 0.05). Figure 2 .

[0130] Example 3: Animal Experiment Verification

[0131] 1. Experimental design

[0132] Twenty rats were randomly divided into two groups, with 10 rats in each group. The first group (Hyp) was placed in an experimental cabin with the pressure adjusted to 380 mmHg to simulate the plateau environment of 5,500 meters above sea level. At the same time, the rats were kept in an environment with a 12:12 hour day and night alternation. They were raised for 28 days. The second group (Nor) rats were placed in the same room under normal pressure and normoxic environment and raised for 28 days.

[0133] 2. Model construction results

[0134] The characteristics of pulmonary hypertension include increased hemoglobin concentration, increased pulmonary circulation-right heart pressure, right ventricular hypertrophy, and arteriolar vascular remodeling. Figure 3 As shown, the details are as follows:

[0135] (1) Blood routine test results of experimental animals

[0136] The number of red blood cells (RBCs) and hemoglobin concentration (HGB) were analyzed by routine blood tests, and the hematocrit (HCT) was calculated. The RBC count results, HGB concentration, and HCT values ​​of rats increased with the extension of the simulated plateau environment. The RBC count began to increase significantly on the 14th day (p<0.001), and the HGB and HCT values ​​increased significantly on the 3rd day (p<0.001). Figure 3 As shown in Figure AC.

[0137] (2) Hemodynamic results

[0138] Right ventricular systolic pressure (RVSP) and mean pulmonary artery pressure (mPAP) were measured by hemodynamics. The RVSP and mPAP of rats raised in a low-pressure and low-oxygen environment increased over time, and the mPAP on the 28th day was 32.1976±1.2643mmHg (greater than 20mHg), indicating that the pulmonary hypertension model was successfully established. Figure 3 As shown in D and E.

[0139] (3) Heart weighing results

[0140] The degree of right ventricular hypertrophy was evaluated by measuring the right ventricular hypertrophy index (RVHI) by heart weighing. The RVHI of rats increased with the extension of the simulated plateau environment, and significant differences began to appear on the 7th day (P<0.001). Figure 3 As shown in F.

[0141] (4) Immunohistochemistry and immunofluorescence staining results

[0142] Immunofluorescence and immunohistochemistry were used to evaluate the arterial media thickness (MWT), vascular muscularization, and cell proliferation rate. Compared with day 0, the MWT, muscularization, and proliferation rate of rats raised in a hypobaric and hypoxic environment for 21 days were significantly increased (P<0.001). Figure 3 As shown in G.

[0143] 3. Detection of PTPRM expression levels in pulmonary artery and lung tissue

[0144] like Figure 4 As shown, after the rats were kept in a low-pressure and low-oxygen environment for 21 days, the expression of PTPRM in the pulmonary artery of the Hyp group rats was significantly downregulated compared with that of the Nor group.

[0145] Mice were used for further verification. The mice were grouped in the same way as rats. The results showed that the expression of PTPRM in the lung tissue of mice raised in a simulated high altitude environment was also significantly downregulated compared with that of mice raised in a normobaric and normoxic environment (see Figure 5 ).

[0146] Example 4: Effects of overexpression of PTPRM on lung tissue cell proliferation, apoptosis and mean pulmonary artery pressure

[0147] Twenty-four mice were randomly divided into four groups, with six mice in each group. The first group (Nor-NC group) was injected with 5E+10 v.g. of adeno-associated virus negative control through the trachea and placed in a normal pressure and normoxic environment; the second group (Nor-AAV group) was injected with 5E+10 v.g. of adeno-associated virus (overexpression vector GV478, purchased from GeneCare, catalog number: GIDV0429100, vector structure including U6-MCS-CAG-EGFP, transcription of saRNA is regulated by U6 promoter) through the trachea and placed in a normal pressure and normoxic environment; the third group (Hyp-NC group) was injected with 5E+10 v.g. of adeno-associated virus negative control through the trachea and placed in an experimental chamber; the fourth group (Hyp-AAV group) was injected with 5E+10 v.g. of adeno-associated virus (SEQ ID NO: 1) through the trachea and placed in a normal pressure and normoxic environment. NO: 1) adeno-associated virus (overexpression vector GV478) and placed in an experimental chamber. The chamber pressure was adjusted to 380 mmHg to simulate the plateau environment of 5,500 meters above sea level, while maintaining a 12:12 hour day and night cycle in the environment where the mice were located. The four groups of mice were raised for 21 days.

[0148] SEQ ID NO: 1:

[0149] accggGCAAATGGAGAGTGTCTTGAAttcaagagaTTCAAGACACTCTCCATTTGCttttt

[0150] The sense strand of saRNA is SEQ ID NO: 2, and the antisense strand is SEQ ID NO: 3.

[0151] SEQ ID NO: 2: GCAAATGGAGAGTGTCTTGAA

[0152] SEQ ID NO: 3: TTCAAGACACTCTCCATTTGC

[0153] After intratracheal injection, PTPRM of mice was overexpressed in the lungs (e.g., lung tissue, lung cells), heart, and spleen. Taking mouse lung tissue as an example, the expression results of PTPRM can be found in Fig. 9 (Among them, NC-1 and NC-2 are two experimental repetitions of the first group, and AAV-1 and AAV-2 are two experimental repetitions of the second group).

[0154] The results are as follows Figure 6 As shown in the figure, after simulating high altitude environment, the mean pulmonary artery pressure of mice increased, while after overexpression of PTPRM in mice, the mean pulmonary artery pressure of the Hyp-AAV group was significantly reduced compared with the Hyp-NC group. Figure 7 and Figure 8 It also showed that after simulating the plateau environment, the proliferation of mouse lung tissue cells (HPAECs) increased and apoptosis decreased, while after overexpression of PTPRM, the proliferation of mouse lung tissue cells (HPAECs) decreased and apoptosis increased. The above results indicate that PTPRM has a warning and potential therapeutic value for pulmonary hypertension.

[0155] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0156] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

Claims

1. A cell, tissue or organ, characterized in that: The cells, tissues or organs overexpress PTPRM.

2. Use of PTPRM as a target or the cells, tissues or organs described in claim 1 in the preparation of products for the treatment and / or prevention of altitude sickness.

3. The use according to claim 2, characterized in that: The product for treating and / or preventing altitude sickness comprises an agent expressing PTPRM; Preferably, the reagent for expressing PTPRM includes one or more of a vector, a factor promoting transcription of the PTPRM gene, or a PTPRM protein agonist; Preferably, the vector contains a PTPRM coding sequence and / or a sequence regulating the expression of PTPRM; Further preferably, the sequence regulating the expression of PTPRM includes a sequence transcribed into saRNA; Preferably, the sequence transcribed into saRNA comprises SEQ ID NO: 1; Preferably, the sense strand of the saRNA comprises SEQ ID NO: 2; the antisense strand comprises SEQ ID NO: 3; Preferably, the vector comprises a viral vector or a non-viral vector; Further preferably, the viral vector comprises a lentiviral vector, a pseudoviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes simplex viral vector or a cytomegalovirus vector.

4. The use of PTPRM as a biomarker in the preparation of products for early warning and / or diagnosis of altitude sickness.

5. The use according to claim 4, characterized in that: The product for early warning and / or diagnosis of altitude sickness includes a reagent for detecting the expression level or protein concentration of the PTPRM gene mRNA or its protein; Preferably, the reagents include one or more of reagents required for reverse transcription, reagents required for PCR, reagents required for BCA method, reagents required for Western Blot method, reagents required for sequencing or reagents required for mass spectrometry.

6. The use according to claim 4 or 5, characterized in that: The PTPRM is a PTPRM in lung tissue, pulmonary artery or cells; Preferably, the cells are pulmonary artery endothelial cells.

7. The use according to any one of claims 2 to 6, characterized in that: The altitude sickness includes diseases caused by high altitude environment, preferably including acute altitude sickness or chronic altitude sickness; Further preferably, the acute mountain sickness includes one or more of plateau coma, high altitude pulmonary edema, high altitude cerebral edema, pulmonary hypertension, or a mixed disease with abnormal brain and lung symptoms; Further preferably, the chronic high altitude sickness includes one or more of high altitude heart disease, high altitude polycythemia, high altitude hypertension or high altitude hypotension; Preferably, the altitude sickness includes pulmonary hypertension.

8. The use according to claim 7, characterized in that: The plateau environment includes a plateau environment with an altitude of more than 2500m; preferably, the plateau environment is a plateau environment with an altitude of more than 5500m.

9. The use according to any one of claims 2 to 8, characterized in that: The products include one or more of diagnostic or early warning kits, chips, test strips or drugs.

10. A saRNA, characterized in that The sense strand of the saRNA comprises SEQ ID NO: 2; the antisense strand comprises SEQ ID NO: 3.

Images