A phi29 dna polymerase mutant and uses thereof
By mutating the amino acid sequence of Phi29 DNA polymerase and introducing a palm domain, a mutant protein capable of efficiently utilizing artificially modified substrates under Mg2+ conditions was prepared. This solved the problem of the difficulty in amplifying Phi29 DNA polymerase in nanopore sequencing technology, and improved sequencing efficiency and accuracy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-27
- Publication Date
- 2026-03-20
AI Technical Summary
When using Mg2+ ion catalysis, Phi29 DNA polymerase has difficulty effectively utilizing artificially modified substrates for DNA extension and amplification, which limits its application potential in nanopore sequencing technology.
By mutating the amino acid sequence of Phi29 DNA polymerase and introducing a palm domain, a mutant protein with DNA polymerase activity was prepared, which can efficiently utilize artificially modified substrates for DNA synthesis, replication, or amplification under Mg2+ conditions.
It significantly improved the efficiency and ability of Phi29 DNA polymerase to extend and amplify DNA using non-natural substrates under Mg2+ conditions, thereby enhancing the accuracy and speed of nanopore sequencing technology.
Smart Images

Figure CN119736271B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to a phi29 DNA polymerase mutant and use thereof. BACKGROUND
[0002] DNA polymerase plays a crucial role in regulating the process of DNA replication in the body, and it participates in and ensures the accurate transmission of genetic information in the body. With the continuous progress of science and technology, the research on the modification of polymerase is also deepening, which makes the DNA sequencing technology gradually perfect and develop. In the polymerase-nanopore sequencing system, clear electrochemical signals can be generated, and this process highly depends on whether the polymerase can effectively use artificial substrates for synthesis. The efficiency of this synthesis directly affects the accuracy and speed of sequencing, so the optimization of polymerase function is the key to improve the performance of sequencing technology.
[0003] Phi29 DNA polymerase is a polymerase derived from Phi29 bacteriophage in Bacillus subtilis, which is classified as B family DNA polymerase. This enzyme is favored due to its excellent sustained synthesis ability, strand displacement activity, high fidelity and low amplification bias. It is widely used in DNA library amplification in rolling circle replication or multiple displacement amplification technology to meet the large amount of library required for gene sequencing. However, due to the difficulty of Phi29 DNA polymerase in using artificial modified substrates for DNA extension and amplification when catalyzed by Mg 2+ ions, its application potential in nanopore sequencing technology is limited to some extent. Therefore, in order to make Phi29 DNA polymerase better adapt to the needs of polymerase-nanopore sequencing system, scientists need to continuously improve and optimize its properties. SUMMARY
[0004] Therefore, the technical problem to be solved by the present application is to provide a phi29 DNA polymerase mutant and use thereof.
[0005] To this end, the present application provides the following technical solutions:
[0006] A protein is selected from at least one of the following:
[0007] (A) the protein has an amino acid sequence of the wild-type phi29 DNA polymerase, and comprises at least one of the following mutation sites: M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S, and / or F526L, compared with the wild-type phi29 DNA polymerase;
[0008] (B) the protein has at least one palm domain, compared with the wild-type phi29 DNA polymerase, to obtain a protein having DNA polymerase activity.
[0009] Optionally, the palm domain is located between the 86th and 87th amino acids of the wild-type phi29 DNA polymerase.
[0010] Optionally, the amino acid sequence of the palm domain is KTVFSKGAPYQTVTDVEE (see SEQ ID NO. 26).
[0011] Optionally, the wild-type phi29 DNA polymerase has an amino acid sequence as shown in SEQ ID NO. 21.
[0012] Optionally, the protein has an amino acid sequence as shown in any of SEQ ID NO. 1-10.
[0013] The present application provides a biomaterial, which is any of the following:
[0014] 1) a nucleic acid molecule encoding the protein; optionally, the nucleic acid molecule comprises a DNA molecule or an RNA molecule;
[0015] 2) a vector containing the nucleic acid molecule of 1).
[0016] The present application provides the protein and the biomaterial for any of the following uses:
[0017] B1, catalyzing DNA replication and / or catalyzing DNA amplification;
[0018] B2, catalyzing rolling circle amplification or catalyzing multiple strand displacement amplification;
[0019] B3, performing DNA sequencing or RNA sequencing or whole genome sequencing;
[0020] B4, constructing a sequencing library;
[0021] B5, preparing a product catalyzing DNA replication and / or catalyzing DNA amplification;
[0022] B6. Preparing a product of catalytic rolling circle amplification or catalytic multiple strand displacement amplification;
[0023] B7. Preparing a product for DNA sequencing or RNA sequencing or whole genome sequencing;
[0024] B8. Preparing a product for constructing a sequencing library.
[0025] Optionally, in the use, comprising:
[0026] using Mg 2+ Catalyzing synthesis, replication or amplification of DNA using a substrate artificially modified, or improving Mg 2+ Selectivity of DNA polymerase catalyzing synthesis, replication or amplification of DNA using a substrate artificially modified.
[0027] Optionally, the substrate artificially modified refers to deoxyribonucleotide modified with oligonucleotide or its analog.
[0028] The present application provides an enzyme preparation comprising the protein.
[0029] Optionally, the enzyme preparation is as a polymerase; optionally, as a DNA polymerase; optionally, as a DNA polymerase using Mg 2+ Catalyzing synthesis, replication or amplification of DNA using a substrate artificially modified, or improving Mg 2+ DNA polymerase catalyzing selectivity of DNA using a substrate artificially modified.
[0030] The present application provides a kit for catalyzing DNA replication, catalyzing DNA amplification, library construction or library sequencing, comprising the protein or the biological material.
[0031] The technical scheme of the present application has the following advantages:
[0032] 1. A protein according to the present invention, selected from at least one of: (A) the protein has an amino acid sequence compared with wild-type phi29 DNA polymerase, comprising at least one of the following mutation sites: M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S, and / or F526L; (B) the protein has at least one palm domain compared with wild-type phi29 DNA polymerase, to obtain a protein having DNA polymerase activity; the research results of the present invention reveal an important finding that the specific mutants M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S, and / or F526L, and the mutant form of phi29 DNA polymerase having a "palm" domain obtained by screening can significantly improve the efficiency and ability of DNA extension amplification using unnatural substrates under conditions containing magnesium ions (Mg 2+ ). BRIEF DESCRIPTION OF DRAWINGS
[0033] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the specific embodiments or prior art description will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.
[0034] Figure 1 is the electrophoretic identification result of Ion_1~Ion_6 polymerase in Example 1 of the present invention;
[0035] Figure 2 is the electrophoretic identification result of Ion_7~Ion_9 polymerase in Example 1 of the present invention;
[0036] Figure 3 is the electrophoretic identification result of Ion_10~Ion_11 polymerase in Example 1 of the present invention;
[0037] Figure 4 is the recombinant plasmid map constructed in Example 1 of the present invention;
[0038] Figure 5is the electrophoresis result of the extension product of Ion_1~Ion_9 polymerase in Example 2 of the present application;
[0039] Figure 6 is the electrophoresis result of the extension product of Ion_10~Ion_11 polymerase in Example 2 of the present application. DETAILED DESCRIPTION
[0040] The following examples are provided to better enable those skilled in the art to further understand and practice the application, and are not intended to limit the scope of the application. Any product derived from the application or any product derived from the application in combination with other prior art features that is equivalent or similar to the application falls within the scope of the application.
[0041] The specific experimental steps or conditions are not indicated in the examples, which can be carried out according to the conventional experimental steps or conditions described in the literature in the art. The reagents or instruments used are not indicated by the manufacturer, which are conventional reagent products that can be obtained by purchase.
[0042] Phi29 DNA polymerase is derived from Bacillus subtilis. Phi29 DNA polymerase is widely used in rolling circle replication or multiple displacement amplification technology. However, when Phi29 DNA polymerase is catalyzed by ions, it is difficult to use artificially modified substrates to extend and amplify DNA. The artificially modified substrate is a substrate modified from a natural substrate, and the natural substrate is A: deoxyadenine nucleotide (abbreviated as deoxyadenosine), T: deoxythymine nucleotide (abbreviated as deoxythymidine), C: deoxycytidine nucleotide (abbreviated as deoxycytidine), and G: deoxyguanine nucleotide (abbreviated as deoxyguanosine). 2+ Ion catalysis, it is difficult to use artificially modified substrates to extend and amplify DNA. The artificially modified substrate is a substrate modified from a natural substrate, and the natural substrate is A: deoxyadenine nucleotide (abbreviated as deoxyadenosine), T: deoxythymine nucleotide (abbreviated as deoxythymidine), C: deoxycytidine nucleotide (abbreviated as deoxycytidine), and G: deoxyguanine nucleotide (abbreviated as deoxyguanosine).
[0043] To this end, the embodiments of the present application provide a protein selected from at least one of the following:
[0044] (A) The protein has at least one of the following mutation sites compared with the amino acid sequence of the wild type phi29 DNA polymerase: M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S, and / or F526L;
[0045] (B) The protein has at least one palm domain compared with the amino acid sequence of the wild type phi29 DNA polymerase, and the protein has DNA polymerase activity.
[0046] In some embodiments, the protein has at least one amino acid mutation, at least two amino acid mutations, at least three amino acid mutations, at least four amino acid mutations, at least five amino acid mutations, at least six amino acid mutations, at least seven amino acid mutations, at least eight amino acid mutations, at least nine amino acid mutations, at least ten amino acid mutations, at least eleven amino acid mutations, at least twelve amino acid mutations, at least thirteen amino acid mutations, at least fourteen amino acid mutations, at least fifteen amino acid mutations, at least sixteen amino acid mutations, or any range of values between any two of these numbers of amino acid mutations, as compared to the amino acid sequence of wild-type phi29 DNA polymerase. The amino acid mutations include at least one of M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S, and / or F526L.
[0047] Further, in some embodiments, the protein has any one of M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S, and / or F526L, as compared to the amino acid sequence of wild-type phi29 DNA polymerase.
[0048] Further, in some embodiments, the protein is a phi29 DNA polymerase having an amino acid sequence that differs from the wild-type phi29 DNA polymerase, for example, by one or more of the following: M97K and L253A, M97K and T368M, M97K and Y369E, M97K and E375D, M97K and Q380L, M97K and A382L, M97K and A484R, M97K and A484E, M97K and E508F, M97K and D510M, M97K and V514Q, M97K and V514D, M97K and V514S, L253A and T368M, L253A and Y369E, L253A and E375D, L253A and Q380L, L253A and A382L, L253A and A484R, L253A and A484E, L253A and E508F, L253A and D510M, L253A and V514Q, L253A and V514D, L253A and V514S, T368M and Y369E, T368M and E375D, T368M and Q380L, T368M and A382L, T368M and A484R, T368M and A484E, T368M and E508F, T368M and D510M, T368M and V514Q, T368M and V514D, T368M and V514S, Y369E and E375D, Y369E and Q380L, Y369E and A382L, Y369E and A484R, Y369E and A484E, Y369E and E508F, Y369E and D510M, Y369E and V514Q, Y369E and V514D, Y369E and V514S, E375D and Q380L, E375D and A382L, E375D and A484R, E375D and A484E, E375D and E508F, E375D and D510M, E375D and V514Q, E375D and V514D, E375D and V514S, Q380L and A382L, Q380L and A484R, Q380L and A484E, Q380L and E508F, Q380L and D510M, Q380L and V514Q, Q380L and V514D, Q380L and V514S, A382L and A484R, A382L and A484E, A382L and E508F, A382L and D510M, A382L and V514Q, A382L and V514D, A382L and V514S, A484R and E508F, A484R and D510M, A484R and V514Q, A484R and V514D, A484R and V514S, A484E and E508F, A484E and D510M, A484E and V514Q, A484E and V514D,any one of the group of amino acid mutations M97K, L253A, and T368M, Y369E, E375D, and Q380L, A382L, A484R, and E508F, E508F, D510M, and V514Q, M97K, L253A, and V514D, Y369E, E375D, and V514S, M97K, E375D, and E508F, Y369E, A382L, and E508F, L253A, E375D, and D510M, etc.
[0049] Further, in some embodiments, the protein has at least one palm domain compared to the amino acid sequence of wild-type phi29 DNA polymerase.
[0050] Further, in some embodiments, the protein has at least one palm domain compared to the amino acid sequence of wild-type phi29 DNA polymerase.
[0051] Further, in some embodiments, the protein has at least one palm domain compared to the amino acid sequence of wild-type phi29 DNA polymerase.
[0052] Further, in some embodiments, the protein has at least one palm domain compared to the amino acid sequence of wild-type phi29 DNA polymerase.
[0053] Further, in some embodiments, the protein has both amino acid mutations and a palm domain compared to the amino acid sequence of wild-type phi29 DNA polymerase. The amino acid mutations can be any one of at least 1 amino acid mutation, at least 2 amino acid mutations, at least 3 amino acid mutations, at least 4 amino acid mutations, at least 5 amino acid mutations, at least 6 amino acid mutations, at least 7 amino acid mutations, at least 8 amino acid mutations, at least 9 amino acid mutations, at least 10 amino acid mutations, at least 11 amino acid mutations, at least 12 amino acid mutations, at least 13 amino acid mutations, at least 14 amino acid mutations, at least 15 amino acid mutations, at least 16 amino acid mutations or a range between any two of the number of amino acid mutations. The palm domain can be at least 1 palm domain.
[0054] Further, in some embodiments, the amino acid sequence of the palm domain can be KTVFSKGAPYQTVTDVEE.
[0055] Further, in some embodiments, the palm domain is located between position 86 and position 87 of the wild-type phi29 DNA polymerase.
[0056] Further, in some embodiments, the amino acid sequence of the wild-type phi29 DNA polymerase has the amino acid sequence as shown in SEQ ID NO. 21.
[0057] Further, in the preferred embodiments, the protein can be phi29 DNA polymerase Ion_1 (mutant sites: N62D, M97K, L253A, T368M, Q380L, A382F, A484R, E508F, D510M, F526L), phi29 DNA polymerase Ion_3 (mutant sites: N62D, M97K, L253A, T368M, Q380L, A382F, A484R, E508F, V514S, F526L), phi29 DNA polymerase Ion_4 (mutant sites: N62D, M97K, L253A, T368M, Q380L, A382F, A484R, E508F, V514D, F526L), phi29 DNA polymerase Ion_5 (mutant sites: N62D, M97K, L253A, T368M, Q380L, A382F, A484R, E508F, V514Q, F526L), phi29 DNA polymerase Ion_6 (mutant sites: N62D, M97K, L253A, T368M, Q380L, A382F, A484R, E508F, F526L), phi29 DNA polymerase Ion_7 (mutant sites: N62D, L253A, T368M, Q380L, A382F, A484R, F526L), phi29 DNA polymerase Ion_8 (mutant sites: N62D, L253A, T368M, Y369E, E375D, Q380L, A382F, A484R, F526L), phi29 DNA polymerase Ion_9 (mutant sites: N62D, L253A, T368M, Q380L, A382L, A484R, F526L), phi29 DNA polymerase Ion_10 (relative to wild-type phi29 DNA polymerase, mutant sites: M8R, D12A, (sequence KTVFSKGAPYQTVTDVEE between 86 and 87), M97K, G197D, F526L, E508F, V514Q), phi29 DNA polymerase Ion_11 (mutant sites: M8R, D12A, M97K, G197D, F526L, E508F, V514Q). Further, the protein has an amino acid sequence as shown in any of SEQ ID NO. 1-10, and a gene sequence encoding the protein is shown in SEQ ID NO. 11-20.
[0058] Further, in some embodiments, the protein can further comprise at least one substitution, deletion and / or addition of amino acid based on the amino acid sequence described above, and the resulting enzyme has enzymatic activity. The number of substitution, deletion or addition of amino acid can be any number, such as 1, 3, 5, 7, 10, and more, so that the sequence identity of the changed amino acid sequence to its respective original sequence can be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more.
[0059] Further, in some embodiments, the protein further comprises a tag. In some embodiments, the tag is fused to the terminus of the protein. In some embodiments, the tag is fused to the C-terminus. In some embodiments, the tag is His-tag (such as consecutive 6 histidine residues), including but not limited to.
[0060] The embodiments of the present application provide biomaterials, which are any one of the following:
[0061] 1) a nucleic acid molecule encoding the protein; optionally, the nucleic acid molecule comprises a DNA molecule or an RNA molecule;
[0062] 2) a vector comprising the nucleic acid molecule of 1).
[0063] As used herein, the terms "polynucleotide" and "nucleic acid molecule" can be used interchangeably and include DNA molecules or RNA molecules. The DNA molecules can be single-stranded or double-stranded.
[0064] Due to the degeneracy of the genetic code, a large number of polynucleotides can be obtained for encoding the enzymes of the present application, and thus, in the case where a specific amino acid sequence has been identified, a person skilled in the art can prepare any number of different nucleic acids by simply modifying the sequence of one or more codons in a manner that does not change the amino acid sequence of the encoded protein. The more preferred polynucleotides can be selected by codon optimization according to the preference of the host cell used in the actual preparation process.
[0065] The polynucleotides can be obtained by conventional methods, such as PCR amplification or artificial synthesis methods, etc. At present, the polynucleotide sequences can be obtained completely by chemical synthesis.
[0066] In some embodiments, the vector can be a recombinant vector or an expression vector, which can be transformed into a host cell to express the nucleic acid molecule or the enzyme.
[0067] As used herein, "vector" refers to a construct capable of delivering, preferably expressing in a host cell, one or more genes or sequences of interest to a host cell. Vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, cosmids, or phage vectors, DNA or RNA expression vectors bound to cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes.
[0068] Embodiments of the present application provide the use of the protein, the biomaterial as described in any one of the following:
[0069] B1, catalyzing DNA replication and / or catalyzing DNA amplification;
[0070] B2, catalyzing rolling circle amplification or catalyzing multiple strand displacement amplification;
[0071] B3, performing DNA sequencing or RNA sequencing or whole genome sequencing;
[0072] B4, constructing sequencing library;
[0073] B5, preparing products catalyzing DNA replication and / or catalyzing DNA amplification;
[0074] B6, preparing products catalyzing rolling circle amplification or catalyzing multiple strand displacement amplification;
[0075] B7, preparing products performing DNA sequencing or RNA sequencing or whole genome sequencing;
[0076] B8, preparing products for constructing sequencing library.
[0077] In some embodiments, in the use, comprises: utilizing Mg 2+ catalyzing synthesis, replication or amplification of DNA on an artificially modified substrate, or improving Mg 2+ selectivity of catalyzing synthesis, replication or amplification of DNA on an artificially modified substrate.
[0078] The artificially modified substrate refers to deoxyribonucleotides with oligonucleotide or its analog modification. The deoxyribonucleotides with oligonucleotide or its analog modification include at least one of natural A, T, C, G modified by oligonucleotide or its analog. The oligonucleotide or its analog modification includes but is not limited to oligomer modification with 10, 20, 30, or 40 deoxyribonucleic acid linkage, polyphosphate modification, abasic oligonucleotide modification, 2' position sugar modification, 5' position pyrimidine modification, 8' position purine modification, exocyclic amine modification, 4-thiouridine substitution, 5-bromo or 5-iodo-uracil substitution, backbone modification, phosphorothioate or alkylphosphonate modification, methylation, and unusual base pairing combinations such as isobase isocytidine and isouridine; 3' and 5' modifications such as capping; and phosphate backbone modification, etc. For example, T40HA, D8G, A30A, N045, N036, N050, and N033.
[0079] The embodiments of the present application provide an enzyme preparation comprising the protein. In some embodiments, the enzyme preparation is as a polymerase; optionally, as a DNA polymerase; optionally, as a DNA polymerase utilizing Mg 2+ catalyzes DNA synthesis, replication, or amplification of artificially modified substrates or improves Mg 2+ catalyzes DNA synthesis, replication, or amplification of artificially modified substrates or improves Mg
[0080] The embodiments of the present application provide a kit for catalyzing DNA replication, catalyzing DNA amplification, library construction, or library sequencing, comprising the protein or the biological material.
[0081] In some embodiments, the library sequencing includes but is not limited to nanopore sequencing.
[0082] In some embodiments, the catalyzing DNA amplification includes but is not limited to strand displacement reaction, polymerase chain reaction. The isothermal amplification reaction includes but is not limited to at least one of loop-mediated amplification (LAMP), rolling circle amplification (RCA), strand displacement amplification (SDA), multiple displacement amplification (MDA), and cross primer amplification (CPA).
[0083] In some embodiments, the kit includes but is not limited to at least one of reaction buffer, magnesium ion solution, nucleotide substrate, dithiothreitol (DTT), potassium chloride.
[0084] In some embodiments, the nucleotide substrate includes at least one of natural A, T, C, G modified by oligonucleotide or its analog.
[0085] In some embodiments, the final concentration of potassium chloride in the kit is 50 mM, 100 mM, 150 mM, 200 mM or more.
[0086] Example 1 Preparation of phi29 DNA polymerase mutants
[0087] This example provides the preparation of phi29 DNA polymerase mutants, including the following steps:
[0088] 1. Design genes encoding phi29 DNA polymerase mutants, each of which is named as follows:
[0089] Table 1
[0090]
[0091]
[0092] II. Connecting the gene expression sequence to the gene expression vector pET-30a+;
[0093] The coding genes in Table 1 above and the recombinant plasmids inserted with the coding genes were all constructed by Kingsway Biotech. The recombinant plasmid map after construction is shown as follows: Figure 4 The exemplary sequence of the constructed recombinant plasmid is shown as SEQ ID NO. 23, and other recombinant plasmids are distinguished by the replacement of the inserted target genes.
[0094] III. Induced expression, collection and purification of polymerase
[0095] The recombinant plasmids inserted with the DNA polymerase gene expression sequences above were respectively transformed into E. coli ER2566 super-competent cells (Bi Yun Tian Biotechnology, D1039S). Inoculated into kanamycin-resistant medium, 37°C, 5% CO2 culture for 12 hours, after resistance screening, 5 μL of bacterial inoculum was inoculated into 5 mL of LB liquid medium and cultured at 37°C overnight, then transferred into 10 mL of LB liquid medium and cultured at 37°C for 3 hours, when OD 600nm = 0.6, the bacterial solution was taken out and cooled at 4°C, after cooling, 0.6 mM of IPTG was added for induction, and the shaking culture was continued at 16°C for 20 hours. Co 2+Column affinity chromatography purification, using different concentrations of imidazole elution solution to elute the polymerase protein. Elution solution components are 50 mM Tris, 200 mM KCl, 0.5% Tween-20, 5 mM TCEP (tris (2-chloroethyl) phosphate), different concentrations of imidazole (100 mM, 150 mM, 200 mM, and 300 mM). The protein of the eluate of the components of 150 mM and 200 mM imidazole concentrations was combined, and the polymerase was concentrated using an ultrafiltration column AMICON ULTRA 15 mL 50K (Millipore Corporation, Catalog No: UFC905024) and replaced with a storage solution. The solution used for replacement is 50 mM Tris, 200 mM KCl, 0.5% Tween-20, 5 mM TCEP, 10% glycerol. The phi29 DNA polymerase (68 kD) obtained above was subjected to SDS-PAGE protein electrophoresis detection, and the purity of the DNA polymerase protein was identified, and the results are shown in Figure 1 , Figure 2 and Figure 3 Ion_1~Ion_11 were successfully expressed and had high purity.
[0096] Example 2 Test of the ability of DNA polymerase to amplify using modified unnatural substrates
[0097] 1. Preparation of the reaction system
[0098] Table 2, reaction system
[0099]
[0100] The single-stranded circular template sequence in the above table is:
[0101] 5-AGGTCGCCAGTTACTTGTTCTCGATGAGTGCCGTACTTGGTTTA ATACCCGTTCTTGGAATGATAAGGAAAGACAGCCGATTATTGATTGGTTTCTACATGCTCGTAAATTAGGATGGGATATTATTTTTCTTGTTCAGGACTTATCTATTGTTGATAAACAGGCGCGTTCTGCATTAGCTGAACATGTGTCGCCAGCCC-3; (see SEQ ID NO. 24).
[0102] Primer: CTGGCGACCTGGGCTGGCGAC; (see SEQ ID NO. 25).
[0103] The substrates in the above Table 1 are as follows:
[0104] The artificially modified substrates A, T, C, and G are selected from the four bases (A, T, C, and G) artificially modified in “Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on an nanopore array” (Contributed by George M. Church, March 18, 2016 (sent for review February 4, 2016; reviewed by Cynthia J. Burrows, Xiaohua Huang, and Andre Marziali, https: / / doi.org / 10.1073 / pnas.1601782113) Figure 2 in the order of dA6P-Cy3-dT4-FldT-dT-FldT-dT 23 -C3, dC6P-Cy3-dT4-dSp3-dT 20 -C3, dC6P-Cy3-dT4-dSp3-dT 23 -C3, dC6P-Cy3-dT4-dSp3-dT 30 -C3. The structural formulas are as follows:
[0105]
[0106] The polymerase and the template primer complex were mixed (5 μL) and reacted at 25°C for 10 min, and then the other components (see Table 2) were added to obtain a reaction solution with a total volume of 10 μL, which was then reacted at 30°C for 2 h.
[0107] The final reaction product was subjected to electrophoresis, and the results are shown in Figure 5 and Figure 6 . Figure 5 Lane L1 in the figure is a negative control (only a mixture of the circular template and the primer complex); L2-L10 are detection of the extension products of Ion_1-Ion_9, respectively. Ion_2 is a wild-type phi29. Figure 5 , except that L4 has almost no amplification, and the others have amplification, indicating that the site mutations of M97K, L253A, T368M, Y369E, E375D, Q380L, A382L, A484E, A484R, E508F, V514Q, and V514D help the phi29 polymerase to use unnatural substrates for DNA amplification under Mg 2+ conditions. Figure 6Lane NC is a negative control (a mixture of only the circular template and the primer complex). Ion_10 is a mutant protein of the protein carrying the "palm" domain, Ion_11 is a protein not carrying a special domain, Ion_11 hardly amplifies, Figure 6 The "palm" domain was shown to help facilitate polymerase in Mg 2+ conditions to use unnatural substrates for DNA amplification.
[0108] Obviously, the above examples are merely illustrative in nature and are not intended to limit the scope of the embodiments. Various changes or modifications can be made by those skilled in the art upon the teachings of the above description. It is intended that all such changes and modifications be included within the scope of the application.
Claims
1. A protein, characterized in that, The protein has an amino acid sequence as shown in any one of SEQ ID NO.1, 3-9.
2. A biomaterial, characterized in that, It can be any of the following: 1) A nucleic acid molecule encoding the protein of claim 1; 2) A carrier containing the nucleic acid molecules described in 1).
3. The use of the protein according to claim 1 in any of the following ways: B1. Catalyzes DNA amplification; B3. Perform DNA sequencing or RNA sequencing; B4. Construct sequencing libraries; B5. Preparation of products that catalyze DNA amplification; B7. Prepare products for DNA sequencing or RNA sequencing; B8. Prepare products for constructing sequencing libraries.
4. The use of the biomaterial according to claim 2 in any of the following ways: B5. Preparation of products that catalyze DNA amplification; B7. Prepare products for DNA sequencing or RNA sequencing; B8. Prepare products for constructing sequencing libraries.
5. The use according to claim 3 or 4, characterized in that, The DNA amplification includes catalytic rolling circle amplification or catalytic multiple strand displacement amplification; Alternatively, the DNA sequencing may include whole-genome sequencing; Alternatively, the products for preparing catalytic DNA amplification include products for preparing catalytic rolling circle amplification or catalytic multiple strand displacement amplification; Alternatively, the preparation of products for DNA sequencing includes the preparation of products for whole-genome sequencing.
6. The use according to claim 3 or 4, characterized in that, In the stated use, it is: Using Mg 2+ To assist the synthesis, replication, or amplification of DNA using the protein-catalyzed artificially modified substrate as described in claim 1, or to enhance Mg... 2+ The protein of claim 1 provides selectivity for catalyzing the synthesis, replication, or amplification of DNA from artificially modified substrates.
7. The use according to claim 6, characterized in that, The artificially modified substrate refers to a deoxyribonucleotide modified with an oligonucleotide or its analogue.
8. An enzyme preparation, characterized in that, It contains the protein as described in claim 1.
9. The enzyme preparation according to claim 8, characterized in that, The enzyme preparation is a DNA polymerase.
10. The enzyme preparation according to claim 8, characterized in that, The enzyme preparation is used as a process utilizing Mg 2+ To assist the protein-catalyzed artificially modified substrate of claim 1 in the synthesis, replication, or amplification of DNA or to enhance Mg. 2+ The ion-assisted DNA polymerase of claim 1 is a selective DNA polymerase that catalyzes the synthesis, replication, or amplification of DNA from artificially modified substrates.
11. A kit for catalyzing DNA amplification, library construction, or library sequencing, characterized in that, It contains the protein as described in claim 1.
Citation Information
Patent Citations
PHI29 mutant and application thereof
CN115362266A
Phi29 DNA polymerase mutant with improved thermal stability and activity and application of Phi29 DNA polymerase mutant
CN118546904A