A thermostable acidic pectinase mutant

Abstract

The present invention relates to the technical field of genetic engineering and protein engineering, and specifically provides a thermostable acidic pectinase mutant. The acidic pectinase mutant comprises a single mutation site S98E, and after being treated at 80°C for 3 minutes, the residual enzyme activity rate is increased by 54.48% compared with the wild type, achieving an unexpected technical effect. The thermostable acidic pectinase mutant provided by the present invention is significantly enhanced, and can be widely used in the fields of feed, food processing, etc.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering and protein engineering transformation, and specifically relates to a thermostable acidic pectinase mutant. Background Art

[0002] Pectin is a type of heteropolysaccharide widely found in the primary wall and the middle layer of the cell wall of plants. It is mainly an acidic heteropolysaccharide composed of D-galacturonic acid (D-Gal-A) connected by α-1,4-glycosidic bonds. In addition to D-Gal-A, it also contains neutral sugars such as L-rhamnose, D-galactose, and D-arabinose. In the plant cell wall, pectin is mainly covalently bound to cellulose, hemicellulose, lignin, etc. to form protopectin, which is a structural substance of plants and plays a vital role in maintaining the structure and hardness of plants.

[0003] Most of the feed consumed by livestock and poultry is plant feed raw materials. To fully digest and degrade plant feed raw materials, the structure of the cell wall must be destroyed first, so that the nutrients such as starch polysaccharides in the cells are fully exposed, and the contact between nutrients and endogenous enzymes such as proteases and amylases is increased, thereby improving feed utilization. Pectinase refers to enzymes that decompose pectin, the main component of plants. Pectinase is widely distributed in higher plants and microorganisms. According to the different substrates, it can be divided into three categories. Two of them (pectinesterase and polygalacturonase) exist in higher plants and microorganisms, and another one (pectin lyase) exists in microorganisms. Exogenous addition of pectinase can degrade pectin in plant cell walls, thereby destroying the cell structure and improving feed utilization. The addition of pectinase can also promote animal digestion and absorption. In the animal's stomach, pectinase can help break down pectin, reduce the viscosity of the feed, and make it easier for other digestive enzymes to come into contact with the feed, thereby improving the digestibility of the feed. It can also promote the reproduction of beneficial bacteria in the intestines, maintain intestinal health, and further improve the animal's digestive system function.

[0004] As people's requirements for feed quality continue to increase, the application effect of pectinase in the feed industry has become increasingly prominent. By adding pectinase, the processing performance of feed can be improved, the pelleting effect and feed stability can be improved. In addition, pectinase can also work synergistically with other enzymes to promote the digestion and absorption of feed and improve the production performance of animals. Therefore, pectinase has become an indispensable and important additive in the modern feed industry. Summary of the invention

[0005] The present invention provides a thermostable acidic pectinase mutant to solve the problems of the prior art. The heat resistance of the mutant is significantly higher than that of the wild type, which is conducive to its wide application in the fields of feed and food processing.

[0006] One aspect of the present invention relates to an acid pectinase mutant, wherein the 98th amino acid of the acid pectinase having an amino acid sequence of SEQ ID NO: 2 is mutated from Ser to Glu.

[0007] The present invention also relates to a DNA molecule encoding the above acid pectinase mutant.

[0008] The present invention also relates to a recombinant expression plasmid comprising the above DNA molecule.

[0009] The present invention also relates to a host cell comprising the above recombinant expression plasmid.

[0010] When the above plasmid is transferred into host cells, the specific activity of the recombinantly expressed acid pectinase mutant is significantly improved.

[0011] The host cell is Aspergillus niger ( Aspergillus niger ).

[0012] Compared with the wild-type acid pectinase PG, the acid pectinase mutant containing the single mutation site S98E provided by the present invention has an enzyme activity residual rate of 54.48% and a high rate of 86.48% after being treated at 80°C for 3 minutes, and the heat resistance is significantly enhanced, and can be widely used in the fields of feed and food processing. The acid pectinase mutant can significantly reduce the water holding capacity of potato residues, which is conducive to promoting the high-value utilization of potato residues, and has broad market prospects. DETAILED DESCRIPTION

[0013] The present invention discloses an acid pectinase mutant, a preparation method and application thereof, a DNA molecule, a plasmid and a host cell encoding the acid pectinase mutant. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the above. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described herein without departing from the content, spirit and scope of the present invention to achieve and apply the technology of the present invention.

[0014] The present invention has used the conventional techniques and methods used in genetic engineering and molecular biology fields, for example MOLECΜLAR CLONING:A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECΜLAR BIOLOGY (Ausubel, 2003) in the method of recording. These general references provide definitions and methods known to those skilled in the art. But those skilled in the art can, on the basis of the technical scheme recorded in the present invention, adopt other conventional methods, experimental schemes and reagents in this area, and are not limited to the limitation of specific embodiments of the present invention. For example, the present invention can select the following experimental materials and reagents: Strains and plasmids: Escherichia coli DH5α, Amp, etc. were purchased from Invitrogen.

[0015] Enzymes and kits: PCR enzyme and ligase were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0016] The formula of the culture medium in the embodiment is as follows: Escherichia coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; LB+Amp medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0; LB+Amp plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0; The present invention will be further described below in conjunction with embodiments: Example 1 Cloning of acid pectinase gene Using Aspergillus niger Su genome as template, primer 1 and primer 2 were used to amplify the acid pectinase gene fragment, the acid pectinase was named PG, the nucleotide sequence was SEQ ID NO: 1, and the amino acid sequence encoded by it was SEQ ID NO: 2.

[0017] PCR primers and reaction conditions are as follows: Primer 1 (F): ATGCCTTCTGCCAAGCCTTTG (SEQ ID NO: 3); Primer 2 (R): TTACTGACTGCAGGAAGCGCC (SEQ ID NO: 4).

[0018] The reaction conditions were: denaturation at 94°C for 5 min, then denaturation at 94°C for 30 s, renaturation at 56°C for 30 s, extension at 72°C for 60 s, and after 30 cycles, incubation at 72°C for 10 min. Agarose electrophoresis results showed that the amplified acid pectinase gene was 1160 bp in size.

[0019] Example 2 Construction of recombinant plasmid PCR amplified the above acid pectinase gene, and Xba I sites were introduced at both ends of the primers. The primer sequences are as follows: Primer 3 (F): GC TCTAGA ATGCCTTCTGCCAAGCCTTTG (SEQ ID NO: 5); Primer 4 (R): GC TCTAGA TTACTGACTGCAGGAAGCGCC (SEQ ID NO: 6).

[0020] The PCR reaction conditions were: denaturation at 94°C for 5 min, then denaturation at 94°C for 30 s, renaturation at 56°C for 30 s, extension at 72°C for 60 s, and after 30 cycles, incubation at 72°C for 10 min. The results of agarose gel electrophoresis showed that the acid pectinase gene was a fragment of 1160 bp in size.

[0021] The acidic pectinase gene fragment obtained above and the expression plasmid pSU were respectively digested with restriction endonuclease XbaI. The digestion conditions are shown in Table 1.

[0022] Table 1 Enzyme digestion system PCR fragment digestion system (50 μL) Plasmid pSU restriction enzyme digestion system (50 μL) PCR fragment 20 μL pSU plasmid 20 μL 10*M 5μL 10*M 5μL BSA 5 μL BSA 5 μL XbaI 2 μL XbaI 2 μL <![CDATA[ddH2O 18μL]]> <![CDATA[ddH2O 18μL]]> The enzyme digestion was carried out at 37℃ in a water bath for 2h, and the two target fragments were recovered after electrophoresis and dissolved in 20 μL ddH2O. T4 DNA ligase was used for ligation, and the ligation system is shown in Table 2.

[0023] Table 2 Connection system PCR fragment 2μL PZQ 2μL 10*Buffer 1μL T4 DNA ligase 1μL <![CDATA[ddH2O]]> 4μL Total volume 10μL The cells were connected at 22°C for 1 hour, transformed into competent E. coli DH5a, spread on LB+AMP plates, and cultured at 37°C overnight to grow single colonies. Colony PCR was used to verify the correct connection of the transformant, and the plasmid was extracted and sent for sequencing. After sequencing was correct, the recombinant plasmid pSU-PG containing the acid pectinase gene was obtained.

[0024] Example 3 Screening of high temperature resistant mutants In order to further improve the heat resistance of acid pectinase PG, the applicant screened a large number of mutations of the enzyme using directed evolution technology.

[0025] Design of PCR primers F3 and R3: F3: GC GAATTC ATGCCTTCTGCCAAGCCTTTG (SEQ ID NO: 7, the underline indicates the restriction endonuclease EcoRI recognition site); R3:TA GCGGCCGC TTACTGACTGCAGGAAGCGCC (SEQ ID NO: 8, the underline indicates the recognition site of restriction endonuclease NotI).

[0026] The PG gene (SEQ ID NO: 1) was used as a template and PCR amplification was performed using the above primers using the GeneMorph II random mutation PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and ligated with the pET21a plasmid digested with the same enzymes, transformed into Escherichia coli BL21 (DE3), spread on LB+Amp plates, and cultured inverted at 37°C. After the transformants appeared, they were picked up one by one with a toothpick to a 96-well plate, and 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well. The cells were cultured at 37°C and 220 rpm for about 6 h, and the supernatant was discarded after centrifugation. The cells were resuspended in buffer and repeatedly frozen and thawed to break the cell wall to obtain Escherichia coli cell lysate containing acidic pectinase.

[0027] 30 μL of lysate was taken out to two new 96-well plates, one of which was treated at 90℃ for 5 min. 30 μL of substrate was added to both 96-well plates. After reacting at 40℃ for 10 min, the generated galacturonic acid was determined by DNS method. Different mutants maintained different activities after high temperature treatment.

[0028] The experimental results show that some mutations have no effect on the heat resistance of acid pectinase PG, and some mutations even make its heat resistance or enzyme activity worse; some other mutations, although they can improve the temperature tolerance of acid pectinase, but their enzymatic properties have changed significantly after mutation, which do not meet the requirements. Finally, a mutation site was obtained that can significantly improve the heat resistance of acid pectinase without affecting its enzyme activity and original enzymatic properties: S98E.

[0029] Based on the above wild-type acid pectinase PG, the present invention provides a mutant containing a single mutation site S98E.

[0030] Example 4 Recombinant expression of acid pectinase According to the method described in Example 2, the mutants screened were amplified by PCR using primers F2 and R2, and digested by Xba I, then connected with the pSu plasmid digested by the same enzyme, and transformed into Escherichia coli DH5a, coated on LB+Amp plates, and inverted cultured at 37°C. After the transformants appeared, colony PCR (reaction system: template-picked single clone, rTaqDNA polymerase 0.5μL, 10×Buffer 2.0μL, dNTPs (2.5mM) 2.0μL, 5'AOX primer (10mM): 0.5μL, 3'AOX primer: 0.5μL, ddH2O 14.5μL, reaction procedure: 95°C pre-denaturation for 5min, 30 cycles: 94°C 30sec, 55°C 30sec, 72°C 2min, 72°C 10min). The positive clones were verified, and the correct mutant recombinant expression plasmid was obtained after sequencing verification.

[0031] 4.1 Protoplast preparation: Inoculate the Aspergillus niger host bacteria on PDA+U (potato 200g / L, filtered and slag removed after boiling for 20-30min; glucose 2%; Uridine 1%; agar powder 1.5%) plates and culture at 30℃ for 5-7d; cut a 2cm×2cm block and inoculate it into 100mL liquid PDA+U (potato 200g / L, filtered and slag removed after boiling for 20-30min; glucose 2%; Uridine 1%) medium, and culture at 30℃ for 16h to grow mycelium for transformation; filter the grown mycelium and resuspend it with 20mL 1.2M magnesium sulfate solution; add 0.2g lysozyme and culture at 30℃ and 100rpm for 2-3h; filter the lysed mycelium with 2 layers of lens paper and centrifuge at 3000rpm for 10min to obtain protoplasts; filter the lysed mycelium with lens paper and centrifuge to obtain protoplasts; then resuspend it with an appropriate amount of sorbitol solution.

[0032] 4.2 Conversion: The protoplasts of the Aspergillus niger host bacteria obtained above were washed twice with 1.2 M sorbitol solution, and then resuspended with an appropriate amount of sorbitol solution to make the protoplast concentration reach 10 8 / mL; add 10 μL of the prepared recombinant plasmid to each 200 μL of protoplasts, add 50 μL of 25% PEG6000, ice bath for 20 minutes, then add 2 mL of 25% PEG6000, and let it stand at room temperature for 5 minutes; add 4 mL of sorbitol solution and mix by inversion, pour in 50 mL of transformation upper culture medium, pour into 4 transformation lower plates, wait for the upper culture medium to solidify, and then invert and culture in a 30°C incubator for 5 days.

[0033] 4.3 Transformant screening: After 5 days of culture, pick the colonies that have grown, and plant them on the transformation lower plate for rescreening, and culture at 30℃ for 3 days. Inoculate the normally growing transformants onto fresh PDA plates and culture at 30℃ for 5-7 days. Cut a 2cm×2cm bacterial block from each transformant and inoculate it into 50mL liquid shake flask medium (maltose 12%; corn syrup 1.5%; ammonium sulfate 0.5%; magnesium sulfate 0.3%; potassium sulfate 0.37%; calcium chloride 0.1125%; trace elements 0.1%) for fermentation, and culture at 30℃ for 5 days. After 5 days of culture, centrifuge the cells to obtain the supernatant, which is the crude enzyme solution, and perform SDS-PAGE protein electrophoresis detection and acid pectinase enzyme activity detection.

[0034] 4.4 Acid pectinase activity detection (1) Definition of acid pectinase activity unit Under the conditions of 40°C and pH 4.5, the amount of enzyme that hydrolyzes polygalacturonic acid to produce 1 μmol of galacturonic acid per minute is defined as one enzyme activity unit U.

[0035] (2) Enzyme activity determination method Polygalacturonic acid solution (0.5%): Weigh 0.5g of sodium polygalacturonate, place a suitable beaker containing 80mL of water on a heated magnetic stirrer, keep stirring and slowly add sodium polygalacturonate. After it is basically dissolved, turn on the magnetic stirring heater to 80℃ and keep it for 2 minutes. After the sodium polygalacturonate is completely dissolved (becomes transparent), immediately transfer the beaker to a cold water bath and cool to room temperature. Add 5mL of 1mol / L sodium acetate buffer to the beaker, and then make up to 100mL with water.

[0036] Galacturonic acid solution (1%): D-galacturonic acid was dried in an oven at 60°C to constant weight, then 0.5 g was accurately weighed, dissolved in 0.05 mol / L sodium acetate buffer and the volume was adjusted to 50 mL.

[0037] Enzyme solution: dilute to an appropriate multiple with 0.05 mol / L sodium acetate buffer at pH 4.5, and control the absorbance value in the range of 0.28-0.33.

[0038] Drawing of galacturonic acid standard curve: Prepare 0, 0.2, 0.4, 0.6, 0.8, 1.0 mL of 1% galacturonic acid standard solution respectively, dilute to 10 mL with 0.05 mol / L sodium acetate buffer as standard point solution. Take 0.5 mL of each of the above standard point solutions, add 0.5 mL of polygalacturonic acid substrate solution, then add 2 mL of DNS stop solution, mix well, place all test tubes in a boiling water bath and boil for 5 minutes, then take out the water bath and cool to room temperature; add 5 mL of water to all test tubes, mix well, transfer the solution to a 10 mL centrifuge tube, centrifuge at 4000 rpm for 10 minutes, take the supernatant and read the absorbance value at 540 nm with a spectrophotometer.

[0039] With the absorbance value as the ordinate (Y) and the galacturonic acid concentration (μmol / mL) as the abscissa (X), a standard curve Y=kX+b was drawn.

[0040] Determination: Take 0.5mL of diluted enzyme solution and add it to the reaction tube and blank tube, and put the reaction tube and blank tube into a 40℃ water bath, preheat for 3min, then add 0.5mL of polygalacturonic acid solution that has been preheated for 5min to the reaction tube at a certain time interval, mix well, and time the reaction for 10min. Finally, add 2mL of DNS solution to all reaction tubes at the same time interval to terminate the reaction, and add 0.5mL of polygalacturonic acid solution to the blank tube.

[0041] All test tubes were placed in a boiling water bath and boiled for 5 minutes, then removed from the water bath and cooled to room temperature. 5 mL of water was added to all test tubes, mixed evenly, and the test tubes were transferred to 10 mL centrifuge tubes, centrifuged at 4000 rpm for 10 minutes, and the supernatant was taken and the absorbance was read at 540 nm using a spectrophotometer. The difference in absorbance between the reaction tube and the blank tube was recorded as A.

[0042] Enzyme activity calculation formula: U=[(Ab)×n] / (10×k).

[0043] Where: U——enzyme activity of the sample, unit is U / mL; A——the difference between the sample and blank absorbance values; k——the slope of the standard curve; b——intercept of the standard curve; n——dilution multiple; 10——reaction time, 10min; Example 5 Analysis of the heat resistance of acid pectinase mutants The fermentation supernatant of the Aspergillus niger recombinant strain expressing the recombinant acid pectinase PG and its mutants constructed above was diluted to about 200 U / mL with acetic acid-sodium acetate buffer at pH 4.5, and the residual enzyme activity was determined after treatment at 80°C for 3 min. The enzyme activity of the untreated sample was taken as 100% to calculate the residual enzyme activity rate. The specific results are shown in Table 3.

[0044] Table 3 Analysis of heat resistance of acid pectinase mutants Acid pectinase Residual enzyme activity after treatment at 80℃ for 3 minutes Wild type PG 32.00% S98E single point mutant 86.48% From the results in Table 3, it can be seen that compared with the wild-type acid pectinase PG, the acid pectinase mutant containing the S98E single mutation site increased the enzyme activity residual rate by 54.48% after being treated at 80°C for 3 minutes, and the heat resistance was significantly enhanced, achieving unexpected technical effects.

[0045] In summary, the acid pectinase mutant provided by the present invention has stronger heat resistance and is more suitable for application in the fields of feed and food processing.

[0046] The applicant named the acid pectinase mutant containing the single mutation site S98E as acid pectinase MY. The Aspergillus niger engineered strain that recombinantly expressed the mutant was scaled up to prepare an acid pectinase MY solid product with an enzyme activity level of 1000u / g.

[0047] Example 6 Application of acid pectinase in potato residue treatment Potato starch enterprises produce a large amount of potato residue in the process of starch production. The daily output is huge. It has high water content, rich bacteria and nutrients, and is easy to rot, which will cause serious environmental pollution and waste of resources. In fact, potato residue is rich in fiber, but the production of fiber and other high-value products using potato residue requires dry potato residue as raw material. Therefore, rapid drying becomes the key to solving the resource utilization of potato residue. Rapid drying requires the use of bio-enzyme technology to reduce the water holding capacity of potato residue and effectively improve the biological value of potato residue.

[0048] The present invention provides a method for reducing the water holding capacity of potato residues by using pectinase, which specifically comprises: adding the acidic pectinase MY solid product described in Example 5 at a ratio of 65 g / ton to potato residues with a water content of 93%, performing enzymatic hydrolysis at room temperature for 4 hours, and performing filter pressing to reduce the water content of the potato residues to 45%.

[0049] As a control, potato residue with a moisture content of 93% was left to stand at room temperature for 4 hours and then filtered, and the moisture content of the potato residue only dropped to 85%.

[0050] The above results show that the acidic pectinase mutant provided by the present invention can significantly reduce the water holding capacity of potato residues, which is beneficial to promote the high-value utilization of potato residues and has broad market prospects.

Claims

1. An acid pectinase mutant, characterized in that: The mutant is an acid pectinase with an amino acid sequence of SEQ ID NO: 2, in which the 98th amino acid is mutated from Ser to Glu.

2. A DNA molecule encoding the acid pectinase mutant according to claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3; the host cell is Aspergillus niger ( Aspergillus niger ).

5. Use of the acid pectinase mutant according to claim 1 in potato residue treatment.