Tobacco negative regulation of maturation and senescence gene Nt-wrky-82 and application thereof

Abstract

The application discloses a tobacco negative regulation maturation and aging gene Nt-wrky-82 and application thereof. The nucleotide sequence of the tobacco negative regulation maturation and aging gene Nt-wrky-82 is shown as SEQ ID No. 1, and the encoded amino acid sequence is shown as SEQ ID No. 2. The gene expression amount in tobacco seedling leaves is significantly reduced during the tobacco leaf maturation and aging period. Nt-wrky-82 The application constructs a gene overexpression vector, and infects Arabidopsis thaliana through Agrobacterium to obtain a gene overexpression Arabidopsis thaliana plant. Nt-wrky-82 Compared with a wild-type overexpression plant, the gene overexpression Arabidopsis thaliana plant can significantly delay leaf aging. Nt-wrky-82 The application proves through experiments that the gene is a negative regulation maturation and aging gene. Nt-wrky-82 Nt-wrky-82 Therefore, the function identification of the tobacco gene enriches gene resources of plant maturation and aging breeding, has important theoretical significance and application value, and has a good market application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a tobacco-related gene that negatively regulates maturation and aging. Nt-wrky-82 And its applications. Background Technology

[0002] Harvesting mature tobacco leaves is a crucial step in flue-cured tobacco production, directly determining the usability and value of tobacco leaves as raw materials for the cigarette industry. Currently, tobacco harvesting involves five or six harvests based on leaf part and maturity level, making full automation difficult. Furthermore, manual harvesting is labor-intensive, costly, and inefficient. Reducing the number of harvests and promoting mechanized "four-harvest" agronomic techniques requires suitable varieties with relatively concentrated maturity. Existing main varieties exhibit a "layered yellowing" maturity characteristic, and there is a severe lack of mechanized "four-harvest" varieties and technologies in tobacco production. Therefore, screening concentrated mature tobacco germplasm resources, identifying key genes regulating concentrated yellowing, and breeding new concentrated mature varieties are particularly crucial in promoting the mechanization of tobacco production. Currently, there are few genes in tobacco with clearly defined maturation and senescence functions. Summary of the Invention

[0003] This invention provides a tobacco-negative aging gene. Nt-wrky-82 Regarding its applications, this invention is the first to screen for a tobacco-related negative regulation of aging. Nt-wrky-82 Genes will Nt-wrky-82 The transgenic lines obtained by gene transformation of Arabidopsis thaliana can significantly delay leaf senescence compared with wild type. This invention provides new gene resources and theoretical basis for molecular-assisted breeding of crops.

[0004] To achieve the above-mentioned objectives, the present invention employs the following technical solution:

[0005] This invention provides a tobacco-negative aging gene. Nt-wrky-82 Its nucleotide sequence is shown in SEQ ID No. 1.

[0006] This invention also provides a gene that negatively regulates aging in tobacco. Nt-wrky-82 The encoded tobacco negative regulatory aging protein has the amino acid sequence shown in SEQ ID No. 2.

[0007] This invention also provides the aforementioned tobacco-negative aging-regulating gene. Nt-wrky-82 Application in regulating plant senescence.

[0008] Furthermore, the application includes the following steps:

[0009] (1) Amplification of tobacco-negative aging-regulating genes Nt-wrky-82 ;

[0010] (2) Cloning the tobacco negative regulation aging gene Nt-wrky-82 After enzyme digestion and purification, the molecule was ligated into an expression vector to obtain an overexpression recombinant vector.

[0011] (3) Transform the overexpression recombinant vector into Agrobacterium to obtain an overexpression recombinant strain;

[0012] (4) Transform the overexpressing recombinant strain into plants, screen and obtain Nt-wrky-82 Transgenic Arabidopsis thaliana lines were developed to enhance the plant's resistance to aging.

[0013] Furthermore, it is used to amplify the tobacco negative regulatory aging gene. Nt-wrky-82 The primers are as follows:

[0014] Nt-wrky-82 -F: GGATCC ATGGAGTCTGAAAATTACACACAGT;

[0015] Nt-wrky-82 -R: GAGCTC TTAAAATTGAAAAGATAAATCAGCA.

[0016] Furthermore, the amplification reaction conditions in step (1) are as follows: 98 °C pre-denaturation for 30 s; 98 °C denaturation for 10 s, 58 °C annealing for 10 s, 72 °C for 50 s, 30 cycles; 72 °C extension for 10 min.

[0017] Furthermore, in step (2), the expression vector is the pCambia2300EC vector, which contains a 35S promoter and a NOS terminator.

[0018] Furthermore, the aforementioned Nt-wrky-82 Compared with wild-type lines, transgenic Arabidopsis thaliana lines significantly delayed leaf senescence.

[0019] Furthermore, the plant in question is Arabidopsis thaliana, but is not limited to Arabidopsis thaliana.

[0020] This invention also provides the aforementioned tobacco-negative aging-regulating gene. Nt-wrky-82 Or the application of the tobacco negative regulatory aging protein in the selection and breeding of plant varieties that regulate aging.

[0021] Compared with existing technologies, this invention has the following advantages and beneficial effects: Through transcriptome sequencing analysis, this invention screens for tobacco genes with significantly reduced expression levels during the senescence stage of tobacco leaves. Nt-wrky-82The expression level of this gene was reduced by nearly 5-fold in senescent leaves, as verified by quantitative real-time PCR. This invention further cloned the gene, constructed an overexpression vector, overexpressed it in a recombinant bacterial strain, and transformed it into Arabidopsis thaliana to obtain transgenic tobacco plants. Nt-wrky-82 - OX and confirmed Nt-wrky- 82-OX It can significantly delay aging compared to the wild type. This proves... Nt-wrky-82 The gene is a gene that negatively regulates aging.

[0022] The tobacco provided by this invention Nt-wrky-82 The functional identification of genes not only enriches the gene resources for plant senescence breeding, but also helps to elucidate the diverse functions of tobacco WRKY transcription factors, which has important theoretical significance and application value. Attached Figure Description

[0023] Figure 1 Tobacco leaves at different stages Nt-wrky-82 Gene expression levels, where the vertical axis represents relative expression levels and the horizontal axis represents leaf development stages.

[0024] Figure 2 for Nt-wrky-82 Senescence identification in transgenic Arabidopsis thaliana, among which Nt-wrky-82 - OX for Nt-wrky-82 Overexpression in Arabidopsis thaliana, Col being untransgenic wild-type Arabidopsis thaliana; a. Overexpression in Arabidopsis thaliana NtWRKY82 a. Delay leaf senescence; b. NtWRKY82 Phenotypic characteristics of detached leaves of overexpressing strains; c. NtWRKY82 The relative expression levels of the three overexpression lines were determined; the photosynthetic rate, chlorophyll content, ion leakage, and relative expression levels of SAG12 in detached leaves of d~e.OX-1 / Col-0 were measured.

[0025] All measurements were performed in triplicate, both biologically and technically. Error bars represent the standard errors (SE) of the three biological and three technical replicates. Significant differences are indicated by "*", with p ≤ 0.05 marked as "*", p ≤ 0.01 marked as "**", and p ≤ 0.001 marked as "***". Detailed Implementation

[0026] The technical solution of the present invention will be further described in detail with reference to the accompanying drawings and the following specific examples.

[0027] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, and the materials and reagents used can be purchased from biological or chemical reagent companies.

[0028] Example 1

[0029] This invention, through transcriptome sequencing analysis, screened a tobacco gene that negatively regulates aging and whose expression level is significantly reduced. Nt-wrky-82 Its nucleotide sequence is shown in SEQ ID No. 1, and the encoded amino acid sequence is shown in SEQ ID No. 2. Then, RT-qPCR verification revealed that... Nt-wrky-82 The expression level of the gene decreased by nearly 5-fold in senescent tobacco leaves compared to the mature stage, and it was preliminarily determined that the gene plays an important role in the regulation of tobacco leaf senescence.

[0030] This invention further uses tobacco leaf cDNA as experimental material and obtains it through PCR amplification. Nt-wrky-82 Gene fragments were digested and ligated to construct an expression vector, which was then transferred into Arabidopsis thaliana using Agrobacterium infection, resulting in transfected genes. Nt-wrky-82 The gene was used in Arabidopsis thaliana plants, and it was confirmed that this gene can significantly delay senescence, thus proving... Nt-wrky-82 The gene is a gene that negatively regulates plant senescence.

[0031] Tobacco negatively regulates aging genes Nt-wrky-82 The specific steps of the cloning method and its application are as follows:

[0032] 1. Tobacco Nt-wrky-82 Using the gene coding region sequence as a reference, specific primers were designed. Nt-wrky-82 -F and Nt-wrky-82 -R, primer sequences are as follows:

[0033] Nt-wrky-82 -F: GGATCC ATGGAGTCTGAAAATTACACACAGT (SEQ ID No. 3);

[0034] Nt-wrky-82 -R: GAGCTC TTAAAATTGAAAAGATAAATCAGCA (SEQ ID No. 4).

[0035] 2. Extract mRNA from seedling leaves of tobacco cultivar "K326", reverse transcribe it into cDNA, and use this as a template for PCR amplification. Perform PCR amplification using the primers from step 1 to obtain... Nt-wrky-82 Amplified fragments of a gene.

[0036] The PCR amplification system was: 31 μL ddH2O, containing Mg. 2+ 10 μL of 5×HF buffer; 2 μL of 2.5 mM dNTPs; and 5 μM of [unspecified substance]. Nt-wrky-82 -F、 Nt-wrky-82-R 2 μL each; DMSO 0.6 μL; Phusion enzyme 0.5 μL; cDNA template 2 μL.

[0037] The PCR reaction conditions were as follows: 98 °C pre-denaturation for 30 s; 98 °C denaturation for 10 s, 58 °C annealing for 10 s, 72 °C for 50 s, 30 cycles; extension at 72 °C for 10 min.

[0038] 3. Construction Nt-wrky-82 The overexpression vector was obtained. The PCR amplification fragment obtained in step 2 was ligated into the cloning vector pEASY-Blunt simple. After correct sequencing, the plasmid was extracted, digested with BamHI and SacI, purified, and ligated into the pCambia2300EC vector (containing a 35S promoter and a NOS terminator) digested with BamHI and SacI. After correct sequencing, Agrobacterium GV3101 was transformed using the freeze-thaw method, and Arabidopsis thaliana was genetically transformed using the pollen staining method to obtain transgenic plants. Nt-wrky-82 .

[0039] 4. Analysis and identification Nt-wrky-82 Negative regulation of aging

[0040] (1) Analysis of expression patterns in tobacco leaves at different stages

[0041] Using tobacco leaves of the "K326" variety at both the mature and senescent stages as materials, quantitative real-time PCR was used to analyze... Nt-wrky-82 Changes in gene expression levels.

[0042] The primer sequences for real-time PCR are as follows:

[0043] NNt-wrky-82 -qF: CTGAGGATTTGGTGGGCAAA (SEQ ID No.5);

[0044] Nt-wrky-82 -qR:TTTCCTTCTTTTTGTAGCGTCCTC (SEQ ID No. 6).

[0045] The results are as follows Figure 1 As shown, the early stage of tobacco leaf maturity Nt-wrky-82 Gene expression as control ( Figure 1 The results showed that Nt- wrky-82 Gene expression was significantly downregulated in the later stages of tobacco leaf maturity, decreasing by approximately 5-fold. This verified the findings. Nt-wrky-82 Genes are involved in the senescence process of tobacco leaves, which indicates Nt-wrky-82 Negative regulation of leaf senescence by genes.

[0046] Anti-aging identification of transgenic Arabidopsis thaliana

[0047] Using the obtained T3 generation transgenic plants, two high-expression lines for each gene were selected. These transgenic lines and Col-0 plants were planted side-by-side with spacing in 32-well trays, one plant per well. All lines participating in phenotypic identification were planted under the same conditions, and the planting was repeated twice. Photos were taken when the leaves showed obvious differences in senescence phenotypes at approximately 40 days of age.

[0048] (3) Determination of chlorophyll content in leaves

[0049] When significant differences in senescence were observed in Arabidopsis leaves, 4, 5, 6, 7, and 8 rosette leaves were collected, with three replicates per group, for chlorophyll content determination. The specific method is as follows: The leaves to be measured were weighed using an electronic analytical balance, and the mass was recorded as m; 15 mL centrifuge tubes were placed with Arabidopsis leaves, and anhydrous ethanol was added to ensure the liquid completely covered the leaves. The centrifuge tubes were wrapped in aluminum foil for light protection and placed at room temperature for 24 h; when the leaves turned white, the decolorization was complete. Anhydrous ethanol was used as a blank control. The absorbance values ​​of each solution at 665 nm and 649 nm were measured using an Infinite M200 PRO microplate reader, and the data were recorded. Each group was performed in three biological replicates and three technical replicates; the chlorophyll content of the Arabidopsis leaves was calculated according to the following formula:

[0050] Total chlorophyll content C (mg / g) = (C a +C b )×V / W;

[0051] C a =13.95*A665-6.88*A649;

[0052] C b =24.96*A649-7.32*A665;

[0053] Where V = 10 mL and W is the fresh weight of the leaf.

[0054] (4) Measurement of leaf photosynthetic rate

[0055] The photosynthetic rate (Fv / Fm) of Arabidopsis leaves was measured using an OS-5p+ chlorophyll fluorometer. The specific operating steps are as follows: Mark and number the leaf positions to be measured, and treat them in darkness for 2 hours to obtain more accurate photosynthetic rate values; Connect the power supply, connect all components of the instrument, and debug to ensure that the instrument can properly measure the leaf Fv / Fm values; Insert the measurement probe into the leaf clamp, clamp the leaf to be measured, and adjust the parameters so that Ft varies within the range of 150-250; Click "Measure" to perform the measurement. The Fv / Fm value will be automatically read at this time. Record the Fv / Fm value for each measurement; For each leaf position, three biological replicates and three technical replicates are performed.

[0056] (5) Leaf ion leakage measurement

[0057] The ion leakage rate of Arabidopsis leaves was measured using a Thermo Fisher Scientific A122 conductivity meter. The experimental steps were as follows: For overexpression plants with obvious leaf phenotypes and Col-0 wild-type plants, the rosette leaves of each Arabidopsis plant were arranged in the order of growth, and the required leaf positions were selected and numbered; the leaves were placed in centrifuge tubes and ddH2O was added, and the tubes were slowly shaken on a MULAB orbital shaker at room temperature for 30 min. At this time, the conductivity R1 of the aqueous solution was measured using a conductivity meter; the centrifuge tube containing the leaves from step (3) was heated and boiled for 10 min, and then rapidly cooled to room temperature on ice before measuring the conductivity R2 of the aqueous solution again; the percentage of the conductivity measured before and after the two measurements is the ion leakage rate of the leaves, calculated as: R1 / R2*100%.

[0058] (6) Assay of aging marker gene expression

[0059] Using the SAG12 gene as a senescence marker, the relative expression levels of the SAG12 gene were determined in OX-NtWRKY82-1 and Col Arabidopsis thaliana plants. The primer sequences used for quantitative real-time PCR were as follows:

[0060] RT-SAG12-F: 5'-ATGTTGTTGGGCGTTTCAGC-3' (SEQ ID No. 7),

[0061] RT-SAG12-R: 5'-GCCGCCAGTCGCTTTTATAT-3' (SEQ ID No. 8).

[0062] The results are as follows Figure 2 As shown, planting under the same conditions NtWRKY82Leaf phenotypic identification was performed on the overexpression lines and Col-0. After 40 days, Col-0 showed obvious leaf senescence phenotypes, while the two overexpression lines showed no or only just leaf senescence. Leaves were disassembled and arranged according to the growth sequence of rosette leaves in the three lines to more visually demonstrate the yellowing of leaves.

[0063] In addition, the overexpression strain OX- was also investigated. NtWRKY82 Physiological data of leaves showing significant differences in senescence between the OX-1 and Col-0 varieties were also measured. Chlorophyll content was measured, revealing that the chlorophyll content of the 4th, 5th, and 6th leaves in the overexpression line OX-1 was higher than that in the wild type. Analysis of photosynthetic rates showed that the photosynthetic rates of the 4th, 5th, and 6th leaves in the overexpression line OX-1 were significantly higher than those in the wild type, while there was no significant difference in the 7th and 8th leaves. After measuring ion leakage, the ion leakage rates of the 4th, 5th, and 6th leaves in the overexpression line were significantly lower than those in the wild type. Since the ion leakage rate, as an indicator of leaf senescence progress, is inversely proportional to the degree of senescence, this indicates that in the three leaf senescence sites (4th, 5th, and 6th leaves), where senescence differences were significant, the senescence degree of the overexpression plant was lower than that of the Col-0 variety. The differential expression level of the leaf senescence marker gene SAG12 was detected by qRT-PCR. The results showed that the expression level of SAG12 gene in OX-1 was significantly lower than that in Col-0. SAG12 was positively correlated with the degree of leaf senescence, indicating that the leaf development age of Col-0 was higher than that of the overexpressing line.

[0064] Based on the results of all the above physiological indicators, compared with the wild type, overexpression in Arabidopsis thaliana... NtWRKY82 The gene delays leaf senescence, thus slowing down leaf senescence. Due to overexpression, the wild-type leaves show a significantly higher degree of senescence compared to the overexpressed line, demonstrating... NtWRKY82 Genes are negative regulators of leaf senescence and can be used to delay leaf senescence.

[0065] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A tobacco gene Nt-wrky-82 Its application in enhancing the anti-aging capabilities of Arabidopsis thaliana or tobacco is characterized by... The tobacco gene Nt-wrky-82 The nucleotide sequence is shown in SEQ ID No. 1; the tobacco gene described Nt-wrky-82 The amino acid sequence of the encoded protein is shown in SEQ ID No.

2.

2. The application according to claim 1, characterized in that, The application includes the following steps: (1) Amplify the tobacco gene Nt-wrky-82 ; (2) Cloning the tobacco gene Nt-wrky-82 After enzyme digestion and purification, the molecule was ligated into an expression vector to obtain an overexpression recombinant vector. (3) Transform the overexpression recombinant vector into Agrobacterium to obtain an overexpression recombinant strain; (4) Transform the overexpressing recombinant strain into plants, screen and obtain Nt-wrky-82 Transgenic Arabidopsis thaliana lines were developed to enhance the plant's resistance to aging.

3. The application according to claim 2, characterized in that, Used to amplify the tobacco gene Nt-wrky-82 The primers are as follows: Nt-wrky-82-F:GGATCCATGGAGTCTGAAAATTACACACAGT; Nt-wrky-82-R:GAGCTCTTAAAATTGAAAAGATAAATCAGCA.

4. The application according to claim 2, characterized in that, The amplification reaction conditions in step (1) are as follows: 98 °C pre-denaturation for 30 s; 98 °C denaturation for 10 s, 58 °C annealing for 10 s, 72 °C for 50 s, 30 cycles; 72 °C extension for 10 min.

5. The application according to claim 2, characterized in that, The expression vector in step (2) is the pCambia2300EC vector, which contains a 35S promoter and a NOS terminator.

Images