Method for producing L-amino acid by using escherichia coli with rsxE gene knocked out

Abstract

The invention discloses a method for producing L-amino acid by using escherichia coli with rsxE gene knocked out. The invention provides application of inhibiting expression and / or activity of SOXR [2FE-2S] reduction system protein in preparation of L-amino acid, and further provides a recombinant bacterium, and the activity of the SOXR [2FE-2S] reduction system protein in the recombinant bacterium is reduced or inactivated or is not expressed. According to the invention, the rsxE gene in escherichia coli is knocked out, so that the expression intensity of the rsxE gene is weakened, and L-threonine, L-tryptophan, L-arginine and L-valine fermentation production strains with more cost benefits can be produced. The invention has important significance for improving the fermentation yield of bacteria, namely L-threonine, L-tryptophan, L-arginine and L-valine.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a method for producing L-amino acids by using Escherichia coli with knocked-out rsxE genes. Background Art

[0002] L-threonine is one of the eight essential amino acids and is an amino acid that humans and animals cannot synthesize by themselves. L-threonine can enhance grain absorption, regulate metabolic balance in the body, and promote growth and development of the body. It is widely used in medicine, feed, food and industry. L-tryptophan plays an important role in the growth, development and metabolism of humans and animals. It is called the second essential amino acid. Its role is manifested in that it can directly affect the physiological and biochemical processes such as growth and metabolism of animals. On the other hand, it can be metabolized and transformed into nicotinamide, nicotinic acid and 5-hydroxytryptamine (5-HT) in the body of animals. These transformation products play an important role in the body. As an essential amino acid, L-tryptophan is one of the important raw materials for protein synthesis. With the development of aquaculture and medical and health products, the market demand for tryptophan is also increasing. The main methods for producing tryptophan are chemical synthesis, enzyme method and fermentation method. The fermentation method for producing tryptophan has the advantages of mild reaction conditions, low cost, green, clean and environmentally friendly. Therefore, in the context of low-carbon and environmental protection, it is of great significance to use the fermentation method to produce tryptophan, optimize the fermentation process of tryptophan, and further increase the yield of tryptophan. L-arginine is a semi-essential basic amino acid in humans and animals. It is an important raw material for synthesizing protein creatine and an important intermediate metabolite in the urea cycle of organisms. Therefore, it has a wide range of uses in the pharmaceutical and food industries. L-valine is a branched-chain amino acid that promotes the development of mammalian mammary cells, improves the immune status of animals, and accelerates muscle tissue repair. It is widely used in the pharmaceutical, feed, and food industries. At present, L-valine is mainly produced in industry through microbial fermentation. With the continuous increase in the market demand for L-valine, researchers are increasingly paying attention to continuously optimizing the fermentation performance of production strains and developing more economical and efficient fermentation processes to improve the production efficiency of valine.

[0003] Breeding efficient strains with L-amino acid production capacity is the key to the industrial application of microbial fermentation. At present, there are two main methods for breeding L-amino acid production strains: the first is rational metabolic engineering transformation: this method mainly uses efficient gene editing technology to systematically transform the L-amino acid synthesis network in the chassis microorganisms to maximize the redirection of carbon metabolic flux to the L-amino acid synthesis pathway, mainly including blocking the L-amino acid degradation pathway, removing the feedback inhibition regulation mechanism of key enzymes in the synthesis pathway, enhancing the supply of precursors, optimizing the balance of chassis cell coenzyme supply, modifying the transmembrane transport system, etc. The second is irrational adaptive evolution: adaptive evolution refers to a breeding strategy that changes the growth environment of microorganisms under laboratory conditions, allowing microorganisms to spontaneously mutate in the process of environmental adaptation and complete the evolution process, and then rationally analyzes the evolutionary results. Since this strategy obtains mutant strains in an irrational way and then analyzes them in a rational way, it is a semi-rational breeding strategy that combines rationality and irrationality. Compared with mutation breeding, spontaneous mutations in the adaptive evolution process are screened and strengthened generation by generation due to the limitation of specific culture conditions, so it is more directional and greatly reduces the number of irrelevant mutation samples.

[0004] The rsxE gene encodes a protein of the SOXR[2FE-2S] reduction system, and its expression level has decreased significantly during the anaerobic adaptive evolution process. However, the effect of the reduced expression intensity of the rsxE gene on the production of L-amino acids has not been studied. In particular, there are no reports on the production of L-threonine, L-tryptophan, L-arginine, and L-valine by Enterobacteriaceae with knockout rsxE genes. Summary of the invention

[0005] The object of the present invention is to provide a method for producing L-amino acids using Escherichia coli with a knocked-out rsxE gene.

[0006] In a first aspect, the present invention claims protection for any of the following applications:

[0007] (A1) Use of inhibiting the expression and / or activity of SOXR [2FE-2S] reduction system protein in the preparation of L-amino acids;

[0008] (A2) Use of a substance that inhibits the expression and / or activity of a SOXR [2FE-2S] reduction system protein in the preparation of L-amino acids;

[0009] (A3) Use of inhibiting the expression and / or activity of SOXR [2FE-2S] reduction system protein in improving bacterial L-amino acid production;

[0010] (A4) Use of a substance that inhibits the expression and / or activity of a SOXR [2FE-2S] reduction system protein in improving bacterial L-amino acid production.

[0011] Furthermore, inhibiting the expression and / or activity of the SOXR[2FE-2S] reduction system protein can be achieved by any of the following methods: knocking out or reducing the expression of the gene encoding the SOXR[2FE-2S] reduction system protein (i.e., the rsxE gene) in the genome of the recipient bacteria.

[0012] Furthermore, the substance is a substance that can knock out or reduce the expression of the gene encoding the SOXR[2FE-2S] reduction system protein (i.e., the rsxE gene) in the genome of the recipient bacteria.

[0013] Wherein, inhibiting the expression and / or activity of the SOXR[2FE-2S] reduction system protein means that compared with the original expression intensity of the target gene (i.e., the coding gene of the SOXR[2FE-2S] reduction system protein, i.e., the rsxE gene), the expression intensity of the gene is significantly weakened and / or the activity is significantly reduced after modification, and the specific method includes but is not limited to reducing the copy number of the target gene by using CRISPRi technology or RNAi interference technology. The same below.

[0014] Specifically, the inhibition of the expression and / or activity of the SOXR[2FE-2S] reduction system protein can be achieved through at least one of the following six regulatory levels: 1) inhibiting the expression of the gene encoding the SOXR[2FE-2S] reduction system protein at the gene transcription level; 2) inhibiting the expression of the gene encoding the SOXR[2FE-2S] reduction system protein at the post-transcriptional level (that is, inhibiting the expression of the SOXR[2FE-2S] reduction system protein by splicing or processing the primary transcript of the relevant gene); 3) inhibiting the SOX at the RNA transport level of the gene. The invention relates to the invention to inhibit the expression of SOXR[2FE-2S] reducing system protein by regulating the transport of mRNA of related genes from the nucleus to the cytoplasm; 4) inhibiting the expression of SOXR[2FE-2S] reducing system protein by regulating the translation level of the gene; 5) inhibiting the expression of SOXR[2FE-2S] reducing system protein by regulating the degradation level of the gene mRNA; 6) inhibiting the activity of SOXR[2FE-2S] reducing system protein by regulating the post-translational level of the gene.

[0015] Wherein, the coding gene of the SOXR[2FE-2S] reduction system protein (i.e., rsxE gene) may include any of the following:

[0016] (C1) DNA molecule shown in SEQ ID No.5;

[0017] (C2) A DNA molecule derived from bacteria that has more than 99%, more than 95%, more than 90%, more than 85% or more identity with the DNA sequence defined in (C1) and encodes the SOXR[2FE-2S] reduction system protein.

[0018] In a second aspect, the present invention claims protection for a recombinant bacterium.

[0019] The activity of the SOXR[2FE-2S] reduction system protein in the recombinant bacteria claimed by the present invention is reduced or inactivated or not expressed.

[0020] The reduction in activity, inactivation or non-expression of the SOXR[2FE-2S] reduction system protein is achieved by inhibiting the expression and / or activity of the SOXR[2FE-2S] reduction system protein in the recipient bacteria.

[0021] Furthermore, inhibiting the expression and / or activity of the SOXR[2FE-2S] reduction system protein in the recipient bacteria can be achieved by any of the following methods: knocking out or reducing the expression of the gene encoding the SOXR[2FE-2S] reduction system protein (i.e., the rsxE gene) in the genome of the recipient bacteria.

[0022] Furthermore, the recipient bacteria may be bacteria.

[0023] Furthermore, the recombinant bacteria is at least selected from one or more of Escherichia coli, Corynebacterium glutamicum, and Pantoea.

[0024] In one embodiment of the present invention, the recombinant bacteria is specifically recombinant Escherichia coli.

[0025] In a third aspect, the present invention claims protection for the use of the recombinant bacteria described in the second aspect above in the fermentation production of L-amino acids.

[0026] In a fourth aspect, the present invention claims a method for constructing an engineered bacterium for producing L-amino acids.

[0027] The method for constructing an engineered bacterium for producing L-amino acids claimed in the present invention may include the following steps: inhibiting the expression and / or activity of a SOXR[2FE-2S] reduction system protein in a recipient bacterium;

[0028] The recipient bacteria are bacteria.

[0029] Furthermore, inhibiting the expression and / or activity of the SOXR[2FE-2S] reduction system protein in the recipient bacteria can be achieved by any of the following methods: knocking out or reducing the expression of the gene encoding the SOXR[2FE-2S] reduction system protein in the genome of the recipient bacteria.

[0030] In a fifth aspect, the present invention claims a method for producing L-amino acids.

[0031] The method for producing L-amino acids claimed in the present invention may include the following steps: culturing the recombinant bacteria described in the second aspect above to obtain L-amino acids from the fermentation products.

[0032] Among them, the cultivation of the recombinant bacteria can be carried out by a person skilled in the art using methods in the prior art, or by optimizing and improving the fermentation method through conventional experiments. The fermentation culture can be carried out in a suitable culture medium under fermentation conditions known in the art. The culture medium can contain: a carbon source, a nitrogen source, trace elements and combinations thereof. During the cultivation, the pH of the culture can be adjusted. During the cultivation, the temperature of the culture can be controlled. During the cultivation, the rotation speed can be controlled. During the cultivation, the fermentation time can be controlled. During the cultivation, the dissolved oxygen can be controlled.

[0033] In the implementation case of the present invention, the specific culture medium formula and fermentation process used refer to the relevant part of Example 3.

[0034] In the above-mentioned related aspects, the expression and / or activity of the SOXR[2FE-2S] reduction system protein can be inhibited by introducing into the recipient bacteria a gene editing tool, siRNA, or shRNA targeting the gene encoding the SOXR[2FE-2S] reduction system protein. The substance can be a gene editing tool, siRNA, or shRNA targeting the gene encoding the SOXR[2FE-2S] reduction system protein.

[0035] In one embodiment of the present invention, the gene editing tool is a CRISPR / Cas9 editing tool. Specifically, the CRISPR / Cas9 editing tool targets the coding gene of the SOXR[2FE-2S] reduction system protein, and its target sequence is shown in SEQ ID No.1.

[0036] In each of the above-mentioned related aspects, the SOXR[2FE-2S] reduction system protein may include or be any of the following:

[0037] (B1) a protein containing or having the amino acid sequence shown in SEQ ID No.6;

[0038] (B2) A protein derived from bacteria and having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the protein defined in (B1) and associated with the production of L-amino acids.

[0039] In the above-mentioned proteins, identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using an identity search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default value), respectively, and searching for the identity of a pair of amino acid sequences for calculation, the identity value (%) can be obtained.

[0040] The 80% or more identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The 85% or more identity may be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The 90% or more identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The greater than 95% identity may be at least 95%, 96%, 97%, 98% or 99% identity.

[0041] In each of the above-mentioned related aspects, the gene encoding the SOXR[2FE-2S] reduction system protein (i.e., the rsxE gene) may include or be any of the following:

[0042] (C1) DNA molecule shown in SEQ ID No.5;

[0043] (C2) A DNA molecule derived from bacteria that has more than 99%, more than 95%, more than 90%, more than 85% or more identity with the DNA sequence defined in (C1) and encodes the SOXR[2FE-2S] reduction system protein.

[0044] In the above genes, the identity of the nucleotide sequence can be determined using an identity search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values), respectively, and searching for a pair of nucleotide sequences to calculate the identity, the identity value (%) can be obtained.

[0045] In the above genes, the above 95% identity may be at least 96%, 97%, 98% identity. The above 90% identity may be at least 91%, 92%, 93%, 94% identity. The above 85% identity may be at least 86%, 87%, 88%, 89% identity. The above 80% identity may be at least 81%, 82%, 83%, 84% identity.

[0046] In each of the above related aspects, the L-amino acid may be L-threonine, L-tryptophan, L-arginine and / or L-valine.

[0047] In each of the above related aspects, the bacterium is a bacterium capable of producing L-amino acids.

[0048] "Bacteria capable of producing L-amino acids" means that the bacteria have the following abilities: the ability to produce and accumulate L-amino acids in the bacteria using external substances (such as culture medium), and further the ability to secrete L-amino acids into the culture system. Thus, L-amino acids can be collected when the bacteria are cultured in the culture medium.

[0049] The recombinant bacteria can be used to produce a variety of products, such as glutamic acid, glycine, alanine, leucine, isoleucine, methionine, proline, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, aspartic acid, histidine, shikimic acid, protocatechuic acid, succinic acid, alpha-ketoglutaric acid, citric acid, ornithine, citrulline, etc.

[0050] The bacteria may be wild-type bacteria collected naturally or modified bacteria.

[0051] "Modified bacteria" refers to modified bacteria obtained by artificially mutating and / or inducing mutations in naturally collected wild-type bacteria.

[0052] Further, the bacteria may be from Escherichia sp., Erwinia sp., Agrobacterium sp., Flavobacterium sp., Alcaligenes sp., Pseudomonas sp., Bacillus sp., Brevibacterium sp., Corynebacterium sp., Aerobacter sp., Enterobacteria sp., Micrococcus sp., Serratia sp., Salmonella sp., Streptomyces sp., Providencia sp., etc., but are not limited thereto.

[0053] Furthermore, the bacterium may be Escherichia coli (also known as Escherichia coli), Corynebacterium glutamicum, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Brevibacterium ammoniagenes, Corynebacterium crenatum or Pantoea, but is not limited thereto.

[0054] In the implementation case of the present invention, the bacteria is specifically Escherichia coli.

[0055] In a specific implementation case of the present invention, the recipient Escherichia coli used in the fermentation production of L-threonine is Escherichia coli W3110 or Escherichia coli CGMCC No. 25404. Accordingly, the engineered bacteria are Escherichia coli W3110-ΔrsxE or Escherichia coli YPThr-ΔrsxE; the Escherichia coli W3110-ΔrsxE is a recombinant bacterium obtained by knocking out the rsxE gene (i.e., the coding gene of the SOXR [2FE-2S] reduction system protein described above) in the genome of Escherichia coli W3110; the Escherichia coli YPThr-ΔrsxE is a recombinant bacterium obtained by knocking out the rsxE gene in the genome of Escherichia coli CGMCC No. 25404.

[0056] In a specific implementation case of the present invention, the recipient Escherichia coli used in the fermentation production of L-tryptophan is Escherichia coli W3110 or Escherichia coli CGMCC No. 25403. Accordingly, the engineered bacteria is the Escherichia coli W3110-ΔrsxE or Escherichia coli YPTrp-ΔrsxE; the Escherichia coli YPTrp-ΔrsxE is a recombinant bacterium obtained by knocking out the rsxE gene in the genome of Escherichia coli CGMCC No. 25403.

[0057] In a specific implementation case of the present invention, the recipient Escherichia coli used in the fermentation production of L-arginine is Escherichia coli W3110 or Escherichia coli CGMCC No. 25402. Accordingly, the engineered bacteria is the Escherichia coli W3110-ΔrsxE or Escherichia coli YPR-ΔrsxE; the Escherichia coli YPR-ΔrsxE is a recombinant bacterium obtained by knocking out the rsxE gene in the genome of Escherichia coli CGMCC No. 25402.

[0058] In a specific implementation case of the present invention, the recipient Escherichia coli used in the fermentation production of L-valine is Escherichia coli W3110 or Escherichia coli CGMCC No. 22721. Accordingly, the engineered bacteria is the Escherichia coli W3110-ΔrsxE or Escherichia coli YPV-ΔrsxE; the Escherichia coli YPV-ΔrsxE is a recombinant bacterium obtained by knocking out the rsxE gene in the genome of Escherichia coli CGMCC No. 22721.

[0059] Experiments have shown that the present invention knocks out the rsxE gene in Escherichia coli to weaken the expression intensity of the rsxE gene, and can produce more cost-effective L-threonine, L-tryptophan, L-arginine and L-valine fermentation production strains. The present invention is of great significance for increasing the fermentation yield of L-threonine, L-tryptophan, L-arginine and L-valine.

[0060] Collection Instructions 1

[0061] Classification and nomenclature: Escherichia coli;

[0062] Reference biological material: YP0158;

[0063] Depository: General Microbiology Center, China Microbiological Culture Collection Administration;

[0064] Abbreviation of depository institution: CGMCC;

[0065] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;

[0066] Deposit date: July 25, 2022;

[0067] The registration number of the Collection Center is: CGMCC No.25404.

[0068] In the present invention, the strain is referred to as Escherichia coli CGMCC No.25404.

[0069] Collection Notes 2

[0070] Classification and nomenclature: Escherichia coli;

[0071] Reference biological material: YP006D;

[0072] Depository: General Microbiology Center, China Microbiological Culture Collection Administration;

[0073] Abbreviation of depository institution: CGMCC;

[0074] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;

[0075] Deposit date: July 25, 2022;

[0076] The registration number of the Collection Center is: CGMCC No.25403.

[0077] In the present invention, the strain is referred to as Escherichia coli CGMCC No.25403.

[0078] Collection Instructions 3

[0079] Classification and nomenclature: Escherichia coli;

[0080] Reference biological materials: YP004-8;

[0081] Depository: General Microbiology Center, China Microbiological Culture Collection Administration;

[0082] Abbreviation of depository institution: CGMCC;

[0083] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;

[0084] Deposit date: July 25, 2022;

[0085] The registration number of the Collection Center is: CGMCC No.25402.

[0086] In the present invention, the strain is referred to as Escherichia coli CGMCC No.25402.

[0087] Collection Instructions 4

[0088] Classification and nomenclature: Escherichia coli;

[0089] Reference biological materials: YP045;

[0090] Depository: General Microbiology Center, China Microbiological Culture Collection Administration;

[0091] Abbreviation of depository institution: CGMCC;

[0092] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;

[0093] Deposit date: June 15, 2021;

[0094] The registration number of the Collection Center is: CGMCC No.22721.

[0095] In the present invention, the strain is referred to as Escherichia coli CGMCC No.22721. BRIEF DESCRIPTION OF THE DRAWINGS

[0096] Figure 1 This is the pREDCas9 plasmid map.

[0097] Figure 2 This is the map of pGRB-rsxE gRNA plasmid. DETAILED DESCRIPTION

[0098] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0099] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0100] The amino acid sequence of the SOXR[2FE-2S] reduction system protein involved in the following examples is shown in SEQ ID No.6, and its gene sequence in the Escherichia coli genome (ie, the rsxE gene sequence) is shown in SEQ ID No.5.

[0101] The primers used in the construction of each engineering bacteria involved in the following examples are summarized in Table 1.

[0102] Table 1. Primer sequences

[0103] Primers Sequence (5'-3') UP-rsxE-S CTGGGCGGTGAAGAAAGATG UP-rsxE-A CCCTGTTTCACCGTTTGGCAATGGGAATGCGGATCTCG DN-rsxE-S CGAGATCCGCATTCCATTGCCAAACGGTGAAACAGGG DN-rsxE-A CTCGCCATTATGCTGCTCC gRNA-rsxE-S AGTCCTAGGTATAATACTAGTCACCGACTCCCCTTTCCTGCGTTTTAGAGCTAGAA gRNA-rsxE-A TTCTAGCTCTAAAACGCAGGAAAGGGGAGTCGGTGACTAGTATTATACCTAGGACT pRedCas9-PF GCAGTGGCGGTTTTCATG pRedCas9-PR CCTTGGTGATCTCGCCTTTC sgRNA-PF CACCGACTCCCCTTTCCTGC sgRNA-PR ATGAGAAAGCGCCACGCT pGRB-PF GTTTTAGAGCTAGAAATAGCAAG pGRB-PR CTAGTATTATACCTAGGACTGAGC RSXE-PF TAGCATGACTGGTGGACAGCAAATGGGTCGCGTGAGCGAAATTAAAGACG RSXE-PR CGGATCTCAGTGGTGGTGGTGGTGGTGTGCTCAGACATTCCCTGTTTCACC T7 TAATACGACTCACTATAGGG T7T GCTAGTTATTGCTCAGCGG

[0104] Example 1. Construction of engineered strains for producing L-amino acids

[0105] In this embodiment, an engineered bacterium W3110-ΔrsxE for producing L-amino acids (including L-threonine, L-tryptophan, L-arginine and L-valine) was constructed, as well as an L-threonine high-producing strain YPThr-ΔrsxE, an L-tryptophan high-producing strain YPTrp-ΔrsxE, an L-arginine high-producing strain YPR-ΔrsxE and an L-valine high-producing strain YPV-ΔrsxE.

[0106] The above-mentioned engineering strains were obtained by knocking out the rsxE gene (SEQ ID No. 5) of the genome of different receptor Escherichia coli using the CRISPR / Cas9 gene editing method (Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli using CRISPR–Cas9 meditated genome editing. Metabolic engineering, 2015, 31: 13-21.). The two plasmids (pREDCas9 and pGRB-rsxEgRNA) used in this method are shown in Figure 1 and Figure 2 The pREDCas9 plasmid carries the elimination system of the expression plasmid pGRB, the Red recombination system of λ phage and the Cas9 protein expression system, spectinomycin resistance (working concentration: 100 mg / L), and is cultured at 32°C; the pGRB-rsxEgRNA plasmid uses pUC18 as the backbone, including the rsxEgRNA sequence, the promoter J23100, the gRNA-Cas9 binding region sequence and the terminator sequence, ampicillin resistance (working concentration: 100 mg / L), and is cultured at 37°C.

[0107] 1. Construction of engineered bacteria W3110-ΔrsxE

[0108] 1. Construction of pGRB-rsxE gRNA plasmid

[0109] The purpose of constructing the plasmid pGRB-rsxE gRNA is to transcribe the gRNA targeting the rsxE gene in the Escherichia coli genome, thereby forming a complex with the Cas9 protein and recognizing the target gene target site through base pairing and PAM to achieve double-strand breaks in the target DNA. The pGRB-rsxE gRNA plasmid was constructed by recombination of a DNA fragment containing the target sequence with a linearized vector fragment.

[0110] (1) Target sequence design

[0111] Design target sequences using CRISPR RGEN Tools as follows:

[0112] 5'-CACCGACTCCCCTTCCTGC-3' (SEQ ID No. 1).

[0113] (2) Preparation of DNA fragments containing target sequences

[0114] Design primers: 5'-linearized vector end sequence (15 bp)-restriction site-target sequence (excluding PAM sequence)-linearized vector end sequence (15 bp)-3' and its reverse complementary primer (i.e. gRNA-rsxE-S and gRNA-rsxE-A in Table 1), and prepare a DNA fragment containing the target sequence (i.e. the insert fragment in step (4) below) by annealing single-stranded DNA. Reaction conditions: pre-denaturation at 95°C for 5 min; annealing at 30-50°C for 1 min. The annealing system is shown in Table 2.

[0115] Table 2: Annealing system

[0116] Reaction system Volume (20 μL) Primer gRNA-rsxE-S (10 μmol / L) 10μL Primer gRNA-rsxE-A (10 μmol / L) 10μL

[0117] (3) Preparation of linear vector

[0118] Using pGRB plasmid (product of Addgene, catalog number #71539) as a template, primers pGRB-PF and pGRB-PR (specific sequences see Table 1) were used for PCR amplification to obtain a linear vector.

[0119] (4) Recombination reaction

[0120] The recombination system is shown in Table 3. The recombinant enzyme used was NEBuilder enzyme (purchased from NEB Company), and the recombination conditions were: 50°C, 30min.

[0121] Table 3. Recombination system

[0122] Reaction system Volume (4μL) Linearized cloning vector (see step (3)) 1μL Insert fragment (see step (2)) 1μL NEBuilder 2μL

[0123] (5) Conversion

[0124] Take 4 μL of the recombinant reaction solution and add it to 100 mL of E. coli DH5α transfection competent cells (purchased from TAKARA). Mix gently and place on ice for 20 minutes, heat shock at 42°C for 45-90 seconds, immediately place on ice for 2-3 minutes, add 900 μL of SOC medium (purchased from TAKARA), and recover at 37°C for 1 hour. Centrifuge at 8000 rpm for 2 minutes, discard part of the supernatant, keep about 200 μL to resuspend the bacteria and apply it to a plate containing 100 mg / L ampicillin, turn the plate upside down, and culture it at 37°C overnight. After a single colony grows on the plate, the primers sgRNA-PF / sgRNA-PR (specific sequence is shown in Table 1) are used for colony PCR identification, and the 457 bp (SEQ ID No. 3) is obtained as a positive recombinant, that is, the pGRB-rsxE gRNA plasmid is obtained.

[0125] 2. Preparation of donor DNA fragments

[0126] The recombinant fragment used for knocking out the rsxE gene consists of the upstream and downstream homology arms of the rsxE gene (upstream homology arm-downstream homology arm). Using the primer design software primer5, the upstream and downstream sequences of the rsxE gene were used as templates to design the upstream and downstream homology arm primers (the primers for amplifying the upstream homology arm are UP-rsxE-S and UP-rsxE-A in Table 1, and the primers for amplifying the upstream homology arm are DN-rsxE-S and DN-rsxE-A in Table 1). The upstream and downstream homology arms were amplified by PCR using the KAPA HiFi HotStart high-fidelity amplification kit, and then the donor DNA fragment was prepared by overlapping PCR. The PCR system and method are shown in Table 4.

[0127] Table 4. PCR amplification system

[0128] Components Volume (50 μL) DNA template 1μL Upstream primer (10 μmol / L) 1μL Downstream primer (10 μmol / L) 1μL dNTP mixture (10mmol / L) 1.5μL 5×Buffer 10μL Enzyme (5U / μL) 0.5μL <![CDATA[ddH2O]]> 35μL

[0129] The overlapping PCR system is shown in Table 5.

[0130] Table 5. Overlapping PCR amplification system

[0131] Components Volume (50 μL) template 2μL Primer UP-rsxE-S (10 μmol / L) 1μL Primer DN-rsxE-A (10 μmol / L) 1μL dNTP mixture (10mmol / L) 1.5μL 5×Buffer 10μL Enzyme (5U / μL) 0.5μL <![CDATA[ddH2O]]> 34μL

[0132] Note: The template consists of equimolar amounts of the amplified fragments of the upstream and downstream homology arms and the target gene, and the total amount does not exceed 10 ng.

[0133] PCR reaction conditions (KAPA HiFi HotStart High-Fidelity Amplification Kit): pre-denaturation (95°C) for 5 min; then 30 cycles: denaturation (98°C) for 10 s, annealing ((Tm-3 / 5)°C) for 15 s, extension at 72°C (this enzyme activity extends about 1 kb per 1 min); continue extension at 72°C for 10 min; maintain (4°C).

[0134] The sequence of the final amplified product (ie, the donor DNA fragment) is shown in SEQ ID No.2.

[0135] 3. Transformation of plasmids and donor DNA fragments

[0136] (1) Transformation with pREDCas9

[0137] The pREDCas9 plasmid (product of Addgene, catalog number #71541) was electroporated into the electroporation competent state of the starting strain (Escherichia coli W3110), and the cells were revived and cultured and then plated on LB plates containing spectinomycin and cultured overnight at 32°C. Single colonies grown on the resistant plates were subjected to colony PCR using identification primers pRedCas9-PF / pRedCas9-PR, and the positive recombinant containing the pREDCas9 plasmid was obtained with 943 bp (SEQ ID No. 4).

[0138] (2) Preparation of electroporation competent cells of target strain containing pREDCas9

[0139] The positive strain containing the pREDCas9 plasmid obtained in step (1) was cultured at 32°C until OD 600 =0.1-0.2, add 0.1M IPTG (to make the final concentration 0.1mM), and continue to culture until OD 600 =0.6-0.7, the competent cells were prepared. The purpose of adding IPTG is to induce the expression of the recombinase on the pREDCas9 plasmid. The culture medium and preparation process required for the preparation of competent cells refer to conventional standard operations.

[0140] (3) Transformation of pGRB-rsxE gRNA and donor DNA fragment

[0141] The pGRB-rsxE gRNA plasmid constructed in step 1 and the donor DNA fragment prepared in step 2 were simultaneously electrotransformed into electrocompetent cells containing pREDCas9. The revived bacteria after electrotransformation were spread on LB plates containing ampicillin and spectinomycin and cultured overnight at 32°C. Colony PCR verification was performed using primers UP-rsxE-S / DN-rsxE-A (see Table 1), and the amplified fragment size of 703bp (SEQ ID No. 2) was screened as a positive recombinant and maintained.

[0142] 4. Elimination of plasmids

[0143] (1) Elimination of pGRB-rsxE gRNA plasmid

[0144] The positive recombinants obtained in the previous step were placed in LB medium containing 0.2% arabinose for overnight culture, and then appropriately diluted and spread on LB plates containing spectinomycin resistance, and cultured overnight at 32°C. Single colonies were picked and streaked one by one on LB plates containing ampicillin and spectinomycin resistance, and single colonies that did not grow on the ampicillin plate but grew on the spectinomycin resistance plate were selected to continue the elimination of the pREDCas9 plasmid.

[0145] (2) Elimination of pREDCas9 plasmid

[0146] The positive recombinants were transferred to LB liquid medium without resistance, cultured overnight at 42°C, and then appropriately diluted and spread on LB plates without resistance, and cultured overnight at 37°C. Single colonies were picked and streaked one by one onto LB plates containing spectinomycin resistance and no resistance, and single colonies that did not grow on spectinomycin resistance plates but grew on no resistance plates were selected to preserve the bacteria, thus obtaining the engineered bacteria W3110-ΔrsxE.

[0147] The final engineered bacteria W3110-ΔrsxE is a recombinant bacterium in which the rsxE gene (SEQID No. 5) in the Escherichia coli W3110 genome is knocked out. Specifically, the sequence between the upstream homologous arm (positions 1-367 of SEQ ID No. 2) and the downstream homologous arm (positions 368-703 of SEQ ID No. 2) in the Escherichia coli W3110 genome is deleted, and the other sequences are kept unchanged.

[0148] 2. Construction of L-threonine high-producing strain YPThr-ΔrsxE

[0149] See step 1. The only difference from step 1 is that the recipient bacteria is replaced by Escherichia coli W3110 with Escherichia coli CGMCC No. 25404.

[0150] The final engineered bacteria YPThr-ΔrsxE is a recombinant bacterium in which the rsxE gene (SEQ ID No. 5) in the Escherichia coli CGMCC No. 25404 genome is knocked out, specifically, the sequence located between the upstream homologous arm (positions 1-367 of SEQ ID No. 2) and the downstream homologous arm (positions 368-703 of SEQ ID No. 2) in the Escherichia coli CGMCC No. 25404 genome is deleted, and the other sequences are kept unchanged.

[0151] 3. Construction of L-tryptophan high-producing strain YPTrp-ΔrsxE

[0152] See step 1. The only difference from step 1 is that the recipient bacteria is replaced by Escherichia coli W3110 with Escherichia coli CGMCC No. 25403.

[0153] The final engineered bacteria YPTrp-ΔrsxE is a recombinant bacterium in which the rsxE gene (SEQ ID No. 5) in the Escherichia coli CGMCC No. 25403 genome is knocked out, specifically, the sequence located between the upstream homologous arm (positions 1-367 of SEQ ID No. 2) and the downstream homologous arm (positions 368-703 of SEQ ID No. 2) in the Escherichia coli CGMCC No. 25403 genome is deleted, and the other sequences are kept unchanged.

[0154] IV. Construction of the L-arginine high-producing strain YPR-ΔrsxE

[0155] See step 1. The only difference from step 1 is that the recipient bacteria is replaced by Escherichia coli W3110 with Escherichia coli CGMCC No. 25402.

[0156] The final engineered bacteria YPR-ΔrsxE is a recombinant bacterium in which the rsxE gene (SEQ ID No. 5) in the Escherichia coli CGMCC No. 25402 genome is knocked out, specifically, the sequence located between the upstream homologous arm (positions 1-367 of SEQ ID No. 2) and the downstream homologous arm (positions 368-703 of SEQ ID No. 2) in the Escherichia coli CGMCC No. 25402 genome is deleted, and the other sequences are kept unchanged.

[0157] 5. Construction of the L-valine high-producing strain YPV-ΔrsxE

[0158] See step 1. The only difference from step 1 is that the recipient bacteria is replaced by Escherichia coli W3110 with Escherichia coli CGMCC No. 22721.

[0159] The final engineered bacteria YPV-ΔrsxE is a recombinant bacterium in which the rsxE gene (SEQ ID No. 5) in the Escherichia coli CGMCC No. 22721 genome is knocked out. Specifically, the sequence located between the upstream homologous arm (positions 1-367 of SEQ ID No. 2) and the downstream homologous arm (positions 368-703 of SEQ ID No. 2) in the Escherichia coli CGMCC No. 22721 genome is deleted, and the other sequences are kept unchanged.

[0160] Example 2: Construction of an engineered strain containing a plasmid overexpressing the rsxE gene

[0161] 1. Construction of rsxE gene expression vector pET28(a)-rsxE

[0162] In order to construct an overexpression plasmid of the rsxE gene, the wild-type rsxE gene (sequence as SEQ ID No. 5) needs to be cloned into the expression vector pET28 (a). The Escherichia coli W3110 genome sequence published by NCBI was used as a template and amplified with primers RSXE-PF / RSXE-PR PCR (sequence shown in Table 1) to obtain the wild-type rsxE gene. After recovery, it was connected with the expression vector pET28 (a) (purchased from BioVeector, containing kanamycin resistance) recovered by BamH I / Xho I digestion using NEBuilder enzyme (purchased from NEB) at 50°C for 30 minutes, and the connection product was transformed into DH5α, spread on a 2-YT agar plate containing kanamycin (50 mg / L) and cultured at 37°C to obtain the pET28 (a) transformant pET28 (a)-rsxE containing the rsxE gene. The single clone grown in culture was identified using primers T7 / T7t (sequence shown in Table 1) and r Taq PCR. The PCR amplified fragment containing 983 bp (sequence shown in SEQ ID No. 7) was the pET28(a) positive transformant pET28(a)-rsxE containing the rsxE gene.

[0163] 2. Construction of an engineered strain overexpressing the rsxE gene

[0164] In order to verify the effect of overexpression of rsxE gene on the production of L-amino acids such as L-threonine, L-tryptophan, L-valine and L-arginine, the expression vector pET28(a)-rsxE constructed in step 1 was introduced into L-threonine-producing bacteria CGMCC No.25404, L-tryptophan-producing bacteria CGMCC No.25403, L-arginine-producing bacteria CGMCC No.25402 and L-valine-producing bacteria CGMCC No.22721, respectively, so as to further study the effect of overexpression of rsxE gene on the production of L-amino acids such as L-threonine, L-tryptophan, L-valine and L-arginine in high-yield strains.

[0165] Prepare competent cells of E. coli of L-threonine CGMCC No.25404, L-tryptophan CGMCC No.25403, L-arginine CGMCC No.25402 and L-valine CGMCC No.22721. 600=0.6, collect the bacteria to prepare competent cells, and transform the plasmid pET28(a)-rsxE constructed in step 1, spread on 2-YT agar plates containing kanamycin (50 mg / L) and culture at 37°C. The single colonies produced by the culture were identified by primers T7 / T7t and rTaq PCR. The PCR amplified fragment containing 983 bp (such as SEQ ID No. 7) was a positive transformant, and the fragment that could not be amplified was the original bacterium.

[0166] PCR amplification system: 2×Premix r Taq 12.5 μL, upstream and downstream primers (10 pM) 1 μL each, supplemented with ddH2O, total volume 25 μL.

[0167] PCR amplification program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s; 56°C annealing for 30 s; 72°C extension for 90 s (30 cycles), 72°C over-extension for 10 min.

[0168] The overexpression plasmid pET28(a)-rsxE was introduced into L-threonine-producing bacteria CGMCC No.25404, L-tryptophan-producing bacteria CGMCC No.25403, L-arginine-producing bacteria CGMCC No.25402 and L-valine-producing bacteria CGMCC No.22721, respectively, and the recombinant bacteria obtained were named YPThr-pET28(a)-rsxE, YPTrp-pET28(a)-rsxE, YPR-pET28(a)-rsxE and YPV-pET28(a)-rsxE.

[0169] The expression plasmid pET28(a)-rsxE in the recombinant bacteria YPThr-pET28(a)-rsxE, YPTrp-pET28(a)-rsxE, YPR-pET28(a)-rsxE and YPV-pET28(a)-rsxE contains the rsxE gene shown in SEQ ID No.5. The recombinant bacteria overexpressing pET28(a)-rsxE can significantly and stably increase the expression level of SOXR[2FE-2S] reduction system protein.

[0170] Example 3, L-amino acid fermentation test

[0171] 1. L-threonine fermentation experiment

[0172] Escherichia coli W3110, Escherichia coli CGMCC No. 25404, and the engineered bacteria W3110-ΔrsxE and YPThr-ΔrsxE constructed in Example 1, and the engineered bacteria YPThr-pET28 (a) -rsxE constructed in Example 2 were inoculated in a 5L fermenter of the BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) with L-threonine fermentation medium and culture conditions for fermentation experiments, and each strain was repeated three times. Among them, YPThr-pET28 (a) -rsxE is a strain containing the pET28 (a) expression vector, and IPTG induction is required during the fermentation process. The specific induction method is: after the fermentation culture is inoculated, IPTG with a final concentration of 0.1mM is added to induce overexpression of the rsxE gene. After the fermentation is completed, the L-threonine content is detected by high performance liquid chromatography (HPLC), and the results are taken as the average of three repetitions, as shown in Table 6. Experimental results: P<0.05(*) indicates a significant difference, and P<0.01(**) indicates an extremely significant difference.

[0173] L-threonine fermentation medium: the solvent is water, the solutes and their concentrations are glucose 13 g / L, (NH4)2SO4 1 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.01 g / L, MnSO4·H2O 0.01 g / L, FM902 yeast powder 1.5 g / L, corn syrup 5 g / L, molasses 17 g / L, and ammonia is added to adjust the pH to 7.0.

[0174] L-Threonine fermentation conditions:

[0175] Calibration DO 100%: temperature 37℃, air volume 5L / min, speed 800rpm, tank pressure 0Mpa, calibration after 5min;

[0176] Inoculum size 10% (v / v);

[0177] Initial conditions: pH 7.0, culture temperature 37°C, tank pressure 0 MPa, air volume 0.5 L / min, rotation speed 400 rpm;

[0178] Full process control: 1. When dissolved oxygen is less than 30%, the rotation speed is increased in sequence: 500rpm→600rpm→air volume 1L / min→700rpm→800rpm; 2. After 8h of fermentation, the tank pressure is increased by 0.01Mpa; after 12h of fermentation, the tank pressure is increased by 0.02Mpa→0.03Mpa→0.04Mpa→0.05Mpa;

[0179] Residual sugar control: 0.1-0.5% before F12h; after F12h, the residual sugar should be controlled at 0.1-0.3% in combination with DO requirements;

[0180] Feed materials: 25% ammonia water, 55% concentrated sugar, 10% sodium bicarbonate;

[0181] Fermentation cycle: about 30 hours, the control process uses 20-30% dissolved oxygen as the standard for increasing and decreasing air volume.

[0182] Table 6. L-threonine production of rsxE engineered strains

[0183]

[0184] Note: ns means there is no significant difference in the production of L-threonine between YPThr-pET28(a)-rsxE and CGMCC No.25404 (P>0.05).

[0185] As shown in the above fermentation results, whether for the high-yield L-threonine strain CGMCC No.25404 or the model strain W3110, the knockout of the rsxE gene helps to increase the L-threonine production, while overexpression of the rsxE gene has no effect on improving the production of L-threonine.

[0186] 2. L-Tryptophan Fermentation Experiment

[0187] Escherichia coli W3110, Escherichia coli CGMCC No. 25403, and the engineered bacteria W3110-ΔrsxE and YPTrp-ΔrsxE constructed in Example 1, and the engineered bacteria YPTrp-pET28 (a) -rsxE constructed in Example 2 were inoculated in a 5L fermenter of the BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) with L-tryptophan fermentation medium and culture conditions for fermentation experiments, and each strain was repeated three times. Among them, YPTrp-pET28 (a) -rsxE is a strain containing the pET28 (a) expression vector, and IPTG induction is required during the fermentation process. The specific induction method is: after the fermentation culture is inoculated, IPTG with a final concentration of 0.1mM is added to induce overexpression of the rsxE gene. After the fermentation is completed, the L-tryptophan content is detected by high performance liquid chromatography (HPLC), and the results are taken as the average of three repetitions, as shown in Table 7. Experimental results: P<0.05(*) indicates a significant difference, and P<0.01(**) indicates an extremely significant difference.

[0188] L-tryptophan fermentation medium: the solvent is water, the solutes and their concentrations are glucose 7g / L, FM902 yeast powder 1g / L, (NH4)2SO4 1.2g / L, citric acid 1.2g / L, MgSO4·7H2O 1.5g / L, K2HPO4·3H2O 5.5g / L, defoaming agent 0.2mL / L, and ammonia is added to adjust the pH to 7.0.

[0189] L-Tryptophan Culture Conditions:

[0190] Calibration DO 100%: temperature 35°C, speed 800rpm, air volume 5L / min, tank pressure 0.00Mpa;

[0191] Inoculum size 10% (v / v);

[0192] Initial conditions: temperature 35°C, pH 7.0, air volume 1.0 L / min, speed 350 rpm;

[0193] Full process control: before the end of the basal sugar consumption, when the dissolved oxygen is ≤20%, increase →400rpm→450rpm in sequence; after the end of the basal sugar consumption, add sugar to control the dissolved oxygen to 15-30%; pH F7.0 before 24h, F6.7 after 24h;

[0194] Residual sugar control: 0.1-0.5% before F12h; after F12h, the residual sugar should be controlled at 0.1-0.3% in combination with DO requirements;

[0195] Feed materials: 25% ammonia water, 55% concentrated sugar, 10% sodium bicarbonate;

[0196] Fermentation cycle: about 34 hours, the control process uses 15-30% dissolved oxygen as the standard for increasing and decreasing air volume.

[0197] Table 7. L-tryptophan production of rsxE engineered strains

[0198]

[0199] Note: ns means there is no significant difference in L-tryptophan production between YPTrp-pET28(a)-rsxE and CGMCC No.25403 (P>0.05).

[0200] As shown in the above fermentation results, whether for the high-L-tryptophan-producing strain CGMCC No.25403 or the model strain W3110, the knockout of the rsxE gene helps to increase the L-tryptophan production, while overexpression of the rsxE gene has no effect on improving the production of L-tryptophan.

[0201] 3. L-arginine fermentation experiment

[0202] Escherichia coli W3110, Escherichia coli CGMCC No. 25402, and the engineered bacteria W3110-ΔrsxE and YPR-ΔrsxE constructed in Example 1, and the engineered bacteria YPR-pET28 (a) -rsxE constructed in Example 2 were inoculated in a 5L fermenter of the BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) with L-arginine fermentation medium and culture conditions for fermentation experiments, and each strain was repeated three times. Among them, YPR-pET28 (a) -rsxE is a strain containing pET28 (a) expression vector, and IPTG induction is required during the fermentation process. The specific induction method is: after the fermentation culture is inoculated, IPTG with a final concentration of 0.1mM is added to induce overexpression of the rsxE gene. After the fermentation is completed, the L-arginine content is detected by high performance liquid chromatography (HPLC), and the results are taken as the average of three repetitions, as shown in Table 8. Experimental results: P<0.05(*) indicates a significant difference, and P<0.01(**) indicates an extremely significant difference.

[0203] L-arginine fermentation medium: the solvent is water, the solutes and their concentrations are glucose 8g / L, FM902 yeast powder 3g / L, K2HPO4·3H2O 6g / L, MgSO4·7H2O 1g / L, FeSO4·7H2O 0.05g / L, betaine 0.5g / L, VB 12 0.005g / L, defoamer 0.3mL / L, ammonium sulfate 3g / L, pH 7.2.

[0204] L-arginine fermentation conditions:

[0205] Calibration DO 100%: temperature 35°C, pH 7.2, speed 100rpm, air volume 6L / min, tank pressure 0.00Mpa;

[0206] Inoculum size 10% (v / v);

[0207] Initial conditions: temperature 35°C, pH 7.2, tank pressure 0.01 MPa, air volume 1.5 L / min, speed 350 rpm;

[0208] Full process control: control DO at 20-30%; when dissolved oxygen ≤ 25%, increase the speed each time: 300rpm→400rpm→2.0L / min→500rpm→0.02Mpa→600rpm→3.0L / min→0.03Mpa→700rpm→3.5L / min→0.04Mpa→800rpm→900rpm→4.0L / min→0.05Mpa→1000rpm;

[0209] Residual sugar control: The residual sugar is controlled at 0.05-0.1% throughout the process;

[0210] Feed materials: 25% ammonia water, 80% concentrated sugar, 10% sodium bicarbonate;

[0211] Fermentation cycle: about 50h, the control process uses 20-30% dissolved oxygen as the standard for increasing and decreasing air volume.

[0212] Table 8. L-arginine production of rsxE engineered strains

[0213]

[0214] Note: ns means that there is no significant difference in the production of L-arginine between YPR-pET28(a)-rsxE and CGMCC No.25402 (P>0.05).

[0215] As shown in the above fermentation results, whether for the high-yield L-arginine strain CGMCC No.25402 or the model strain W3110, the knockout of the rsxE gene helps to increase the L-arginine production, while overexpression of the rsxE gene has no effect on improving the production of L-arginine.

[0216] IV. L-valine fermentation experiment

[0217] Escherichia coli W3110, Escherichia coli CGMCC No. 22721, and the engineered bacteria W3110-ΔrsxE and YPV-ΔrsxE constructed in Example 1, and the engineered bacteria YPV-pET28 (a) -rsxE constructed in Example 2 were inoculated in a 5L fermenter of the BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) with L-valine fermentation medium and culture conditions for fermentation experiments, and each strain was repeated three times. Among them, YPV-pET28 (a) -rsxE is a strain containing the pET28 (a) expression vector, and IPTG induction is required during the fermentation process. The specific induction method is: after the fermentation culture is inoculated, IPTG with a final concentration of 0.1mM is added to induce overexpression of the rsxE gene. After the fermentation is completed, the L-valine content is detected by high performance liquid chromatography (HPLC), and the results are taken as the average of three repetitions, as shown in Table 9. Experimental results: P<0.05(*) indicates a significant difference, and P<0.01(**) indicates an extremely significant difference.

[0218] L-valine fermentation medium: the solvent is water, the solutes and their concentrations are yeast extract powder 4g / L, corn steep liquor powder 2g / L, peptone 4g / L, methionine 2g / L, KH2PO4·3H2O 7g / L, MgSO4·7H2O 2g / L, CoCl2 20mg / L, (NH4)2SO4 3g / L, citric acid 2g / L, FeSO4·7H2O 50mg / L, MnSO4·7H2O 30mg / L, VH 20mg / L, VB11.5mg / L, VB3 1.5mg / L VB 12 1.5g / L, defoamer 0.3mL / L, (NH4)2SO4 3g / L, pH 7.0.

[0219] L-valine fermentation conditions:

[0220] Dissolved oxygen electrode calibration method: calibrate the zero point in saturated sodium sulfite solution and calibrate the hundred point in air;

[0221] Fermentation control temperature: 35℃;

[0222] Fermentation period: 30h;

[0223] L-valine fermentation includes two stages of aerobic-limited oxygen fermentation. The cells are first cultured under aerobic fermentation. The air volume, speed and sugar addition rate are adjusted in the early stage to control the dissolved oxygen at about 25%. 600 When the value reaches 50-60, the speed is reduced to 400rpm and the air volume is reduced to 2L / min; and the aerobic fermentation is converted to oxygen-limited fermentation.

[0224] Table 9. L-valine production of rsxE engineered strains

[0225]

[0226] Note: ns means that there is no significant difference in the production of L-valine between YPV-pET28(a)-rsxE and CGMCC No.22721 (P>0.05).

[0227] As shown in the above fermentation results, whether for the high-yield L-valine strain CGMCC No.22721 or the model strain W3110, the knockout of the rsxE gene helps to increase the L-valine yield, while overexpression of the rsxE gene has no effect on improving the production of L-valine.

[0228] From all the above fermentation results, it can be seen that, no matter for strains with high production of corresponding L-amino acids or model strain W3110, knockout of rsxE gene helps to increase the production of L-threonine, L-tryptophan, L-arginine and L-valine, while overexpression of rsxE gene has no effect on improving the production of L-threonine, L-tryptophan, L-arginine and L-valine.

[0229] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Any of the following applications: (A1) Use of inhibiting the expression and / or activity of SOXR [2FE-2S] reduction system protein in the preparation of L-amino acids; (A2) Use of a substance that inhibits the expression and / or activity of a SOXR [2FE-2S] reduction system protein in the preparation of L-amino acids.

2. The use according to claim 1, characterized in that: Inhibiting the expression and / or activity of the SOXR[2FE-2S] reduction system protein is achieved by any of the following methods: knocking out or reducing the expression of the gene encoding the SOXR[2FE-2S] reduction system protein in the genome of the recipient bacteria; The substance is a substance that can knock out or reduce the expression of the gene encoding the SOXR[2FE-2S] reduction system protein in the genome of the recipient bacteria.

3. A recombinant bacterium, characterized in that: The activity of the SOXR[2FE-2S] reduction system protein in the recombinant bacteria is reduced or inactivated or not expressed.

4. The recombinant bacterium according to claim 3, characterized in that: The recombinant bacteria is at least selected from one or more of Escherichia coli, Corynebacterium glutamicum and Pantoea.

5. Use of the recombinant bacteria according to claim 3 or 4 in the fermentation production of L-amino acids.

6. A method for constructing an engineered bacterium for producing L-amino acids, comprising the steps of: inhibiting the expression and / or activity of a SOXR[2FE-2S] reduction system protein in a recipient bacterium; The recipient bacteria are bacteria.

7. A method for producing L-amino acids, comprising the following steps: culturing the recombinant bacteria according to claim 3 or 4, and obtaining L-amino acids from the fermentation products.

8. The use or recombinant bacteria or method according to any one of claims 1 to 7, characterized in that: The SOXR[2FE-2S] reduction system protein comprises any of the following: (B1) a protein comprising the amino acid sequence shown in SEQ ID No.6; (B2) A protein derived from bacteria and having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the protein defined in (B1) and associated with the production of L-amino acids.

9. The use or recombinant bacteria or method according to any one of claims 1 to 8, characterized in that: The coding gene of the SOXR[2FE-2S] reduction system protein includes any of the following: (C1) DNA molecule shown in SEQ ID No.5; (C2) A DNA molecule derived from bacteria that has more than 99%, more than 95%, more than 90%, more than 85% or more identity with the DNA sequence defined in (C1) and encodes the SOXR[2FE-2S] reduction system protein.

10. The use or recombinant bacteria or method according to any one of claims 1 to 9, characterized in that: The L-amino acid is L-threonine, L-tryptophan, L-arginine and / or L-valine.

Images