Construction method and application of fusion enzyme escherichia coli genetically engineered bacterium capable of directionally synthesizing high-molecular-weight dextran

Abstract

The invention discloses a construction method of fusion enzyme escherichia coli engineering bacteria capable of directionally synthesizing high-molecular-weight dextran and application of the fusion enzyme escherichia coli engineering bacteria. P473S dextran sucrase genes and dextran enzyme BMdex genes are used as templates, and the two enzyme genes are subjected to homologous recombination according to a catalysis sequence and are converted into BL21 (DE3) escherichia coli; and the fusion enzyme escherichia coli BL21 (DE3) / dex-P473S-BMdex genetically engineered bacterium capable of directionally synthesizing dextran with different high molecular weights is obtained. The dex-P473S-BMdex genetically engineered bacterium constructed by the method disclosed by the invention can be used for producing a fusion enzyme for directionally synthesizing high-molecular-weight dextran through fermentation expression; sucrose is used as a substrate, and 1500kDa dextran with concentrated molecular weight can be directly obtained through fusion enzyme catalysis.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a construction method and application of a fusion enzyme Escherichia coli genetic engineering bacterium capable of directing the synthesis of high-molecular-weight dextran. Background Art

[0002] Dextran, also known as glucan, has a molecular formula of (C6H 10 O5) n , usually derived from the dextran sucrase of Leuconostoc entericola, using sucrose as substrate to synthesize a microbial polysaccharide with α(1,6) glycosidic bonds as the main chain (more than 50%), α(1,3) glycosidic bonds as the side chains, and occasionally α(1,2) glycosidic bonds and α(1,4) glycosidic bonds as the side chains. Due to the different degrees of polymerization of dextran, its molecular weight also varies greatly. Dextran with different molecular weights has different application values ​​and is mainly used in the food and pharmaceutical industries. Dextran with a weight average molecular weight greater than 1MDa can be used as a chromatographic column filler. Dextran with a weight average molecular weight of 1-2MDa can be used as a food additive to improve the texture properties of fermented dairy products and baked goods. Dextran with a weight average molecular weight of 40-100KDa can be used as a blood volume expander in the medical industry for emergency treatment of clinical blood loss. Dextran 40 and dextran 70 can be used as plasma substitutes. Low molecular weight dextran (less than 2000 Da) has been shown to be a potential prebiotic.

[0003] Dextran sucrase is a kind of glucosyltransferase belonging to the GH70 family. The dextran products catalyzed by wild dextran sucrase generally have the problems of high molecular weight and high viscosity, and the products are not easy to separate and purify. In order to control the molecular weight of dextran products, chemical, physical or biological methods are often required to further degrade high molecular weight dextran. Acid hydrolysis is a traditional chemical method for degrading high molecular weight dextran. Although the degradation rate of acid hydrolysis is fast, there are a lot of chlorides and product inhomogeneity in the dextran products obtained by acid hydrolysis. Ultrasonic method is a physical method for degrading high molecular weight dextran. Although this method is simple to operate, it has the disadvantage of high energy consumption and is not suitable for large-scale production of dextran. Degrading high molecular weight dextran using dextranase can obtain dextran products in a green and efficient way.

[0004] Dextranase can specifically catalyze the hydrolysis of α-1,6 glycosidic bonds in dextran. Dextranase includes exodextranase and endodextranase. Exodextranase acts on the reducing or non-reducing end of dextran, hydrolyzing the substrate to release glucose, isomaltose or isomaltotriose. Endodextranase acts on the internal glycosidic bonds of dextran, thereby producing dextran of different molecular weights, oligoisomaltolsaccharides (DP 2-10), panose and glucose.

[0005] At present, there are reports on fusing dextran sucrase and dextranase to construct a fusion enzyme to directly produce low molecular weight dextran. For example, by fusing these two enzymes, the molecular weight of dextran was regulated by controlling the sucrose concentration, and low molecular weight dextran was successfully produced, and the yield of the fusion enzyme was 30 times higher than that of the mixture of the dual enzyme method with the same activity. And by adding different lengths of connecting peptides between dextran sucrase and dextranase to construct a fusion enzyme, an artificial bifunctional enzyme was successfully constructed, which can directly convert sucrose into low molecular weight dextran (13,050 Da), and the two-stage catalytic efficiency of the fusion enzyme was successfully adjusted by studying the temperature dynamics of the fusion enzyme, which increased the yield of low molecular weight homogeneous dextran (yield of 62%).

[0006] It can be seen that low molecular weight dextran can be successfully produced by fusing dextran sucrase and dextran from different sources, but there are few reports on the fusion of two enzymes to produce high molecular weight dextran. Summary of the invention

[0007] The purpose of the present invention is to provide a fusion enzyme Escherichia coli genetic engineering bacteria capable of directing the synthesis of high molecular weight dextran and its construction method and application. The present invention utilizes the sequential cascade relationship between two enzymes to construct a fusion enzyme and directly obtain a relatively uniform high molecular weight dextran product by a one-step enzymatic method.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] Firstly, the present invention provides a method for constructing a fusion enzyme Escherichia coli genetically engineered bacterium capable of directionally synthesizing high-molecular-weight dextrans, which uses the dextransucrase P473S gene and the dextranase BMdex gene as templates, sequentially homologously recombines the dextransucrase P473S gene and the dextranase BMdex gene and transforms them into BL21 (DE3) Escherichia coli to obtain a fusion enzyme Escherichia coli genetically engineered bacterium capable of directionally synthesizing different high-molecular-weight dextrans.

[0010] The above-mentioned construction method may preferably include the following steps: (1) seamless connection and molecular simulation of the P473S dextransucrase gene and the dextranase BMdex gene, (2) primer design, (3) recombinant plasmid construction and (4) host bacteria transformation.

[0011] For the construction method described above, preferably, in step (1) seamless connection and molecular simulation of the P473S dextransucrase gene and the dextranase BMdex gene, the P473S dextransucrase gene protein and the dextranase BMdex are subjected to sequence similarity comparison and template search through Discovery Studio 2019 software, the templates are structurally aligned and superimposed, the target sequence is aligned with the template sequence, and a fusion enzyme model is generated using MODELLER and then a feasibility analysis is performed.

[0012] For the construction method described above, preferably, the primer design in step (2) is based on the P473S dextran sucrase gene, the vector pET-28a-(+) and the dextranase BMdex gene sequence, and the mutation primers are designed with the help of SnapGene software as follows:

[0013] pET-28a-(+)-P473S Template:

[0014] Upstream primer:

[0015] 5'--TGGTCGGCATTGCTGACACAGCATTTCCATTATTATCAAA---3'

[0016] Downstream primer:

[0017] 5'--GAAAAGCACCCCGCTCGAGCACCACCACCACCACCACTGA--3'

[0018] BMdex template:

[0019] Upstream primer:

[0020] 5'--AAATGCTGTCAGCAATGCCGACCACCGGCCTGCGTCAG--3'

[0021] Downstream primer:

[0022] 5'--GGTGGTGGTGGTGGGTGCTCGAGCGGGGTGCTTTTCCA --3'.

[0023] For the construction method described above, preferably, the recombinant plasmid construction in step (3) is based on the P473S dextran sucrase gene and the vector pET-28a-(+) and the dextranase BMdex sequence template, using the designed primers, through PCR amplification technology and seamless cloning technology, and digesting the original template with DMT to obtain the recombinant expression plasmid pET-28a-(+)-dex-P473S-BMdex.

[0024] For the construction method described above, preferably, in step (4), host bacteria transformation is to transform the recombinant expression plasmid pET-28a-(+)-dex-P473S-BMdex into Escherichia coli competent cells BL21 (DE3), and then verify by kanamycin resistance screening, enzyme digestion, bacterial liquid PCR and DNA sequencing.

[0025] Secondly, the present invention can obtain a fusion enzyme Escherichia coli BL21 (DE3) / dex-P473S-BMdex genetically engineered bacteria that can synthesize high molecular weight dextran in a directed manner through the above-mentioned construction method.

[0026] Thirdly, the present invention also provides the use of the above-mentioned fusion enzyme Escherichia coli BL21 (DE3) / dex-P473S-BMdex genetic engineering bacteria capable of directing the synthesis of high molecular weight dextran in catalyzing the conversion of sucrose into high molecular weight dextran, wherein preferably, the weight average molecular weight of the high molecular weight dextran is 1400-1600 kD. The sucrose conversion rate can reach more than 86%.

[0027] For the above-mentioned application, it is preferred that the fusion enzyme is first expressed by fermenting Escherichia coli BL21 (DE3) / dex-P473S-BMdex genetically engineered bacteria, and then high molecular weight dextran is obtained by catalysis of the fusion enzyme using sucrose as a substrate.

[0028] For the above-mentioned application, preferably, the fermentation of Escherichia coli BL21 (DE3) / dex-P473S-BMdex genetically engineered bacteria to express the fusion enzyme may include the following steps: inoculating Escherichia coli BL21 (DE3) / dex-P473S-BMdex genetically engineered bacteria at a volume fraction of 0.5% into LB culture medium containing 40-60 μg / ml kanamycin, rotating at 250 r / min, and culturing at 37°C for 16 hours; taking 4 mL from the above culture solution and adding it to 200 mL of A culture medium, placing it in a shaking table at 37°C for culturing, and when the enriched cultured bacterial solution is diluted 10 times with distilled water, the OD 600When the pH value is 0.20 to 0.24, 500 μL IPTG can be added to start inducing enzyme production, and the fermentation is induced at 15°C for 3.5 to 4 hours. The bacterial suspension after induced fermentation is centrifuged at 8000 r / min for 15 min at 4°C. One centrifuge tube corresponds to one bottle of bacterial suspension, and then distilled water is added for oscillation and washing, and centrifugation is performed again; 15 to 20 mL of acetic acid-calcium acetate buffer with a pH value of 5.4 is added to each centrifuge tube, shaken and evenly mixed, an ice water bath is added, ultrasonically broken for 15 min, and centrifuged to separate. The supernatant is the fusion enzyme that can synthesize high molecular weight dextran in a directed manner, and the enzyme activity is 70 to 100 U / mL; each liter of the A culture medium contains 5 g glycerol, 5 g glucose, 10 g peptone, 10 g potassium nitrate, 17.105 g Na2HPO4·12H2O, 3 g KH2PO4, 1 g NH4Cl, and 0.1 mmol / L MgSO4·7H2O.

[0029] The fusion enzyme for the directed synthesis of dextran prepared by fermentation of the genetically engineered bacteria of the present invention uses sucrose as a substrate, and can directly obtain dextran with a molecular weight concentrated around 1500 kDa through bifunctional catalysis. Based on the relationship between the sequential cascade catalysis (polymerization and hydrolysis) between dextran sucrase and dextranase, the synergistic catalysis of dextran sucrase and dextranase to produce low molecular weight dextran was studied. Although Gan Weiwei et al. obtained a low molecular weight main product (such as 5241 Da) through the synergistic catalysis of dextran sucrase and dextranase, there were still medium molecular weight byproducts (19374 Da, 8295 Da). Sharma et al. obtained oligosaccharide (DP3-7) by co-immobilization catalysis of dextranase and dextranase, but the degree of polymerization was uneven. Therefore, the one-step production of dextran with uniform molecular weight is a problem to be solved. The invention uses the dextran sucrase YG (Genbank No. ABC75033.1) mutant P473S (source: Int J Biol Macromol 2017.10.023) constructed by Li Mengqi and others and the dextranase gene BMdex (Genbank No. BAA76382.1) as templates, sequentially homologously recombines the two enzyme genes and transforms them into BL21 (DE3) Escherichia coli to obtain BL21 (DE3) / dex-P473S-BMdex genetic engineering bacteria, and produces a fusion enzyme for directed synthesis of high molecular weight dextran through fermentation expression; using sucrose as a substrate, 1500 kDa dextran (T1500) with a concentrated molecular weight can be directly obtained through fusion enzyme catalysis. Under the same conditions and reaction time, the fusion enzyme expressed by the engineered bacteria BL21 (DE3) / dex-P473S-5rl-BMdex has a smaller molecular weight and is more concentrated than the product of the synergistic catalysis of the dual enzyme free enzyme, and the yield of dextran T1500 can reach 32.6% within 24 hours of reaction.

[0030] The BL21 (DE3) / dex-P473S-BMdex genetically engineered bacteria constructed by the present invention can be fermented and cultured at 37°C and then induced with IPTG at 15°C by controlling conditions, and the crude enzyme solution can be crushed in a calcium acetate buffer solution with a pH of 5.4 and then product catalyzed at 30°C, and finally a dextran product with a weight average molecular weight of 1500 kDa can be obtained. The present invention can specifically produce 1500 kDa dextran, simplifies the separation and purification steps, reduces the production cost, and provides a certain basis for better application in production. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1This is a diagram of the construction of a fusion plasmid of dextran sucrase and dextran enzyme; the P473S dextran sucrase gene and the vector pET-28a-(+) and the dextran enzyme BMdex gene were extracted separately as shown in the right figure, and the two were combined by seamless connection to obtain the left figure.

[0032] Figure 2 It is a three-dimensional structure simulation diagram of dextransucrase and dextranase fusion enzyme through homology modeling by Discovery Studio 2019 software;

[0033] Figure 3 This is a diagram of the one-step directional catalysis and dual-enzyme synergistic catalysis mechanism of the present invention; sucrose is degraded into fructose and high molecular weight dextran under the action of dextran sucrase P473S, and then stable dextran with uniform molecular weight is generated under the catalysis of dextranase BMdex;

[0034] Figure 4 This is a molecular weight HPLC chart of dextran T1500, a product catalyzed by the fusion enzyme of the present invention; the molecular weight of the dextran product with a uniform molecular weight of 1500 kDa is characterized by the fusion enzyme after successful fusion generated in 16.38 min under the catalysis of sucrose;

[0035] Figure 5 It is a one-dimensional hydrogen spectrum of the product dextran T1500 of the present invention.

[0036] Figure 6 This paper compares the results of cooperative catalysis and fusion enzyme catalysis of dextransucrase P473S and dextranase BMdex free enzyme. DETAILED DESCRIPTION

[0037] The following embodiments are further descriptions of the content of the present invention as an explanation of the technical content of the present invention, but the essential content of the present invention is not limited to the following embodiments. Ordinary technicians in this field can and should know that any simple changes or replacements based on the essential spirit of the present invention should fall within the scope of protection required by the present invention.

[0038] Example 1

[0039] A method for constructing a fusion enzyme Escherichia coli capable of directing the synthesis of dextran with a weight-average molecular weight of 1500 kDa, using the dextran sucrase P473S gene and the dextran BMdex gene as templates, sequentially homologously recombining the two enzyme genes and transforming them into BL21 (DE3) Escherichia coli to obtain a fusion enzyme Escherichia coli BL21 (DE3) / dex-P473S-BMdex genetic engineering bacteria capable of directing the synthesis of T1500 dextran. The BL21 (DE3) / dex-P473S-BMdex genetic engineering bacteria, referred to as dex-P473S-BMdex, has a deposit number of CGMCC No. 33058, and was deposited in the General Microbiology Center of the China National Committee for the Preservation and Administration of Microbiological Cultures (No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing) on ​​December 13, 2024, and is classified and named Escherichia coli.

[0040] The construction method specifically comprises the following steps:

[0041] (1) Molecular simulation: P473S dextran sucrase protein and BMdex dextran sucrase protein were compared for sequence similarity and searched for templates using Discovery Studio 2019 software. The templates were structurally aligned and superimposed. The target sequence was aligned with the template sequence and a fusion enzyme model was generated using MODELLER, followed by a feasibility analysis.

[0042] (2) Primer design: Based on the P473S dextran sucrase gene, vector pET-28a-(+) and dextranase BMdex sequence, the mutation primers were designed with the help of SnapGene software as follows:

[0043] pET-28a-(+)-P473S Template:

[0044] Upstream primer:

[0045] 5'----- TGGTCGGCATTGCTGACACAGCATTTCCATTATTATCAAA -----3'

[0046] Downstream primer:

[0047] 5'-----GAAAAGCACCCCGCTCGAGCACCACCACCACCACCACTGA-----3'

[0048] BMdex template:

[0049] Upstream primer:

[0050] 5'-----AAATGCTGTCAGCAATGCCGACCACCGGCCTGCGTCAG-----3'

[0051] Downstream primer:

[0052] 5'-----GGGTGGTGGTGGTGGTGCTCGAGCGGGGTGCTTTTCCA -----3'.

[0053] (3) Construction of the recombinant plasmid: Based on the P473S dextran sucrase gene, the vector pET-28a-(+) and the dextranase BMdex sequence template, the designed primers were used, PCR amplification technology and seamless cloning technology were used, and the original template was digested with DMT to obtain the recombinant expression plasmid pET-28a-(+)-dex-P473S-BMdex.

[0054] (4) Host bacteria transformation: The recombinant expression plasmid pET-28a-(+)-dex-P473S-BMdex was transformed into the competent Escherichia coli cells BL21 (DE3). After kanamycin resistance screening, enzyme digestion, bacterial liquid PCR and DNA sequencing verification, the fusion enzyme Escherichia coli engineered bacteria BL21 (DE3) / dex-P473S-BMdex suitable for the directed synthesis of dextran were obtained.

[0055] The host bacteria transformation may specifically include the following steps:

[0056] (1) Take 100 μL of E. coli BL21 (DE3) competent cell suspension (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) from the -80 ℃ refrigerator and thaw it on ice;

[0057] (2) Add the prepared recombinant expression plasmid solution, add about 5 μl of plasmid DNA per 50 μl of competent cells, shake gently, and place on ice for 30 minutes;

[0058] (3) Heat shock in a 42°C water bath for 45 seconds, then quickly cool on ice for 2 minutes;

[0059] (4) Add 500 ml of sterilized LB liquid medium (without antibiotics) to the tube, mix well, and culture at 37 °C for 1 hour to allow the bacteria to return to normal growth and express the resistance gene encoded by the plasmid;

[0060] (5) After shaking the above bacterial solution, take 100 μL and spread it on the screening plate containing antibiotics, place it with the front side facing up for half an hour, and when the bacterial solution is completely absorbed by the culture medium, invert the culture medium and culture it at 37°C for 16 to 18 hours; select positive colonies, and verify them by PCR of the bacterial solution to obtain the fusion enzyme Escherichia coli engineered bacteria BL21 (DE3) / dex-P473S-2rl-BMdex that can synthesize dextran in a directed manner.

[0061] Example 2

[0062] Expression of the fusion enzyme Escherichia coli engineered bacteria BL21 (DE3) / dex-P473S-2rl-BMdex that can direct the synthesis of dextran.

[0063] The genetically engineered bacteria BL21 (DE3) / dex-P473S-BMdex were inoculated into LB medium containing 40-60 μg / ml kanamycin at a rate of 0.5%, and cultured at 37 °C for 16 hours at a speed of 250 r / min. 2 mL of the culture medium was taken out and added to 200 mL of A medium, and cultured in a shaking incubator at 37 °C. When the enriched culture solution was diluted 10 times with distilled water, the OD 600 At 0.20-0.24, 500 μL IPTG can be added to start inducing enzyme production. After induced fermentation at 15°C for 3.5-4 hours, crushing and centrifugation are performed. Among them, each liter of the A culture medium contains 5 g glycerol, 5 g glucose, 10 g peptone, 10 g potassium nitrate, 17.105 g Na2HPO4·12H2O, 3 g KH2PO4, 1 g NH4Cl, and 0.1 mmol / L MgSO4·7H2O.

[0064] Example 3

[0065] The fermentation of the fusion enzyme Escherichia coli engineering bacteria BL21 (DE3) / dex-P473S-BMdex genetic engineering bacteria that can synthesize dextran specifically includes the following steps:

[0066] The genetically engineered bacteria BL21 (DE3) / dex-P473S-BMdex were inoculated into LB medium containing 40-60 μg / ml kanamycin at a volume fraction of 0.5%, and cultured at 37 °C for 16 hours at a speed of 250 r / min. 2 mL of the culture medium was taken out and added to 200 mL of A medium, and placed in a shaking incubator at 37 °C. When the enriched culture solution was diluted 10 times with distilled water, the OD 600When the pH is 0.20-0.24, 500 μL IPTG can be added to start inducing enzyme production, and the fermentation is induced at 15°C for 3.5-4 hours. The bacterial suspension after induced fermentation is centrifuged at 8000 r / min for 15 min at 4°C. One centrifuge tube corresponds to one bottle of bacterial suspension, and then distilled water is added for shaking and washing, and centrifuged again; 15-20 mL of acetic acid-calcium acetate buffer with a pH value of 5.4 is added to each centrifuge tube and shaken to evenly mix, then an ice water bath is added, ultrasonically broken for 15 min, and centrifuged. The supernatant is the crude enzyme solution of the fusion enzyme dex-P473S-BMdex, and the enzyme activity is 70-100 U / mL. Among them, each liter of the A culture medium contains 5 g glycerol, 5 g glucose, 10 g peptone, 10 g potassium nitrate, 17.105 g Na2HPO4·12H2O, 3 gKH2PO4, 1 g NH4Cl, and 0.1 mmol / L MgSO4·7H2O.

[0067] Example 4

[0068] The application of the fusion enzyme directed synthesis of dextran T1500 of the present invention is as follows:

[0069] The crude enzyme solution of the fusion enzyme dex-P473S-BMdex obtained by the method of Example 3 was used to react with sucrose. The enzyme reaction system was prepared with 10% sucrose, 10 mmol / L calcium acetate buffer (pH=5.4), and 5 U / ml enzyme activity. The reaction was carried out in a water bath at 30°C and 120-150 pm for 24 hours. The reaction solution was taken out and boiled in boiling water for 10 min to stop the reaction. The inactivated enzyme protein was removed by centrifugation. The reaction solution was dialyzed for 48 hours using a 500 kDa dialysis bag to remove small molecule sugars in the reaction solution, and then dried. The dried product was detected by differential liquid chromatography. The detection conditions were: GPC column, differential detector, mobile phase pure water, flow rate 0.6 mL / min, as Figure 5 This is a one-dimensional hydrogen spectrum analysis to characterize dextran. After successful fusion, the product dextran catalyzed by the fusion enzyme is mainly composed of α-(1,6) glycosidic bonds and α-(1,3) glycosidic bonds.

[0070] Comparative Example 1

[0071] The free dextran sucrase P473S and dextran sucrase Bmdex were expressed and prepared by the engineering bacteria induction method. Specifically, the Escherichia coli BL21 (DE3) / P473S genetically engineered bacteria were cultured at 37°C for 16 hours, 4 mL of the bacterial solution was transferred to 200 mL of the induction medium, and placed in a shaking incubator at 37°C for culture. The OD 600At 2-4 o'clock, 500 μL IPTG can be added to start inducing enzyme production, and the fermentation is induced at 25℃ for 3.5-4 hours. The bacterial suspension after induced fermentation is centrifuged at low temperature for 15 minutes. After obtaining the bacteria, 15-20 mL of acetic acid-calcium acetate buffer with a pH value of 5.4 is added and shaken, and the supernatant is free dextran sucrase P473S with an enzyme activity of 120-150 U / mL. The same engineering bacteria induction method can be used to prepare free dextran sucrase Bmdex. Take 10% (w / v) sucrose as the substrate, dissolve it in acetic acid-calcium acetate buffer solution with a pH of 5.4 and 10 mmol / L. After the sucrose is completely dissolved, add the final enzyme activity of 5U / mL dextran sucrase P473S and the final enzyme activity of 5U / mL dextran sucrase BMdex at the same time, and react in a water bath at 30℃ for 24 hours at 160r / min. After the reaction, the mixture was boiled in a boiling water bath for 10 min. After the reaction solution cooled to room temperature, the inactivated enzyme protein was removed by centrifugation. The reaction solution was dialyzed for 48 hours using a 500 kDa dialysis bag to remove small molecule sugars in the reaction solution and then dried. The dried product was detected by differential liquid chromatography under the following conditions: GPC column, differential detector, mobile phase pure water, flow rate 0.6 mL / min, and the HPLC results for molecular weight comparison were obtained as shown in the figure below. Figure 6 .

[0072] from Figure 6 It can be seen that the product distribution of the fusion enzyme is more concentrated and the product is more uniform than that of the free enzyme. The main peak time of the fusion enzyme product is 16.3 min, the weight average molecular weight is about 1500 kDa, and the D value of the fusion enzyme dextran product is 1.13 (Table 1); while the distribution index D of the free enzyme is greater than that of the fusion enzyme, indicating that its product is more dispersed, and the weight average molecular weight is about 2240-7702 kDa, which is much higher than the molecular weight of the fusion enzyme product. The reason is that the "substrate channel" effect of the fusion enzyme, the intermediate high molecular weight dextran is captured by the catalytic active site of the dextran enzyme in time, and the fusion enzyme begins to play a hydrolysis function, breaking the α-1,6 glycosidic bond in the dextran, and finally generating a dextran product with a molecular weight of 1500 kDa. This is the reason why fusion enzyme A produces a relatively uniform dextran product with a molecular weight of about 1500 kDa.

[0073] Table 1 Comparison of products of fusion enzyme and free enzyme

[0074] Enzymes Mw (kDa) D value Fusion enzyme 1500 1.13 Free enzyme 2240—7702 1.21

[0075] It should be noted that the above-mentioned technical contents of the present invention are only for explanation and clarification to enable those skilled in the art to understand the technical essence of the present invention, so the technical contents are not used to limit the substantial protection scope of the present invention. The substantial protection scope of the present invention shall be subject to the claims. Those skilled in the art should know that any modification, equivalent substitution and improvement based on the substantial spirit of the present invention shall be within the substantial protection scope of the present invention.

Claims

1. A method for constructing a fusion enzyme Escherichia coli genetically engineered bacterium capable of directing the synthesis of high molecular weight dextrans, wherein the dextransucrase P473S gene and the dextranase BMdex gene are used as templates, the dextransucrase P473S gene and the dextranase BMdex gene are sequentially homologously recombined and transformed into BL21 (DE3) Escherichia coli to obtain a fusion enzyme Escherichia coli genetically engineered bacterium capable of directing the synthesis of different high molecular weight dextrans.

2. The construction method according to claim 1, characterized in that: The following steps are involved: (1) Seamless connection and molecular simulation of P473S dextran sucrase gene and dextranase BMdex gene, (2) primer design, (3) recombinant plasmid construction and (4) host bacteria transformation.

3. The construction method according to claim 2, characterized in that: The step (1) seamless connection and molecular simulation of the P473S dextransucrase gene and the dextranase BMdex gene is to perform sequence similarity comparison and template search on the P473S dextransucrase gene protein and the dextranase BMdex through Discovery Studio 2019 software, perform structural comparison and superposition on the templates, compare the target sequence with the template sequence, use MODELLER to generate a fusion enzyme model, and then perform feasibility analysis.

4. The construction method according to claim 2, characterized in that: The primer design in step (2) is based on the P473S dextran sucrase gene, the vector pET-28a-(+) and the dextranase BMdex gene sequence, and the mutation primers are designed with the help of SnapGene software as follows: pET-28a-(+)-P473S Template: Upstream primer: 5'--TGGTCGGCATTGCTGACACAGCATTTCCATTATTATCAAA---3' Downstream primer: 5'--GAAAAGCACCCCGCTCGAGCACCACCACCACCACCACTGA--3' BMdex template: Upstream primer: 5'--AAATGCTGTCAGCAATGCCGACCACCGGCCTGCGTCAG--3' Downstream primer: 5'--GGTGGTGGTGGTGGGTGCTCGAGCGGGGTGCTTTTCCA --3'.

5. The construction method according to claim 2, characterized in that: The recombinant plasmid construction in step (3) is based on the P473S dextran sucrase gene and the vector pET-28a-(+) and the dextranase BMdex sequence template, using the designed primers, PCR amplification technology and seamless cloning technology, and DMT digestion of the original template to obtain the recombinant expression plasmid pET-28a-(+)-dex-P473S-BMdex.

6. The construction method according to claim 2, characterized in that: The host bacteria transformation in step (4) is to transform the recombinant expression plasmid pET-28a-(+)-dex-P473S-BMdex into the competent Escherichia coli cell BL21 (DE3), and then verify it through kanamycin resistance screening, enzyme digestion, bacterial liquid PCR and DNA sequencing.

7. The fusion enzyme Escherichia coli BL21 (DE3) / dex-P473S-BMdex genetically engineered bacteria capable of directing the synthesis of high molecular weight dextran obtained by the construction method according to any one of claims 1 to 6, characterized in that: The BL21 (DE3) / dex-P473S-BMdex genetically engineered bacteria was deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration on December 13, 2024, with the deposit number CGMCC No. 33058 and the classification name Escherichia coli.

8. Use of the fusion enzyme Escherichia coli BL21 (DE3) / dex-P473S-BMdex genetically engineered bacteria capable of directing the synthesis of high molecular weight dextran as claimed in claim 7 in catalyzing the conversion of sucrose into high molecular weight dextran, characterized in that: The weight average molecular weight of the high molecular weight dextran is 1400-1600 kDa.

9. The use according to claim 8, characterized in that First, the Escherichia coli BL21 (DE3) / dex-P473S-BMdex genetically engineered bacteria were fermented to express the fusion enzyme, and then sucrose was used as a substrate to obtain high molecular weight dextran through catalysis of the fusion enzyme.

10. The use according to claim 9, characterized in that The method comprises the steps of fermenting Escherichia coli BL21 (DE3) / dex-P473S-BMdex genetically engineered bacteria to express a fusion enzyme, and inoculating the Escherichia coli BL21 (DE3) / dex-P473S-BMdex genetically engineered bacteria at a volume fraction of 0.5% into an LB culture medium containing 40 to 60 μg / ml kanamycin, rotating at 250 r / min, and culturing at 37°C for 16 hours; taking 4 mL of the culture solution and adding it to 200 mL of A culture medium, placing it in a shaking table for culturing at 37°C, and when the enriched cultured bacterial solution is diluted 10 times with distilled water, the OD 600 When the concentration of the acetic acid is 0.20 to 0.24, 500 μL IPTG can be added to start inducing enzyme production, and the fermentation is induced at 15°C for 3.5 to 4 hours. The bacterial suspension after induced fermentation is centrifuged at 8000 r / min for 15 min at 4°C. One centrifuge tube corresponds to one bottle of bacterial suspension, and then distilled water is added for oscillation and washing, and centrifugation is performed again; 15 to 20 mL of acetic acid-calcium acetate buffer with a pH value of 5.4 is added to each centrifuge tube, shaken and evenly mixed, an ice water bath is added, ultrasonically broken for 15 min, and centrifuged to separate. The supernatant is the fusion enzyme that can synthesize high molecular weight dextran in a directional manner, and the enzyme activity is 70 to 100 U / mL; each liter of the A culture medium contains 5 g glycerol, 5 g glucose, 10 g peptone, 10 g potassium nitrate, 17.105 g Na2HPO4·12H2O, 3 g KH2PO4, 1 g NH4Cl, and 0.1 mmol / LMgSO4·7H2O.

Images