Engineering migration body and application thereof

Abstract

The invention discloses an engineering migration body and application thereof, and belongs to the field of biomedicine. According to the invention, a Tspan4 gene is highly expressed in an immortalized cell line (such as a human bronchial epithelial cell line BEAS-2B), so that the immortalized cell line obtains the ability of secreting a migration body, and then an ILK gene is highly expressed, so that an exogenous ILK protein synthesized in a cell is packaged into the migration body. The migration body has the same function of promoting wound healing as a migration body derived from stromal cells, and compared with a primary stromal cell line, the immortalized cell line has the advantages of fast proliferation, low culture cost, stable cell state and the like. Compared with the unknown property and safety of promoting wound healing through epidermal growth factors in the prior art, the method provided by the invention has the advantages of high innovativeness, wide application prospect and high market value. The method has irreplaceable advantages in the aspect of wound healing.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and in particular relates to an engineered migrator and application thereof. Background Art

[0002] The migratory bodies produced by primary stromal cells have the effect of promoting wound healing. Compared with traditional wound healing drugs whose main ingredient is growth factor (EGF), they have higher safety and more significant therapeutic effects. However, the number of primary stromal cells is limited, the cell state is relatively unstable, the culture cost is high, it is difficult to culture on a large scale, and there are certain ethical and patient immune rejection issues. Summary of the invention

[0003] To address the above issues, we conducted in-depth research on the mechanism of stromal cell-derived migratoria in promoting wound healing. We overexpressed the Tspan4 gene in immortalized cell lines (such as the human bronchial epithelial cell line BEAS-2B) to enable them to secrete migratoria. We then overexpressed the ILK gene so that the exogenous ILK protein synthesized in the cells was packaged into the migratoria. These migratoria have the same wound healing function as stromal cell-derived migratoria.

[0004] The present invention provides a method for preparing an engineered migratoria, which comprises the following steps: co-transfecting an immortalized cell line with lentiviruses containing target genes Tspan4 and ILK, respectively, so that the immortalized cell line after transfection can secrete migratoria containing ILK protein, and collecting the secreted migratoria.

[0005] Preferably, when constructing the lentivirus containing the target gene Tspan4, a lentiviral expression vector pLVX-Tspan4-eGFP-puro is used.

[0006] More preferably, when constructing the lentivirus containing the target gene ILK, the lentivirus expression vector pLVX-ILK-mCherry-puro is used.

[0007] More preferably, when preparing the lentivirus containing the target genes Tspan4 and ILK respectively, a second-generation lentivirus packaging three-plasmid system is used.

[0008] More preferably, the second-generation lentiviral packaging three-plasmid system includes plasmids psPAX2 and pMD2.G.

[0009] More preferably, the immortalized cell line is the human bronchial epithelial cell line BEAS-2B.

[0010] The present invention also provides a migration body prepared by the above preparation method.

[0011] The present invention also provides the use of the above-mentioned migrator in preparing a product for promoting wound healing.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] The present invention transforms the immortalized cell line so that the migrasomes produced by it have the same wound healing promoting function as the migrasomes derived from stromal cells. The difficulties of limited generation of primary stromal cells, unstable cell state, high culture cost, and difficulty in large-scale culture are overcome, and the patient's immune rejection reaction is alleviated to a certain extent, avoiding ethical issues. Compared with the unknown and safety of promoting wound healing through epidermal growth factor, the present invention has high innovation, broad application prospects, and strong market value. In terms of wound healing, it has its irreplaceable advantages. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is a tool cell that is successfully constructed by viral transfection of immortalized cell lines in Example 1 and is capable of producing migrasomes containing ILK protein.

[0015] Figure 2a BEAS-2B in Example 3 Tspan4-eGFP / ILK-mCherry Typical pictures of the migratoria from the source promoting the healing of Kunming mouse skin wounds. The left picture is the matrix gel experimental group containing migratoria, and the photos show the wound status (day 0) and the healing status (day 7). The right picture is the serum-free DMEM medium mixed with matrix gel (Matrigel) control group, and the black disc is a reference with a diameter of 2.5 mm.

[0016] Figure 2b BEAS-2B in Example 3 Tspan4-eGFP / ILK-mCherry Statistical results of the migrasomes derived from BEAS-2B cells promoting wound healing in Kunming mice skin, *p<0.05. The experimental results showed that the migrasomes after BEAS-2B cells highly expressed ILK had the effect of promoting wound healing.

[0017] Figure 3a BEAS-2B in Example 4 Tspan4-eGFP / ILK-mCherry Migration-promoting epithelial cells (HaCaT mCherry ) adhesion fluorescence images, the left image shows only epithelial cells (HaCaT mCherry) The right picture shows the control group before and after perfusion with a syringe pump. The right picture shows the epithelial cell mixed migration body and the experimental group before and after perfusion with a syringe pump.

[0018] Figure 3b BEAS-2B in Example 4 Tspan4-eGFP / ILK-mCherryThe statistical results of the migratoria derived from BEAS-2B cells promoting endothelial cell adhesion, ***p<0.001. The experimental results show that the migratoria derived from BEAS-2B cells with high expression of ILK have the effect of enhancing epithelial cell adhesion.

[0019] Figure 4a BEAS-2B in Example 4 Tspan4-eGFP / ILK-mCherry Migration-promoting endothelial cells (HUVEC CFP ) adhesion fluorescence images, the left image shows only endothelial cells (HUVEC CFP ), and the control group before and after perfusion with a syringe pump. The right picture shows the epithelial cell mixed migration body, and the experimental group before and after perfusion with a syringe pump.

[0020] Figure 4b BEAS-2B in Example 4 Tspan4-eGFP / ILK-mCherry The statistical results of the migratoria derived from BEAS-2B cells promoted endothelial cell adhesion, ***p<0.001. The experimental results showed that the migratoria derived from BEAS-2B cells with high expression of ILK had the effect of enhancing endothelial cell adhesion.

[0021] Figure 5 This is the comparative experimental result of Example 5. DETAILED DESCRIPTION

[0022] Example 1 Construction of tool cells

[0023] 1. Thawing HEK-293FT cells:

[0024] 1.1 Add about 3 mL of fresh 10% FBSDMEM culture medium to a 6 cm cell culture dish and place it in a 37°C incubator to rewarm.

[0025] 1.2 Take out the HEK-293FT cells frozen at -80℃ with a density of one 6cm culture dish, put them in clean PE gloves, place them in a 37℃ water bath, and shake them quickly until the cells in the cryopreservation tube are completely thawed.

[0026] 1.3 Take the cryotube out of the PE gloves and gently wipe the outer wall of the cryotube with clean absorbent paper moistened with 75% ethanol.

[0027] 1.4 Gently aspirate the cryopreservation solution and cells in the cryopreservation tube with a pipette, add them to a 15 mL centrifuge tube containing 3 mL of 10% FBSDMEM culture medium and centrifuge at 1000 rpm for 3 min.

[0028] 1.5 After centrifugation, discard the supernatant, add 1 mL of fresh 10% FBSDMEM medium to resuspend the cell pellet, and then add it to a 6 cm cell culture dish that has been placed in a 37°C incubator and rewarmed with fresh 10% FBSDMEM medium. Gently shake the cell culture dish using the cross-shaking method to spread the cells as evenly as possible, and then place it steadily in a 37°C incubator.

[0029] 2. Passaging of HEK-293FT Cells

[0030] 2.1 Observe the cell status under a microscope. When the cell density reaches about 80%, cell subculture can be performed.

[0031] 2.2 Slightly tilt the cell culture dish and use negative pressure to gently remove the culture medium. Add 1 mL of sterile PBS buffer, gently shake the culture dish, slightly tilt the cell culture dish, and use negative pressure to gently remove the buffer and cell debris.

[0032] 2.3 Gently add 1 mL of 0.25% pancreatin along the side wall of the culture dish (6 cm), gently shake the cell culture dish for 2-4 seconds to allow the pancreatin to evenly cover the entire bottom of the culture dish, and then use negative pressure to absorb the pancreatin.

[0033] 2.4 Place the culture dish in a 37℃ incubator for about 10 seconds to allow digestion.

[0034] 2.5 Add 1 mL of 10% FBSDMEM culture medium to the culture dish and gently blow off the cells. Collect the cell suspension into a 1.5 mL centrifuge tube and centrifuge at 1000 rpm for 3 min.

[0035] 2.6 After centrifugation, discard the supernatant and add 1 mL of fresh 10% FBSDMEM medium to resuspend the cell pellet. Add 500 μL of cell suspension to each of two 6 cm culture dishes that have been added with 3.5 mL of 10% FBSDMEM medium. Gently shake the cell culture dish using the cross-shaking method to spread the cells as evenly as possible, and then place it steadily in a 37°C incubator.

[0036] 3. Construction of plasmid vectors (pLVX-Tspan4-eGFP-puro, pLVX-ILK-mCherry-puro)

[0037] 3.1 Obtaining target genes

[0038] 3.1.1 The target fragment Tspan4 (NC_000011.10) was designed by CE Design V1.04 software.

[0039] The upstream and downstream primers of (842852..867111)) and ILK (NC_000011.10 (6603774..6610870)) were sent to Sangon Biotech Co., Ltd. for synthesis to obtain the fragment primers. Genomic DNA was extracted from primary fibroblasts (HFL) and used as a template for the target fragment Tspan4 gene to amplify the target fragment. pEGFP-ILK-C1 (plasmid donated by Professor Yang Qingkai of Dalian Medical University) was used as a template for the target fragment ILK gene to amplify the target fragment.

[0040] Tspan4 upstream primer (SEQ ID NO.1):

[0041] CTCGAGCTCAAGCTTCGCCACCATGGCGCCTGCCTC;

[0042] Downstream primer (SEQ ID NO.2):

[0043] CCTCGCCCTTGCTCACCATCGCGCAGTAGTGTCTGCCTT.

[0044] ILK upstream primer (SEQ ID NO.3):

[0045] TCAGATCTCGAGCTCAAGCTTATGGACGACATTTTCACTCAGTGC;

[0046] Downstream primer (SEQ ID NO.4):

[0047] CCTTGAGAAGATGCAGGACAAGTGAATTCTGCAGTCGACGGTAC.

[0048] 3.2 Construction of pLVX-Tspan4-eGFP-puro plasmid

[0049] 3.2.1 Enzyme digestion vector pLVX-eGFP-puro (Company: Addgene, Catalog No.: 128652)

[0050] 3.2.2 The enzyme digestion products were recovered from gel.

[0051] 3.2.3 The vector pLVX-eGFP-puro and the target fragment (Tspan4) were placed in a PCR instrument for ligation according to the instructions, and the ligation sites were HindIII and AgeI.

[0052] 3.2.4 After amplifying the ligation product, pick the single clone colony and send it to Sangon for sequencing analysis.

[0053] 3.2.5 After sequencing is correct, use the endotoxin-free plasmid mini-extraction kit to extract the plasmid from the product to obtain the target plasmid.

[0054] 3.3 Construction of pLVX-ILK-mCherry-puro plasmid

[0055] 3.3.1 Enzyme digestion vector pLVX-mCherry-puro (Company: Addgene, Catalog No.: 180646)

[0056] 3.3.2 The enzyme cleavage products were recovered from gel.

[0057] 3.3.3 The vector pLVX-mCherry-puro and the target fragment (ILK) were placed in a PCR instrument for ligation according to the instructions, and the ligation sites were HindIII and EcoRI.

[0058] 3.3.4 After amplifying the ligation product, pick out the single clone colony and send it to Sangon for sequencing analysis.

[0059] 3.3.5 After sequencing is correct, use the endotoxin-free plasmid mini-extraction kit to extract the plasmid from the shaken product to obtain the target plasmid.

[0060] 4. Virus packaging:

[0061] This experiment uses a second-generation lentiviral packaging three-plasmid system, which are psPAX2, pMD2.G and the target plasmid (pLVX-Tspan4-eGFP-puro, pLVX-ILK-mCherry-puro). The total amount of plasmids required for a 6cm cell culture dish is 5μg, and the concentration ratio of the target plasmid, psPAX2, and pMD2.G is 4:3:1. Therefore, the target plasmid is 2.5μg, the plasmid psPAX2 is 1.875μg, and the plasmid pMD2.G is 0.625μg.

[0062] 4.1 Virus packaging (pLVX-Tspan4-eGFP-puro)

[0063] 4.1.1 Observe under a microscope and wait until the density of HEK-293FT cells reaches about 80% before preparing for virus packaging.

[0064] 4.1.2 Take a clean and sterilized 1.5 mL centrifuge tube and add 200 μL of Buffer (Company: Poly.plus Catalog No.: 201000003) was added with corresponding volumes of psPAX2, pMD2.G and pLVX-Tspan4-eGFP-puro at corresponding concentrations.

[0065] 4.1.3 Vortex for 10 seconds and centrifuge for 10 seconds.

[0066] 4.1.4 Add twice the volume of the total amount of plasmid Reagent (here 10 μL).

[0067] 4.1.5 Vortex for 10 seconds and centrifuge for 10 seconds.

[0068] 4.1.6 Let stand at room temperature for 10 minutes.

[0069] 4.1.7 After standing for 10 minutes, aspirate the liquid and gently drop it into the HEK-293FT cell culture dish. Gently shake the dish and place it in a 37°C incubator. Replace the culture medium after 12 hours.

[0070] 4.1.8 After 12 hours, discard the old culture medium, add 6 mL (6 cm cell culture dish) of 10% FBSDMEM culture medium, and place in a 37°C incubator.

[0071] 4.1.972 hours later, observe whether the HEK-293FT cells have successfully expressed green fluorescent protein using an inverted fluorescence microscope.

[0072] 4.1.10 After HEK-293FT cells are successfully stimulated to emit green fluorescence, use a 10mL syringe to aspirate the culture medium, then pass it through a 0.22μm filter, collect the filtered virus solution into a 15mL centrifuge tube, add the corresponding volume of 5x PEG solution, tighten the centrifuge tube cap, seal it with sealing film, and place it in a shaker in a 4℃ cold room and shake slowly overnight to concentrate the virus solution.

[0073] 4.1.11 Place on a shaker and shake slowly overnight, then centrifuge at 6000 rcf for 40 min.

[0074] 4.1.12 After centrifugation, discard the supernatant and add 1 mL of serum-free DMEM medium to resuspend the precipitate. Transfer to a 1.5 mL centrifuge tube and store in a -80°C refrigerator.

[0075] 4.2 Virus packaging (pLVX-ILK-mCherry-puro)

[0076] 4.2.1 Observe under a microscope and wait until the density of HEK-293FT cells reaches about 80% before preparing for virus packaging.

[0077] 4.2.2 Take a clean and sterilized 1.5 mL centrifuge tube and add 200 μL of Buffer (Company: Poly.plus Catalog No.: 201000003) was added with corresponding volumes of psPAX2, pMD2.G and pLVX-ILK-mCherry-puro at corresponding concentrations.

[0078] 4.2.3 Vortex for 10 seconds and centrifuge for 10 seconds.

[0079] 4.2.4 Add twice the volume of the total amount of plasmid Reagent (here 10 μL)

[0080] 4.2.5 Vortex for 10 seconds and centrifuge for 10 seconds.

[0081] 4.2.6 Let stand at room temperature for 10 minutes.

[0082] 4.2.7 After standing for 10 minutes, aspirate the liquid and gently drop it into the HEK-293FT cell culture dish. Gently shake the dish and place it in a 37°C incubator. Replace the culture medium after 12 hours.

[0083] 4.2.8 After 12 h, discard the old culture medium, add 6 mL (6 cm cell culture dish) of 10% FBSDMEM culture medium, and place in a 37°C incubator.

[0084] 4.2.972 hours later, observe whether the HEK-293FT cells have successfully expressed red fluorescent protein using an inverted fluorescence microscope.

[0085] 4.2.10 After the HEK-293FT cells are successfully stimulated to emit red fluorescence, the culture medium is aspirated with a 10 mL syringe, and then filtered through a 0.22 μm filter to collect the filtered virus solution into a 15 mL centrifuge tube, and the corresponding volume of 5x PEG solution is added. The centrifuge tube cap is tightened, sealed with sealing film, and placed in a shaker in a 4°C cold room for slow shaking overnight to concentrate the virus solution.

[0086] 4.2.11 Place on a shaker and shake slowly overnight, then centrifuge at 6000 rcf for 40 min.

[0087] 4.2.12 After centrifugation, discard the supernatant and add 1 mL of serum-free DMEM medium to resuspend the precipitate. Transfer to a 1.5 mL centrifuge tube and store in a -80°C refrigerator.

[0088] 5. Resuscitation of BEAS-2B cells

[0089] 5.1 Add about 3 mL of fresh 10% FBSDMEM culture medium to a 6 cm cell culture dish and place it in a 37°C incubator to rewarm.

[0090] 5.2 Take out the BEAS-2B cells frozen at -80℃ with a density of one 6cm culture dish, put them in clean PE gloves, place them in a 37℃ water bath, and shake them quickly until the cells in the cryopreservation tube are completely thawed.

[0091] 5.3 Take the cryotube out of the PE gloves and gently wipe the outer wall of the cryotube with clean absorbent paper moistened with 75% ethanol.

[0092] 5.4 Gently aspirate the cryopreservation solution and cells in the cryopreservation tube with a pipette, add them to a 15 mL centrifuge tube containing 3 mL of 10% FBSDMEM culture medium and centrifuge at 1000 rpm for 3 min.

[0093] 5.5 After centrifugation, discard the supernatant, add 1 mL of fresh 10% FBSDMEM medium to resuspend the cell pellet, and then add it to a 6 cm cell culture dish that has been placed in a 37°C incubator and rewarmed with fresh 10% FBSDMEM medium. Gently shake the cell culture dish using the cross-shaking method to spread the cells as evenly as possible, and then place it steadily in a 37°C incubator.

[0094] 6. Virus infection of BEAS-2B cells

[0095] 6.1 Observe the cell status under a microscope. When the cell density reaches about 80%, the cells can be plated.

[0096] 6.2 Slightly tilt the cell culture dish and use negative pressure to gently remove the culture medium. Add 1 mL of sterile PBS buffer, gently shake the culture dish, slightly tilt the cell culture dish, and use negative pressure to gently remove the buffer and cell debris.

[0097] 6.3 Gently add 1 mL of 0.25% pancreatin along the side wall of the culture dish (6 cm), gently shake the cell culture dish for 2-4 seconds to allow the pancreatin to evenly cover the entire bottom of the culture dish, and then use negative pressure to absorb the pancreatin.

[0098] 6.4 Place the culture dish in a 37℃ incubator for digestion for about 30 seconds until the cells become round.

[0099] 6.5 Add 1 mL of 10% FBSDMEM culture medium to the culture dish and gently blow off the cells. Collect the cell suspension into a 1.5 mL centrifuge tube and count the cells.

[0100] 6.6 Add about 2.0x10^5 BEAS-2B cells to one well of a six-well plate and fill up the well with culture medium to 1 mL.

[0101] 6.7 Take out the concentrated virus solution (pLVX-Tspan4-eGFP-puro) from the -80℃ refrigerator, thaw it at room temperature, add it to the cell suspension in 6.6, and then add 4μL of 10mg / mL polybrene.

[0102] 6.8 After 17-18 hours, observe the cell status and use an inverted fluorescence microscope to observe whether the BEAS-2B cells have successfully expressed Tspan4-eGFP green fluorescent protein. After the cells successfully excite green fluorescence, replace with fresh culture medium.

[0103] 6.9 When the cell density reaches 80% (one well of a 6-well plate), digest and resuspend the cells in 1 mL of 10% FBSDMEM medium. Centrifuge at 1000 rpm for 3 min, discard the supernatant, resuspend the cell pellet in 1 mL of fresh 10% FBSDMEM medium and inoculate into a well of a 6-well plate, and make up to 2 mL with 10% FBSDMEM medium.

[0104] 6.10 When the cell density reaches 80%, digest and resuspend the cells in 1 mL of 10% FBSDMEM medium. Centrifuge at 1000 rpm for 3 min, discard the supernatant, resuspend the cell pellet in 1 mL of fresh 10% FBSDMEM medium, inoculate into a 6 cm culture dish, and add 10% FBSDMEM medium to 4 mL.

[0105] 6.11 When the cell density reaches 80%, add 4 μL of 10 mg / mL puro reagent and screen stable strains for 7 days. During this period, the culture medium should be replaced. The corresponding volume of puro reagent should be added each time the medium is changed.

[0106] 6. After 127 days, the cells became puro-resistant and BEAS-2B was finally obtained. Tspan4-eGFP When BEAS-2B Tspan4-eGFP When the cell density reaches about 80%, cells can be plated.

[0107] 6.13 Slightly tilt the cell culture dish and use negative pressure to gently remove the culture medium. Add 1 mL of sterile PBS buffer, gently shake the culture dish, slightly tilt the cell culture dish, and use negative pressure to gently remove the buffer and cell debris.

[0108] 6.14 Gently add 1 mL of 0.25% pancreatin along the side wall of the culture dish (6 cm), gently shake the cell culture dish for 2-4 seconds to allow the pancreatin to evenly cover the entire bottom of the culture dish, and then use negative pressure to absorb the pancreatin.

[0109] 6.15 Place the culture dish in a 37°C incubator for digestion for about 30 seconds until the cells become round.

[0110] 6.16 Add 1 mL of 10% FBSDMEM medium to the culture dish and gently blow off the cells. Tspan4 -eGFP The cell suspension was collected into a 1.5 mL centrifuge tube and the cells were counted.

[0111] 6.17 Add about 2.0x10^5 BEAS-2B to one well of a six-well plate. Tspan4-eGFP Cells were supplemented with culture medium to 1 mL.

[0112] 6.18 Take out the concentrated virus solution (pLVX-ILK-mCherry-puro) from the -80°C refrigerator, thaw it at room temperature, add it to the cell suspension in 6.17, and then add 4 μL of 10 mg / mL polybrene.

[0113] 6. Observe the cell status after 1917-18h and observe BEAS-2B by inverted fluorescence microscope Tspan4-eGFP Check whether the cells have successfully expressed ILK-mCherry red fluorescent protein. After the cells are successfully excited to emit red fluorescence, replace the culture medium with fresh one.

[0114] 6.20 When the cell density reaches 80% (one well of a 6-well plate), digest and resuspend the cells in 1 mL of 10% FBSDMEM medium. Centrifuge at 1000 rpm for 3 min, discard the supernatant, resuspend the cell pellet in 1 mL of fresh 10% FBSDMEM medium and inoculate into a well of a 6-well plate, and make up to 2 mL with 10% FBSDMEM medium.

[0115] 6.21 When the cell density reaches 80%, digest and resuspend the cells in 1 mL of 10% FBSDMEM medium. Centrifuge at 1000 rpm for 3 min, discard the supernatant, resuspend the cell pellet in 1 mL of fresh 10% FBSDMEM medium, inoculate into a 6 cm culture dish, and add 10% FBSDMEM medium to 4 mL.

[0116] 6.22 When the cell density reaches 80%, add 4 μL of 10 mg / mL puro reagent and screen the stable strains for 7 days. During this period, the culture medium should be changed. Each time the culture medium is changed, the corresponding volume of puro reagent should be added. The cells screened are puro-resistant and express Tspan4-eGFP green fluorescent protein and ILK-mCherry red fluorescent protein (see Figure 1 ). Tool cell BEAS-2B Tspan4-eGFP / ILK-mCherry Build successfully.

[0117] Example 2 Extraction of Migratory Bodies

[0118] 1.BEAS-2BTspan4-eGFP / ILK-mCherry planking

[0119] Experimental materials: Fn (fibronectin) coating solution, 50mL centrifuge tube, 9 15cm cell culture dishes, 0.25% trypsin, 10% FBSDMEM culture medium

[0120] Experimental steps:

[0121] 1.1 Add 12 mL of Fn (0.1 μg / mL) coating solution to a 15 cm cell culture dish. Perform this operation on 9 15 cm dishes and then place them in a 37°C incubator for 1 hour.

[0122] 1. After 21 hours, the Fn coating solution in the 15 cm culture dish was sucked away by negative pressure, and 12 mL of 10% FBSDMEM culture medium was added to each 15 cm culture dish.

[0123] 1.3 Grow 4 BEAS-2B Tspan4-eGFP / ILK-mCherry For each 10 cm culture dish of cells, add 2 mL of 0.25% trypsin for digestion, aspirate the trypsin and put it in a 37 ° C incubator for digestion for 1 min, then add 3 mL of 10% FBSDMEM culture medium to resuspend, collect all the cell suspensions in a 15 mL centrifuge tube, and then add about 1.85x10^6 cells to each 15 cm cell culture dish that has been added with 12 mL of 10% FBS DMEM culture medium, and put it in the incubator for 15-16 hours.

[0124] 2. Extraction of Migration Bodies by Gradient Centrifugation

[0125] Experimental steps:

[0126] 2.1 After 15-16 hours, recover the culture medium in the 15 cm cell culture dish into three 50 mL centrifuge tubes.

[0127] 2.2 Add 2 mL of 0.25% trypsin to each 15 cm cell culture dish for digestion (do not absorb the trypsin), place in the incubator for digestion for 2 min, then add 3 mL of 10% FBSDMEM culture medium to resuspend, and transfer the cell suspension in 9 15 cm cell culture dishes to 2 50 mL centrifuge tubes as evenly as possible.

[0128] 2.3 Centrifugation: 1000rcf, 10min, then 4000rcf, 20min. After the end, pour the supernatant in the two 50mL centrifuge tubes into two 50mL round-bottom centrifuge tubes respectively, change to a round-bottom rotor and centrifuge at 20000rcf, 30min, then discard the supernatant, resuspend the precipitate in the two 50mL round-bottom centrifuge tubes with 1mL of PBS buffer, transfer to a 1.5mL centrifuge tube, centrifuge at 20000rcf, 30min, then discard the supernatant and retain the precipitate, which is rich in migration bodies and is placed on ice for use.

[0129] Example 3 Mouse skin wound healing experiment:

[0130] In this experiment, female Kunming mice aged 6-8 weeks were obtained from Changsheng Biotechnology Co., Ltd.

[0131] Experimental steps:

[0132] 1. The precipitate rich in migratory bodies in Example 2 was resuspended in 20 μL of serum-free DMEM and mixed with 20 μL of Matrigel. This is the matrix gel mixed with BEAS-2B. Tspan4-eGFP / ILK-mCherry Reagents used in the cell-derived migratory body group. The blank matrix gel control group was mixed with 20 μL of serum-free DMEM and 20 μL of Matrigel. (This experiment was divided into three batches, and each batch of experiments used 3 female Kunming mice. Each mouse had 2 experimental group wounds and 2 control group wounds. Each wound was dripped with 6 μL of liquid. Therefore, each batch of experimental control group and experimental group required 36 μL of liquid. To avoid loss, 40 μL was prepared.)

[0133] 2. First, anesthetize the mouse.

[0134] 3. Then use a shaver to shave the hair, apply depilatory cream on the mouse's back skin, and gently circle it with a cotton swab. After three minutes, use a cotton swab dipped in clean water to wipe off the depilatory cream and loose hair to expose the mouse's back skin.

[0135] 4. Use alcohol cotton balls to wipe the back skin of the mouse for disinfection.

[0136] 5. Then use a 2.5 mm punch pen to make a penetrating wound on the back skin of the mouse and take a picture.

[0137] 6. Mix Matrigel with BEAS-2B Tspan4-eGFP / ILK-mCherry The mixed liquid of the cell-derived migratoria group and the blank matrix gel control group was dropped into the corresponding wounds with a pipette.

[0138] 7. Collect tissue samples after 7 days and observe the mice several times to see if they are in good condition.

[0139] The experimental results are as follows Figure 2a , 2b As shown, Figure 2a, 2b It shows that the migratory bodies of BEAS-2B cells with high expression of ILK have the effect of promoting wound healing.

[0140] Example 4 Enhanced cell adhesion experiment

[0141] 1. Enhancement of epithelial cells HaCaT mCherry Adhesion test:

[0142] Experimental steps:

[0143] 1.1 Building HaCaT mCherry Stable strain

[0144] 1.1.1. Virus packaging:

[0145] This experiment uses a second-generation lentiviral packaging three-plasmid system, which are psPAX2, pMD2.G and the target plasmid pLVX-mCherry-puro (to make the host cells fluorescent). The total amount of plasmids required for a 6cm cell culture dish is 5μg, and the concentration ratio of the target plasmid, psPAX2, and pMD2.G is 4:3:1. Therefore, the target plasmid is 2.5μg, the plasmid psPAX2 is 1.875μg, and the plasmid pMD2.G is 0.625μg.

[0146] 1.1.2 Observe under a microscope and wait until the density of HEK-293FT cells reaches about 80% before preparing for virus packaging.

[0147] 1.1.3 Take a clean and sterilized 1.5 mL centrifuge tube and add 200 μL of Buffer (Company: Poly.plus Catalog No.: 201000003) was added with corresponding volumes of psPAX2, pMD2.G and pLVX-mCherry-puro at corresponding concentrations.

[0148] 1.1.4 Vortex for 10 seconds and centrifuge for 10 seconds.

[0149] 1.1.5 Add twice the volume of the total amount of plasmid Reagent (here 10 μL)

[0150] 1.1.6 Vortex for 10 seconds and centrifuge for 10 seconds.

[0151] 1.1.7 Let stand at room temperature for 10 minutes.

[0152] 1.1.8 After standing for 10 minutes, aspirate the liquid and gently drop it into the HEK-293FT cell culture dish. Gently shake the culture dish and place it in a 37℃ incubator. Replace the culture medium after 12 hours.

[0153] 1.1.9 After 12 hours, discard the old culture medium, add 6 mL (6 cm cell culture dish) of 10% FBSDMEM culture medium, and place in a 37°C incubator.

[0154] 1.1.1072 hours later, observe whether the HEK-293FT cells are successfully excited to emit red fluorescence using an inverted fluorescence microscope.

[0155] 1.1.11 After HEK-293FT cells are successfully stimulated to emit red fluorescence, use a 10mL syringe to aspirate the culture medium, then pass it through a 0.22μm filter, collect the filtered virus solution into a 15mL centrifuge tube, add the corresponding volume of 5x PEG solution, tighten the centrifuge tube cap, seal it with sealing film, and place it in a shaker in a 4℃ cold room and shake slowly overnight to concentrate the virus solution.

[0156] 1.1.12 Place on a shaker and shake slowly overnight, then centrifuge at 6000 rcf for 40 min.

[0157] 1.1.13 After centrifugation, discard the supernatant and add 1 mL of serum-free DMEM medium to resuspend the precipitate. Transfer to a 1.5 mL centrifuge tube and store in a -80°C refrigerator.

[0158] 1.2 Recovery of HaCaT cells (purchased from ATCC official website)

[0159] 1.2.1 Add about 3 mL of fresh 10% FBSDMEM culture medium to a 6 cm cell culture dish and place it in a 37°C incubator to rewarm.

[0160] 1.2.2 Take out the HaCaT cells frozen at -80℃ with a density of one 6cm culture dish, put them in clean PE gloves, place them in a 37℃ water bath, and shake them quickly until the cells in the cryopreserved tube are completely thawed.

[0161] 1.2.3 Take the cryotube out of the PE gloves and gently wipe the outer wall of the cryotube with clean absorbent paper moistened with 75% ethanol.

[0162] 1.2.4 Gently aspirate the cryopreservation solution and cells in the cryopreservation tube with a pipette, add them to a 15 mL centrifuge tube containing 3 mL of 10% FBSDMEM culture medium and centrifuge at 1000 rpm for 3 min.

[0163] 1.2.5 After centrifugation, discard the supernatant, add 1 mL of fresh 10% FBSDMEM medium to resuspend the cell pellet, and then add it to a 6 cm cell culture dish that has been placed in a 37°C incubator and rewarmed with about 3 mL of fresh 10% FBSDMEM medium. Gently shake the cell culture dish using the cross-shaking method to spread the cells as evenly as possible, and then place it steadily in a 37°C incubator.

[0164] 1.3 Virus infection of HaCaT cells

[0165] 1.3.1 Observe the cell status under a microscope. When the cell density reaches about 80%, the cells can be plated.

[0166] 1.3.2 Slightly tilt the cell culture dish and use negative pressure to gently remove the culture medium. Add 1 mL of sterile PBS buffer, gently shake the culture dish, slightly tilt the cell culture dish, and use negative pressure to gently remove the buffer and cell debris.

[0167] 1.3.3 Gently add 1 mL of 0.25% pancreatin along the side wall of the culture dish (6 cm), gently shake the cell culture dish for 2-4 seconds to allow the pancreatin to evenly cover the entire bottom of the culture dish, and then use negative pressure to absorb the pancreatin.

[0168] 1.3.4 Place the culture dish in a 37℃ incubator for about 10 minutes for digestion until the cells become round.

[0169] 1.3.5 Add 1 mL of 10% FBSDMEM culture medium to the culture dish and gently blow off the cells. Collect the cell suspension into a 1.5 mL centrifuge tube and count the cells.

[0170] 1.3.6 Add about 2.0x10^5 HaCaT cells to one well of a six-well plate. Fill the well with culture medium to 1 mL.

[0171] 1.3.7 Take out the concentrated virus solution (pLVX-mCherry-puro) from the -80℃ refrigerator and melt it at room temperature, then add it to the cell suspension in 1.3.6, and then add 4μL of 10mg / mL polybrene.

[0172] 1.3.8 After 24 hours, observe the cell status and use an inverted fluorescence microscope to observe whether the HaCaT cells are successfully stimulated to emit red fluorescence. After the cells are successfully stimulated to emit red fluorescence, replace with fresh culture medium.

[0173] 1.3.9 When the cell density reaches 80% (one well of a 6-well plate), digest and resuspend the cells in 1 mL of 10% FBSDMEM medium. Centrifuge at 1000 rpm for 3 min, discard the supernatant, resuspend the cell pellet in 1 mL of fresh 10% FBSDMEM medium, and inoculate it into a 6 cm cell culture dish, and add 10% FBSDMEM medium to 4 mL.

[0174] 1.3.10 When the cell density reaches 80%, add 4 μL of 10 mg / mL puro reagent and screen the stable strain for 7 days. During this period, the culture medium should be changed. Each time the medium is changed, the corresponding volume of puro reagent should be added. Until the cells have puro resistance, HaCaT is finally obtained. mCherry cell.

[0175] 1.4 The migratory bodies were extracted using the method in Example 2, and the precipitate rich in migratory bodies was resuspended in 30 μL of 10% FBS DMEM and placed on ice for later use.

[0176] 1.5 Observation of HaCaT under microscope mCherry Cell status: When the cell density reaches about 80%, the experiment can be carried out.

[0177] 1.6 Slightly tilt the cell culture dish (6 cm), use negative pressure to gently remove the culture medium, add 1 mL of sterile PBS buffer, gently shake the culture dish, slightly tilt the cell culture dish, and use negative pressure to gently remove the buffer and the cell debris.

[0178] 1.7 Gently add 1 mL of 0.25% pancreatin along the side wall of the culture dish (6 cm), gently shake the cell culture dish for 2-4 seconds to allow the pancreatin to evenly cover the entire bottom of the culture dish, and then use negative pressure to absorb the pancreatin.

[0179] 1.8 Place the culture dish in a 37°C incubator for 10 minutes for digestion.

[0180] 1.9 Add 1 mL of 10% FBSDMEM culture medium to the culture dish and gently blow off the cells. Collect the cell suspension into a 1.5 mL centrifuge tube and centrifuge at 1000 rpm for 3 min.

[0181] 1.10 After centrifugation, discard the supernatant, add 1 mL of sterile PBS buffer to resuspend the cell pellet, and centrifuge at 1000 rpm for 3 min.

[0182] 1.11 After centrifugation, discard the supernatant, add 1 mL of 10% FBSDMEM medium to resuspend the cell pellet, then count and concentrate the cell suspension to 1.2x10^7 cells / mL.

[0183] 1.12 Take 30 μL of HaCaT with a concentration of 1.2x10^7 cells / mL mCherry The cell suspension was mixed with 30 μL of migrator suspension as the experimental group, and 30 μL of HaCaT with a concentration of 1.2x10^7 cells / mL was taken. mCherryThe cell suspension was mixed with 30 μL 10% FBS DMEM medium as the control group. The cells were injected into different channels of the microfluidic chip that had been coated with poly-lysine (0.1 mg / mL) for 30 min in a 37°C incubator. Each channel was injected with 6 μL and placed in a 37°C incubator.

[0184] 1. After 131 hours, perfuse with a syringe pump and take photos to observe the cell adhesion effect. The flow rate is 10 mL / h, the perfusion volume is 1 mL, and the perfusion time is 6 minutes.

[0185] The experimental results are as follows Figure 3a , 3b As shown, Figure 3a , 3b It shows that the migratory bodies of BEAS-2B cells with high expression of ILK have the effect of enhancing the adhesion of epithelial cells.

[0186] 2. Enhancement of Endothelial Cells HUVEC CFP Adhesion test:

[0187] Experimental steps:

[0188] 2.1 Construction of HUVEC CFP Stable strain

[0189] 2.1.1. Virus packaging:

[0190] This experiment uses a second-generation lentiviral packaging three-plasmid system, which are psPAX2, pMD2.G and the target plasmid pLVX-CFP-puro (to make the host cells fluorescent). The total amount of plasmids required for a 6cm cell culture dish is 5μg, and the concentration ratio of the target plasmid, psPAX2, and pMD2.G is 4:3:1. Therefore, the target plasmid is 2.5μg, the plasmid psPAX2 is 1.875μg, and the plasmid pMD2.G is 0.625μg.

[0191] 2.1.2 Observe under a microscope and wait until the density of HEK-293FT cells reaches about 80% before preparing for virus packaging.

[0192] 2.1.3 Take a clean and sterilized 1.5 mL centrifuge tube and add 200 μL of Buffer (Company: Poly.plus Catalog No.: 201000003) was added with corresponding volumes of psPAX2, pMD2.G and pLVX-CFP-puro at corresponding concentrations.

[0193] 2.1.4 Vortex for 10 seconds and centrifuge for 10 seconds.

[0194] 2.1.5 Add twice the volume of the total amount of plasmid Reagent (here 10 μL)

[0195] 2.1.6 Vortex for 10 seconds and centrifuge for 10 seconds.

[0196] 2.1.7 Let stand at room temperature for 10 minutes.

[0197] 2.1.8 After standing for 10 minutes, aspirate the liquid and gently drop it into the HEK-293FT cell culture dish. Gently shake the culture dish and place it in a 37℃ incubator. Replace the culture medium after 12 hours.

[0198] 2.1.9 After 12 hours, discard the old culture medium, add 6 mL (6 cm cell culture dish) of 10% FBSDMEM culture medium, and place in a 37°C incubator.

[0199] 2.1.1072 hours later, observe whether HEK-293FT cells are successfully excited to emit cyan fluorescence using an inverted fluorescence microscope.

[0200] 2.1.11 After HEK-293FT cells are successfully stimulated to emit cyan fluorescence, use a 10 mL syringe to aspirate the culture medium, then pass it through a 0.22 μm filter, collect the filtered virus solution into a 15 mL centrifuge tube, add the corresponding volume of 5x PEG solution, tighten the centrifuge tube cap, seal it with sealing film, and place it in a shaker in a 4°C cold room and shake slowly overnight to concentrate the virus solution.

[0201] 2.1.12 Place on a shaker and shake slowly overnight, then centrifuge at 6000 rcf for 40 min.

[0202] 2.1.13 After centrifugation, discard the supernatant and add 1 mL of serum-free DMEM medium to resuspend the precipitate. Transfer to a 1.5 mL centrifuge tube and store in a -80°C refrigerator.

[0203] 2.2 Recovery of HUVEC cells (purchased from ATCC official website)

[0204] 2.2.1 Add about 3 mL of fresh 10% FBS1640 culture medium to a 6 cm cell culture dish and place it in a 37°C incubator to rewarm.

[0205] 2.2.2 Take out the HUVEC cells in a 6 cm culture dish frozen at -80°C, put them in clean PE gloves, place them in a 37°C water bath, and shake them quickly until the cells in the cryopreserved tube are completely thawed.

[0206] 2.2.3 Take the cryotube out of the PE gloves and gently wipe the outer wall of the cryotube with clean absorbent paper moistened with 75% ethanol.

[0207] 2.2.4 Gently aspirate the cryopreservation solution and cells in the cryopreservation tube with a pipette, add them into a 15 mL centrifuge tube containing 3 mL 10% FBS1640 culture medium and centrifuge at 1000 rpm for 3 min.

[0208] 2.2.5 After centrifugation, discard the supernatant, add 1 mL of fresh 10% FBS1640 medium to resuspend the cell pellet, and then add it to a 6 cm cell culture dish that has been placed in a 37°C incubator and rewarmed with about 3 mL of fresh 10% FBS1640 medium. Gently shake the cell culture dish using the cross-shaking method to spread the cells as evenly as possible, and then place it steadily in a 37°C incubator.

[0209] 2.3 Virus infection of HUVEC cells

[0210] 2.3.1 Observe the cell status under a microscope. When the cell density reaches about 80%, the cells can be plated.

[0211] 2.3.2 Slightly tilt the cell culture dish and use negative pressure to gently remove the culture medium. Add 1 mL of sterile PBS buffer, gently shake the culture dish, slightly tilt the cell culture dish, and use negative pressure to gently remove the buffer and cell debris.

[0212] 2.3.3 Gently add 1 mL of 0.25% pancreatic enzyme along the side wall of the culture dish (6 cm), gently shake the cell culture dish for 2-4 seconds to allow the pancreatic enzyme to evenly cover the entire bottom of the culture dish, and then use negative pressure to absorb the pancreatic enzyme.

[0213] 2.3.4 Place the culture dish in a 37℃ incubator for digestion for about 5 minutes until the cells become round.

[0214] 2.3.5 Add 1 mL of 10% FBS1640 culture medium to the culture dish and gently blow off the cells. Collect the cell suspension into a 1.5 mL centrifuge tube and count the cells.

[0215] 2.3.6 Add approximately 2.0x10^5 HUVEC cells to one well of a six-well plate and fill the well with culture medium to 1 mL.

[0216] 2.3.7 Take out the concentrated virus solution (pLVX-CFP-puro) from the -80℃ refrigerator and thaw it at room temperature, then add it to the cell suspension in 2.3.6, and then add 4μL of 10mg / mL polybrene.

[0217] 2.3.8 After 24 hours, observe the cell status and observe whether the HUVEC cells are successfully excited to emit cyan fluorescence using an inverted fluorescence microscope. After the cells are successfully excited to emit cyan fluorescence, replace with fresh culture medium.

[0218] 2.3.9 When the cell density reaches 80% (one well of a 6-well plate), digest and resuspend the cells in 1 mL of 10% FBS1640 medium. Centrifuge at 1000 rpm for 3 min, discard the supernatant, resuspend the cell pellet in 1 mL of fresh 10% FBS1640 medium, and inoculate into a 6 cm cell culture dish, and add 10% FBS1640 medium to make up to 4 mL.

[0219] 2.3.10 When the cell density reaches 80%, add 4 μL of 10 mg / mL puro reagent and screen the stable strain for 7 days. During this period, the culture medium should be changed. Each time the medium is changed, the corresponding volume of puro reagent should be added until the cells have puro resistance and finally HUVEC is obtained. CFP cell.

[0220] 2.4 The migrating bodies were extracted using the method in Example 2, and the precipitate rich in migrating bodies was resuspended in 30 μL of 10% FBS 1640 and placed on ice for later use.

[0221] 2.5 Observation of HUVEC under microscope CFP Cell status: When the cell density reaches about 80%, the experiment can be carried out.

[0222] 2.6 Slightly tilt the cell culture dish (6 cm) and use negative pressure to gently remove the culture medium. Add 1 mL of sterile PBS buffer, gently shake the dish, slightly tilt the cell culture dish, and use negative pressure to gently remove the buffer and cell debris.

[0223] 2.7 Gently add 1 mL of 0.25% pancreatin along the side wall of the culture dish (6 cm), gently shake the cell culture dish for 2-4 seconds to allow the pancreatin to evenly cover the entire bottom of the culture dish, and then use negative pressure to absorb the pancreatin.

[0224] 2.8 Place the culture dish in a 37°C incubator for 5 minutes for digestion.

[0225] 2.9 Add 1 mL of 10% FBS1640 culture medium to the culture dish and gently blow off the cells. Collect the cell suspension into a 1.5 mL centrifuge tube and centrifuge at 1000 rpm for 3 min.

[0226] 2.10 After centrifugation, discard the supernatant, add 1 mL of sterile PBS buffer to resuspend the cell pellet, and centrifuge at 1000 rpm for 3 min.

[0227] 2.11 After centrifugation, discard the supernatant, add 1 mL of 10% FBS1640 medium to resuspend the cell pellet, then count and concentrate the cell suspension to 1.2x10^7 cells / mL.

[0228] 2.12 Take 30 μL of HUVEC with a concentration of 1.2x10^7 cells / mLCFP The cell suspension was mixed with 30 μL of migratoria suspension as the experimental group, and 30 μL of HUVEC with a concentration of 1.2x10^7 cells / mL was taken. CFP The cell suspension was mixed with 30 μL 10% FBS1640 medium as the control group. The cells were injected into different channels of the microfluidic chip that had been coated with poly-lysine (0.1 mg / mL) for 30 min in a 37°C incubator. Each channel was injected with 6 μL and placed in a 37°C incubator.

[0229] 2. After 131 hours, perfuse with a syringe pump and take photos to observe the cell adhesion effect. The flow rate is 5 mL / h, the perfusion volume is 0.5 mL, and the perfusion time is 6 minutes.

[0230] The experimental results are as follows Figure 4a , 4b As shown, Figure 4a , 4b It shows that the migrating bodies of BEAS-2B cells with high expression of ILK have the effect of enhancing endothelial cell adhesion.

[0231] Example 5

[0232] The mouse skin wound model was used to test the promoting effect of migratory bodies secreted by mesenchymal cells on wound healing.

[0233] 1. Newborn SPF Kunming mice were killed by cervical dislocation, immersed in 75% ethanol for 2 minutes for disinfection, and placed in a 10 cm cell culture dish after draining.

[0234] 2. Use surgical scissors to separate the back skin, immerse it in a 2mL centrifuge tube filled with PBS buffer, use surgical scissors to cut the skin into pieces with a diameter of 0.5mm, collect it into a 15ml centrifuge tube, centrifuge at 1000rpm for 5min to remove the supernatant, add 1640 culture medium containing 0.1% type I collagenase, place it in an incubator, treat it at 37℃ for 15min, centrifuge at 1000rpm for 5min to remove the supernatant, add 1640 culture medium containing 10% serum to resuspend, pass through an 80μm pore size cell sieve, place the filtrate in a 10cm culture dish, place it in a cell culture incubator, culture it at 37℃ and 5% carbon dioxide, and passage it until it fills 4 10cm cell culture dishes.

[0235] 3. Prepare 9 15cm cell culture dishes, add 12mL of Fn (0.1μg / mL) coating solution to one 15cm cell culture dish. Perform this operation on all 9 15cm dishes, and then place them in a 37℃ incubator for 1h.

[0236] 4. After 1 h, the Fn coating solution in the 15 cm culture dish was sucked away by negative pressure, and 12 mL of 10% FBSDMEM culture medium was added to each 15 cm culture dish.

[0237] 5. Add 2 mL of 0.25% trypsin to each of four 10 cm culture dishes filled with mesenchymal cells for digestion, remove the trypsin and place in a 37 °C incubator for 1 min, then add 3 mL of 10% FBSDMEM culture medium to resuspend each dish, collect all the cell suspensions in a 15 mL centrifuge tube, and then add approximately 1.85 x 10^6 cells to each 15 cm cell culture dish that has been added with 12 mL of 10% FBSDMEM culture medium and place in the incubator for 15-16 hours.

[0238] 6. Extraction of Migration Bodies by Gradient Centrifugation

[0239] Experimental steps:

[0240] 6.1 After 15-16 hours, recover the culture medium in the 15 cm cell culture dish into three 50 mL centrifuge tubes.

[0241] 6.2 Add 2 mL of 0.25% trypsin to each 15 cm cell culture dish for digestion (do not aspirate the trypsin), place in the incubator for 1 min, then add 3 mL of 10% FBSDMEM culture medium to resuspend, and transfer the cell suspension in 9 15 cm cell culture dishes to 2 50 mL centrifuge tubes as evenly as possible.

[0242] 6.3 Centrifugation: 1000rcf, 10min, then 4000rcf, 20min. After the end, pour the supernatant in the two 50mL centrifuge tubes into two 50mL round-bottom centrifuge tubes respectively, change to a round-bottom rotor and centrifuge at 20000rcf, 30min, then discard the supernatant, resuspend the precipitate in the two 50mL round-bottom centrifuge tubes with 1mL of PBS buffer, transfer to a 1.5mL centrifuge tube, centrifuge at 20000rcf, 30min, then discard the supernatant and retain the precipitate, which is rich in migration bodies and is placed on ice for later use.

[0243] This experiment used female Kunming mice aged 6-8 weeks from Changsheng Bio-Technology Co., Ltd.

[0244] Experimental steps:

[0245] 6.4 The precipitate rich in migratory bodies extracted in 6.3 was resuspended in 20 μL of serum-free DMEM to a concentration of about 1.6x10^8 cells / μL, and then 20 μL of Matrigel was added to mix. This is the reagent used in the matrix gel experimental group of matrix cell-derived migratory bodies; the matrix gel experimental group with added EGF was prepared by aspirating 2 μL of 100 μg / mL EGF and 18 μL of serum-free DMEM culture medium and then adding 20 μL of Matrigel to mix. At this time, the concentration of EGF was about 5 μg / mL; the blank matrix gel experimental group was mixed with 20 μL of serum-free DMEM and 20 μL of Matrigel; the precipitate rich in migratory bodies extracted in Example 2 was resuspended in 20 μL of serum-free DMEM to a concentration of about 1.6x10^8 cells / μL, and then 20 μL of Matrigel was added to mix. (This experiment was conducted in three batches, with three female Kunming mice in each batch. Each mouse had two matrix gel experimental groups of matrix cell-derived migratory bodies, two matrix gel experimental groups with EGF added, and two blank matrix gel groups. 6 μL of liquid was dripped into each wound, so 36 μL of liquid was required for each group in each batch of experiments. To avoid loss, 40 μL was prepared.)

[0246] 6.5 First, anesthetize the mouse.

[0247] 6.6 Then use a shaver to shave the hair, apply depilatory cream on the mouse's back skin, and gently make circles with a cotton swab. After three minutes, use a cotton swab dipped in clean water to wipe off the depilatory cream and loose hair to expose the mouse's back skin.

[0248] 6.7 Use alcohol cotton balls to wipe the back skin of the mouse for disinfection.

[0249] 6.8 Then use a 2.5 mm punch pen to make a penetrating wound on the back skin of the mouse and take pictures.

[0250] 6.9 Use a pipette to drop the mixed liquid of the experimental group and the control group into the corresponding wounds.

[0251] 6. After 107 days, the wound area was measured and tissue samples were collected. The mice were observed several times to see if they were in good condition.

[0252] In the same mouse, the EGF-added Matrigel experimental group and the matrix cell-derived migratory body Matrigel experimental group were able to substantially heal the wound compared with the blank Matrigel experimental group on the 7th day. Tspan4-eGFP / ILK-mCherry On the seventh day, the cells were able to basically heal the wound compared with the blank matrix gel group (see Figure 5 ). Therefore, the present invention also has the effect of promoting wound healing and has very good market application value.

[0253] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for preparing an engineered migrator, characterized in that: The preparation method comprises the following steps: co-transfecting an immortalized cell line with lentiviruses containing target genes Tspan4 and ILK respectively, the immortalized cell line after transfection can secrete migrasomes containing ILK protein, and collecting the secreted migrasomes.

2. The preparation method according to claim 1, characterized in that: When constructing the lentivirus containing the target gene Tspan4, the lentivirus expression vector pLVX-Tspan4-eGFP-puro was used.

3. The preparation method according to claim 2, characterized in that: When constructing the lentivirus containing the target gene ILK, the lentivirus expression vector pLVX-ILK-mCherry-puro was used.

4. The preparation method according to claim 3, characterized in that: When preparing the lentivirus containing the target genes Tspan4 and ILK respectively, a second-generation lentivirus packaging three-plasmid system was used.

5. The preparation method according to claim 4, characterized in that: The second-generation lentiviral packaging three-plasmid system includes plasmids psPAX2 and pMD2.G.

6. The preparation method according to any one of claims 1 to 5, characterized in that: The immortalized cell line is a human bronchial epithelial cell line BEAS-2B.

7. A migrator prepared by the preparation method according to any one of claims 1 to 5.

8. The migrator prepared by the preparation method according to claim 6.

9. Use of the migrator according to claim 7 in the preparation of a product for promoting wound healing.

10. Use of the migrator according to claim 8 in the preparation of a product for promoting wound healing.

Images