Universal Photocontrolled CRISPR-Cas12a Detection Method Based on the Strategy of "Tail-Added Self-Silencing" of crRNA
By using the "tailed self-closing" strategy of crRNA in CRISPR-Cas12a detection, the problem of incompatibility of the CRISPR-Cas12a system in the prior art is solved, and the detection effect of high sensitivity and low cross-contamination is achieved.
Patent Information
- Application Number
- CN202510252412.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-05
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2045-03-05
AI Technical Summary
In the existing CRISPR-Cas12a detection technology, the cis and trans cleavage functions are incompatible with the nucleic acid amplification reaction and the aptamer incubation and binding reaction with the target, resulting in complex detection process and risk of cross-contamination.
The universal photocontrolled CRISPR-Cas12a detection method based on the crRNA "tailed self-closing" strategy was adopted. By adding a "self-closing tail" to the end of the crRNA, the tail contains PC-linker photosensitive molecules and complementary base sequences bound to the crRNA target. The self-closing photocontrolled crRNA "detailed" under UV light, restarting the cleavage activity of the CRISPR system.
The compatibility of the CRISPR-Cas12a system with nucleic acid amplification or aptamer with target incubation process is achieved, reducing detection steps and complexity, reducing the risk of cross-contamination, and improving the sensitivity and versatility of the detection.
Smart Images

Figure CN119736370B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biological detection, and particularly relates to a detection method of a universal light-controlled CRISPR-Cas12a based on the "tail-adding self-silencing" strategy of crRNA. Background Art
[0002] Under the guidance of CRISPR RNA (crRNA), the Cas12a protein specifically recognizes and cleaves double-stranded DNA targets, and simultaneously activates efficient trans-cleavage activity. Currently, the CRISPR-Cas12a detection technology for nucleic acid and non-nucleic acid target detection still faces a key bottleneck problem: the cis- and trans-cleavage functions of CRISPR-Cas12a are incompatible with nucleic acid amplification reactions and the incubation and binding reactions of aptamers with targets. This is mainly because: the cis-cleavage function of CRISPR-Cas12a will lead to the loss of nucleic acid amplification templates; the trans-cleavage function will destroy the primers or aptamers of nucleic acid amplification, thereby affecting the amplification efficiency and detection sensitivity. Therefore, in the current detection steps, nucleic acid amplification, the incubation and binding process of aptamers with targets, and the CRISPR-Cas12a reaction are carried out in different test tubes or chambers. However, the two-step reaction requires liquid transfer, which increases the complexity of the detection process and the risk of cross-contamination. Therefore, it is of great research significance to develop a one-pot detection method of CRISPR-Cas12a that is compatible with nucleic acid amplification or the incubation process of targets with aptamers.
[0003] Currently, several one-pot CRISPR detection strategies have been reported, such as using physical space to separate nucleic acid amplification or aptamer and target incubation and the CRISPR reaction, optimizing the concentration of CRISPR components to reduce the inhibition of nucleic acid amplification, and designing crRNAs that do not depend on protospacer adjacent motif (PAM) sites. However, these methods still require additional operation steps or complex microfluidic designs. Photocontrol technology allows chemical reactions to be controlled in a very fast (usually a few seconds) and non-contact manner. The photocontrolled CRISPR-Cas12a technology can activate the CRISPR system at a specific time, thereby achieving one-pot, one-step highly sensitive detection. Research has reported a silencing oligonucleotide modified with a photocleavable linker (PC-linker) that can hybridize with crRNA, which can block the recognition and trans-cleavage functions of the target DNA of the CRISPR system, but this method requires optimizing the ratio of the silencing oligonucleotide to crRNA to achieve complete hybridization and silencing of crRNA.
[0004] G-quadruplex (G4) is a functional nucleic acid nanostructure, which is a four-stranded self-assembly formed by folding a DNA sequence rich in guanine (G). There are a few reports in the literature on the CRISPR-Cas12a biosensing detection method based on G4. G4 dimer (dG4) is a higher-order quaternary structure. It has been found that the fluorescence intensity of dG4 / ThT is about 9 times that of G4 / ThT, and the fluorescence intensity is not affected by high-salt solutions. After investigation, it is found that there is no relevant report on the CRISPR-Cas12a biosensing detection technology based on dG4. Summary of the Invention
[0005] To solve the above technical problems, the present invention provides a general light-controlled CRISPR-Cas12a detection method based on the "tail-added self-silencing" strategy of crRNA.
[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:
[0007] A general light-controlled CRISPR-Cas12a detection method based on the "tail-added self-silencing" strategy of crRNA. In this method, the crRNA in the general light-controlled CRISPR-Cas12a detection system is used as a self-closed light-controlled crRNA. The self-closed light-controlled crRNA is obtained by adding a "self-closed tail" to the end of the crRNA. The "self-closed tail" contains both a photo-cleavable PC-linker photosensitive molecule and a complementary base sequence that spontaneously forms a hairpin structure with the target-binding sequence of the crRNA. Further, the sequence of the crRNA is SEQ ID NO.1: 5′–UAAUUUCUACUCUUGUAGAU NNNNNNNNNNNNNNNNNNNN –3′ (the bold part UAAUUUCUACUCUUGUAGAU is a 20-nt direct repeat sequence (DR region) in full length), and the underlined N represents the spacer region that is complementary to the specific target sequence of the gene to be detected; the sequence of the "self-closed tail" is the N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′–3′ base sequence that is complementary to NNNNNNNNNNNNNNNNNNNN and spontaneously forms a hairpin structure, and N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′ is labeled with a PC-linker photosensitive molecule; there are 2 to 6 base Us between N and N′; N and N′ represent bases selected from C, G, U, and A.
[0008] The crRNA containing the "self-closed tail" is extended by a section at the 3′ end of the crRNA, and its base sequence is AAUUUCUACUCUUGUAGAU NNNNNNNNNNNNNNNNNNNNUUUUUN ′ N ′N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′–3′, where the N sequence (spacer region) is base complementary paired with the N ′ sequence.
[0009] Furthermore, the length of the "self-closing tail" is 10 to 25 bases, that is, the number of N is 10 to 25 nt.
[0010] The photocontrolled crRNA (1) containing the "self-closing tail" can "self-silence" the CRISPR system through the spontaneously formed "hairpin" structure with the PC-linker site, blocking the cleavage of the nucleic acid amplification primer or aptamer by the CRISPR system, thus solving the incompatibility problem between nucleic acid amplification and the enzymatic cleavage reaction of the CRISPR system; (2) the "hairpin" structure with the PC-linker site can be cleaved by UV light, and then "tail addition" of crRNA generates "tail removal", thus restarting the enzymatic cleavage function of the CRISPR system.
[0011] Among them, PC-linker is 2-nitrophenyl phosphate diester, which is a photocleavable spacer and a non-nucleoside molecule. It connects two nucleotide sequences through a short UV-light cleavable C3 spacer arm and can be added at any position of the sequence; PC-linker can be rapidly cleaved under specific short UV light to obtain a 5'-phosphorylated oligomer and a 3'-phosphorylated oligomer.
[0012] For the detection method as described above, preferably, the detection system of the general photocontrolled CRISPR-Cas12a further includes aptamer (non-nucleic acid target) or RPA system (nucleic acid target) and Cas12a and G4 dimer and the sample to be tested; during detection, after irradiating with a 365 nm ultraviolet lamp and incubating at 37 °C, then add thioflavin T (ThT) to each reaction tube, and after incubating in the dark at room temperature, detect the fluorescence signal intensity of the detection system and analyze the results to calculate the content of the sample to be tested.
[0013] A method for detecting non-nucleic acid targets of Salmonella by a universal light-controlled CRISPR-Cas12a based on the "tail-added self-silencing" strategy of crRNA, characterized in that the detection system of the universal light-controlled CRISPR-Cas12a includes aptamer, Cas12a, self-closed light-controlled crRNA, G4 dimer and the sample of the bacteria to be detected; wherein the sequence of the aptamer is as shown in SEQ ID NO.2, and the sequence of the self-closed light-controlled crRNA is as shown in SEQ ID NO.3, and PC-linker photosensitive molecules are labeled at the 41st base and every 5 bases thereafter in its sequence;
[0014] During detection, after irradiation with an ultraviolet lamp, incubation is carried out, and then thioflavin T is added to each detection system. After incubation in the dark at room temperature, the fluorescence signal intensity of the detection system is detected and the results are analyzed to calculate the Salmonella content of the sample to be detected.
[0015] Furthermore, the irradiation time of the ultraviolet lamp is 1-2 min; the incubation is carried out at 35-40 °C for 60-120 min, and the incubation time in the dark is 15-30 min.
[0016] For the detection method as described above, preferably, the concentration of the aptamer is 25 nM.
[0017] A method for detecting nucleic acid targets of Salmonella by a universal light-controlled CRISPR-Cas12a based on the "tail-added self-silencing" strategy of crRNA, characterized in that the detection system of the universal light-controlled CRISPR-Cas12a includes an RPA amplification system, Cas12a, self-closed light-controlled crRNA, G4 dimer and the DNA sample to be detected; the sequence of the self-closed light-controlled crRNA is as shown in SEQ ID NO.4, and PC-linker photosensitive molecules are labeled at the 44th base and every 6 bases thereafter in this sequence; the RPA system includes upstream primers and downstream primers as shown in SEQ ID NO.5 and SEQ ID NO.6;
[0018] During detection, after irradiation with an ultraviolet lamp, incubation is carried out, and then thioflavin T is added to each reaction tube. After incubation in the dark at room temperature, the fluorescence signal intensity of the detection system is detected and the results are analyzed.
[0019] For the detection method as described above, preferably, the irradiation time of the ultraviolet lamp is 1-2 min.
[0020] For the detection method as described above, preferably, after irradiation with the ultraviolet lamp, the incubation is carried out at 35-40 °C for 60-120 min, and the incubation time in the dark is 15-30 min.
[0021] Preferably, the detection system is first shaken and mixed evenly and then incubated at 37 °C for 10 min; then irradiated with a UV lamp (λ365 nm, 35 W) for 90 s and then incubated at 37 °C for 60 - 90 min.
[0022] Among them, the RPA amplification was carried out using an RPA amplification kit, and the RPA amplification system was: 0.5 μL of 10 μM primer A (the sequence is SEQ ID NO.5: CATCTGTTTACCGGGCATACCATCCAGAGAAAA), 0.5 μL of 10 μM primer B (the sequence is SEQ ID NO.6: TGTTGTCTTCTCTATTGTCACCGTGGTCCAG), 0.5 μL of 280 mM MgOAc), 6 μL of rehydration buffer, 0.2 μL of sample DNA and 2.5 μL of water; the total reaction volume was 10 μL.
[0023] The beneficial effects of the present invention are as follows:
[0024] The novel light-controlled CRISPR-Cas12a detection technology provided by the present invention uses a light-controlled CRISPR-Cas12a detection system including a "tail-added self-blocking" light-controlled crRNA, Cas12a, a nucleic acid amplification reaction system or aptamer, a target molecule incubation system, and a G4 dimer-ThT (dG4-ThT) system; specifically, a "self-blocking tail" is added to the end of the crRNA, and this "tail" contains both a photo-cleavable PC-linker site and a complementary base sequence that spontaneously forms a hairpin structure with the target-binding sequence of the crRNA.
[0025] The present invention uses self-blocking crRNA to block the cleavage activity of the CRISPR-Cas12a system, avoiding the cleavage effect on the nucleic acid amplification reaction system or aptamer and the target molecule incubation system; after the nucleic acid amplification or aptamer and target molecule incubation is completed, under the condition of UV light irradiation, the self-blocking light-controlled crRNA "removes the tail", thereby restarting the cleavage activity of the CRISPR-Cas12a system; the activated CRISPR-Cas12a system cleaves dG4, so no strong fluorescence signal is generated. The method provided by the present invention can block the CRISPR-Cas12a system without optimizing the conditions for crRNA blocking.
[0026] The novel light-controlled CRISPR-Cas12a detection technology provided by the present invention does not require optimizing the ratio of the silencing oligonucleotide and crRNA. Only by self-blocking the crRNA can the complete hybridization and silencing of the crRNA be achieved, which has universality, simple operation, and greatly shortens the detection time.
[0027] The general-purpose light-controlled CRISPR-Cas12a one-pot detection technology constructed by the present invention is applicable to the detection of nucleic acid and non-nucleic acid targets. Brief Description of the Drawings
[0028] Figure 1 It is a schematic diagram of the principle of the light-controlled CRISPR-Cas12a one-pot method for the detection of nucleic acid and non-nucleic acid targets based on the "tail-added self-silencing" strategy of crRNA.
[0029] Figure 2 It is a schematic diagram of the structure of the PC-linker photosensitive molecule.
[0030] Figure 3 It is a graph showing the influence of different UV irradiation times on the activation efficiency of the CRISPR-Cas12a system.
[0031] Figure 4 It is a graph showing the influence of different incubation times on the cleavage efficiency of the CRISPR-Cas12a system.
[0032] Figure 5 It is a graph showing the influence of different aptamer concentrations on the cleavage efficiency of the CRISPR-Cas12a system.
[0033] Figure 6 It is a graph of the fluorescence spectrum results at different wavelengths for the detection of non-nucleic acid targets of Salmonella by the light-controlled CRISPR-Cas12a one-pot method based on the "tail-added self-silencing" strategy of crRNA.
[0034] Figure 7 It is a scatter plot for the detection of non-nucleic acid targets of Salmonella by the light-controlled CRISPR-Cas12a one-pot method based on the "tail-added self-silencing" strategy of crRNA.
[0035] Figure 8 It is a standard curve graph for the detection of non-nucleic acid targets of Salmonella by the light-controlled CRISPR-Cas12a one-pot method based on the "tail-added self-silencing" strategy of crRNA.
[0036] Figure 9 It is a graph showing the results of the specificity investigation for the detection of non-nucleic acid targets of Salmonella by the light-controlled CRISPR-Cas12a one-pot method based on the "tail-added self-silencing" strategy of crRNA.
[0037] Figure 10 It is a graph of the fluorescence spectrum results at different wavelengths for the detection of nucleic acid targets of Salmonella by the light-controlled CRISPR-Cas12a one-pot method based on the "tail-added self-silencing" strategy of crRNA.
[0038] Figure 11Scatter plot of Salmonella concentration and fluorescence value for the detection of Salmonella nucleic acid targets by the one-pot method of light-controlled CRISPR-Cas12a based on the "tail-added self-silencing" strategy of crRNA.
[0039] Figure 12 Result diagram of the standard curve for the detection of Salmonella nucleic acid targets by the one-pot method of light-controlled CRISPR-Cas12a based on the "tail-added self-silencing" strategy of crRNA.
[0040] Figure 13 Result diagram for the specificity investigation of the detection of Salmonella nucleic acid targets by the one-pot method of light-controlled CRISPR-Cas12a based on the "tail-added self-silencing" strategy of crRNA. Detailed implementation mode
[0041] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Modifications or substitutions made to the present invention without departing from the spirit and essence of the present invention all fall within the scope of the present invention.
[0042] Unless otherwise specified, the technical means used in the examples are conventional means well-known to those skilled in the art. Unless otherwise specified, the reagents used in the present invention are all of analytical pure or above specifications and can be purchased commercially.
[0043] Example 1 Light-controlled CRISPR mechanism based on the "tail-added self-silencing" strategy of crRNA
[0044] The light-controlled CRISPR mechanism based on the "tail-added self-silencing" strategy of crRNA provided by the present invention is as Figure 1 shown:
[0045] (1) Nucleic acid target detection: When the target object is present in the sample, the target nucleic acid is first amplified by the RPA system; after the amplification is completed, it is irradiated with a UV lamp, and the tail of the light-controlled crRNA with added tail is cleaved; the RPA amplification product activates the CRISPR-Cas12a system (crRNA-Cas12a), and then trans-cleaves dG4, thus hindering the formation of the dG4-ThT complex and generating a weak fluorescence signal. On the contrary, when the target object is not present in the sample, the RPA amplification product cannot activate the CRISPR-Cas12a system, so there are a large number of dG4, and then a high-concentration dG4-ThT complex is formed, resulting in a high-intensity fluorescence signal.
[0046] (2) Non-nucleic acid target detection: When the target object is present in the sample, the target molecule first binds to the aptamer; after the binding is completed, the sample is also irradiated with a UV lamp, and the tail-added self-silencing photocontrolled crRNA tail breaks; since the aptamer binds to the target molecule, the CRISPR-Cas12a system cannot be activated, so there are a large number of dG4, and then a high-concentration dG4-ThT complex is formed, resulting in a high-intensity fluorescence signal. Conversely, when the target object is not present in the sample, the aptamer can fully activate the CRISPR-Cas12a system, which then trans-cleaves dG4, thus hindering the formation of the dG4-ThT complex and generating a weak fluorescence signal.
[0047] In the present invention, a complementary sequence containing a PC-linker photocontrol site is extended at the end of the crRNA to form a photocontrolled crRNA with a "self-closed tail". Specifically, the design of the self-closed photocontrolled crRNA: The crRNA contains a 20-nt direct repeat sequence (DR region), and a guide sequence (spacer region) with a length of 20-25 nt that is complementary to the specific target sequence of the gene to be detected. The "self-closed tail" is a base sequence that is complementary to the guide sequence and spontaneously forms a hairpin structure, and the complementary sequence is marked with a PC-linker photosensitive molecule every 4-6 bases; there are 3-6 bases U between the guide sequence and the complementary sequence.
[0048] The designed crRNA sequence is as follows SEQ ID NO.1: 5′–UAAUUUCUACUCUUGUAGAU NNNNNNNNNNNNN NNNNNNN –3′ (the bold part is the 20-nt direct repeat sequence (DR region) in full length, and the underlined part represents the spacer region that is complementary to the specific target sequence), and the tail-added self-closed photocontrolled crRNA is extended by a segment at the 3′ end of the crRNA, and its base sequence can be UAAUUUCUACUCUUGUAGAU NNNNNNNNNNNNNNNNNNNNUUUUUN ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N ′ N′–3′, where the N sequence is the spacer region, which is complementary to a partial sequence of the target DNA or aptamer; the extended N′ sequence with a tail is base-complementary to the N sequence, and there are also 2 to 6 bases U between the N sequence and the N′ sequence, which helps the sequence to form a complementary sequence. After the N sequence, a PC-linker photosensitive molecule is marked every 4 to 6 bases. Among them, the PC-linker photosensitive molecule is 2-nitrophenyl phosphate diester, which is a photo-cleavable spacer and a non-nucleoside molecule. It connects two nucleotide sequences through a C3 spacer arm that can be cleaved by short ultraviolet light and can be added at any position of the sequence; PC-linker can be quickly cleaved under specific short ultraviolet light to obtain a 5'-phosphorylated oligomer and a 3'-phosphorylated oligomer. The specific structure is as Figure 2 shown.
[0049] Example 2 Effect of UV irradiation time on the activation efficiency of CRISPR-Cas12a system
[0050] Taking the detection of non-nucleic acid target of Salmonella as an example. The sequence of the tail-added self-closing photocontrolled crRNA is designed as SEQ ID NO.3: UAAUUUCUACUAAGUGUAGAUCCCCGUCGGGUGACGCCGCC (PC-1inker) UUUUU (PC-1inker) GGCGG (PC-1inker) CGUCA (PC-1inker) CCCGA (PC-1inker) CGGGG.
[0051] Add 10 µL of 125 nM Salmonella aptamer (the sequence is SEQ ID NO.2: TATGGCGGCGTCACCCGACGGGGATTGACATTATGACAG, synthesized by Sangon Biotech), 5 µL of 500 nM Cas12a, 5 µL of 500 nM self-closing photocontrolled crRNA (wherein, Cas12a is purchased from NEB company, and the sequence of the self-closing photocontrolled crRNA is as above, synthesized by Sangon Biotech) and 10 µL of 5 μM G4 dimer (G4 dimer, synthesized by Sangon Biotech) into a centrifuge tube, and then make up to 200 µL with 10 mM Tris-HCl buffer. Among them, after irradiating with a 365 nm ultraviolet lamp for 0, 30, 60, 90, 120, 180, 240, 300 s respectively, incubate at 37 °C for 1 h. Add 2.5 μL of 1 mM thioflavin T (ThT) to each tube and incubate in the dark at room temperature for 30 min. Measure the fluorescence intensity of G4dimer / ThT with an enzyme-linked immunosorbent assay (ELISA). The specific results are shown in Figure 3 . Figure 3The abscissa represents the ultraviolet lamp irradiation time, and the ordinate represents the fluorescence value. From the obtained results, it can be seen that the optimal UV light irradiation time is 90 s.
[0052] Example 3 Influence of Incubation Time on the Cleavage Efficiency of the CRISPR-Cas12a System
[0053] Taking the detection of non-nucleic acid targets of Salmonella as an example. Add 10 µL of 125 nM Salmonella aptamer, 5 µL of 500 nM Cas12a, 5 µL of 500 nM self-blocking photocontrolled crRNA, and 10 µL of 5 μM G4 dimer into a centrifuge tube, and then make up to 200 µL with 10 mM Tris-HCl buffer. The sequence of the photocontrolled crRNA is the same as that in Example 2. After irradiating with a 365 nm UV lamp for 30 s respectively, incubate at 37 °C for 0, 30, 60, 90, 120, 150 min. Immediately afterwards, add 2.5 μL of 1 mM thioflavin T (ThT) to each tube and incubate in the dark at room temperature for 30 min. Measure the fluorescence intensity of G4 dimer / ThT using a microplate reader. The specific results are shown in Figure 4 . Figure 4 In it, the abscissa represents the incubation time, and the ordinate represents the fluorescence value. From the obtained results, it can be seen that the optimal incubation time is 120 min. In addition, we found that the fluorescence intensity at 90 min is close to that at 120 min. In order to shorten the detection time, we selected an incubation time of 90 min.
[0054] Example 4 Influence of Aptamer Concentration on the Cleavage Efficiency of the Photocontrolled CRISPR-Cas12a System
[0055] Taking the detection of non-nucleic acid targets of Salmonella as an example.
[0056] Add 10 µL of 1000 nM, 500 nM, 250 nM, 125 nM, 62.5 nM, 31.25 nM, and 0 nM aptamer into centrifuge tubes respectively; add 5 µL of 500 nM Cas12a, 5 µL of 500 nM self-blocking photocontrolled crRNA, and 10 µL of 5 μM dG4 into each centrifuge tube; make up to 200 µL with 10 mM Tris-HCl buffer. The sequence of the photocontrolled crRNA is the same as that in Example 2. Subsequently, irradiate with a 365 nm ultraviolet lamp for 90 s and incubate at 37 °C for 90 min. Immediately afterwards, add 2.5 μL of 1 mM thioflavin T (ThT) to each tube and incubate in the dark at room temperature for 30 min. Measure the fluorescence intensity of G4 dimer / ThT using a microplate reader. The specific results are shown in Figure 5。It can be seen from the obtained results that the optimal aptamer concentration is 500 nM, so the final concentration of aptamer is about 25 nM. The aptamer sequence of Salmonella is SEQ ID NO.2: TATGGCGGCGTCACCCGACGGGGATTGACATTATGACAG.
[0057] Example 5 Detection of Non-Nucleic Acid Targets of Salmonella
[0058] Add 80 µL of Salmonella at different concentration gradients (0, 1.7×10 1 、1.7×10 2 、1.7×10 3 、1.7×10 4 、1.7×10 5 、1.7×10 6 、1.7×10 7 CFU / mL) into centrifuge tubes, and then add 10 µL of 500 nM aptamer, 5 µL of 500 nM Cas12a, 5 µL of 500 nM self-blocking photocontrolled crRNA, 10 µL of 5 µM G4 dimer and 167.5 µL of 10 mM Tris-HCl buffer (containing 100 mM NaCl and 20 mM MgCl 2 ). The sequence of the photocontrolled crRNA is the same as that in Example 2. After shaking and mixing evenly, incubate at 37 °C for 10 min. Then irradiate with a UV lamp (λ 365 nm, 35 W) for 90 s and incubate at 37 °C for 90 min. Finally, add 2.5 µL of 1 mM thioflavin T (ThT) to each centrifuge tube, incubate in the dark at room temperature for 30 min, and then detect the fluorescence signal intensity of the G4dimer / ThT complex at different wavelengths under different concentrations of Salmonella.
[0059] Plot the fluorescence signal intensity detected at different wavelengths with different wavelengths as the abscissa. The detection results are as Figure 6 shown, indicating that as the concentration of Salmonella increases from 0 to 1.7×10 7 CFU / mL, the fluorescence intensity of G4 dimer / ThT gradually increases, and there is a relatively high fluorescence intensity at a wavelength of 490 nm. And there is a linear relationship in the range of 1.7×10 1 to 1.7×10 7 CFU / mL. Plot a scatter diagram with the logarithm of the Salmonella concentration as the abscissa (IgC) and the fluorescence intensity at a corresponding wavelength of 490 nm as the abscissa, as shown in Figure 7 shown. At the same time, plot the standard curve, and the linear equation is: FI = 2055.33 lgC + 17151.64, R2 = 0.998. As shown in Figure 8 Figure 8 , the lowest detection limit of Salmonella was obtained as 13 CFU / mL.
[0060] Example 6 Detection Specificity of Salmonella Non-Nucleic Acid Targets
[0061] 10 μL of 500 nM aptamer, 5 μL of 500 nM Cas12a, 5 μL of 500 nM photocontrolled crRNA, 10 μL of 5 μM G4 dimer, and 87.5 μL of 10 mM Tris-HCl were successively added into a centrifuge tube. Then, 80 μL of 1.7×10 5 CFU / mL Staphylococcus aureus (J), Escherichia coli (D), Salmonella (S), and their mixtures J+D, S+J, S+D were added respectively, and incubated at 37 °C for 10 min. The sequence of the photocontrolled crRNA was the same as that in Example 2. Immediately, it was irradiated with a UV lamp for 90 s. Then, it was incubated at 37 °C for 90 min. Finally, 2.5 μL of 1 mM ThT was added to each centrifuge tube. After incubating at room temperature in the dark for 30 min, the fluorescence signal intensities of G4 dimer / ThT corresponding to different foodborne pathogenic bacteria were measured at a wavelength of 490 nm. From the obtained results Figure 9 it can be seen that the fluorescence intensity of the sample containing Salmonella (S) was the highest, and the fluorescence intensity values of non-target foodborne pathogenic bacteria were similar to those of the negative control group. Therefore, it was verified that the method had good detection specificity.
[0062] Example 7 Practical Application of Detecting Salmonella Non-Nucleic Acid Targets
[0063] Salmonella typhimurium was added to milk, pre-cut vegetables, and chicken samples to evaluate the practical application of this method. The final spiked concentrations of Salmonella in each sample were 1.7×10 2 、1.7×10 3 and 1.7×10 4 CFU / mL respectively. According to the operation in Example 5, 80 μL of the spiked test sample was added to the centrifuge tube for the test sample, and then 10 μL of 500 nM aptamer, 5 μL of 500 nM Cas12a, 5 μL of 500 nM photocontrolled crRNA, 10 μL of 5 μM G4 dimer, and 87.5 μL of 10 mM Tris-HCl (100 mM NaCl, 20 mM MgCl 2, pH 7.5), where the sequence of the light-controlled crRNA is the same as in Example 2. After shaking and mixing evenly, incubate at 37 °C for 10 min. Then irradiate with a UV lamp (λ 365 nm, 35 W) for 90 s and incubate at 37 °C for 90 min. Finally, add 2.5 µL of 1 mM thioflavin T (ThT) to each centrifuge tube, incubate in the dark at room temperature for 30 min, and then detect the fluorescence signal intensity of the G4 dimer / ThT complex at a wavelength of 490 nm. Substitute the measured fluorescence signal intensity of the sample into the linear equation in Example 5 to obtain the Salmonella in the sample to be tested. The results are shown in Table 1.
[0064] As can be seen from Table 1 of the results, the recovery rate of Salmonella was 97.06% - 108.41%, which further indicates that this method has good practical applicability.
[0065] Table 1 Investigation of practical applicability
[0066]
[0067] Example 8 Detection of Salmonella nucleic acid target
[0068] The sequence of the self-cleaving light-controlled crRNA for the Salmonella nucleic acid target was designed as SEQ ID NO.4: UAAUUUCUACUAAGUGUAGAUCCGGGCAUACCAUCCAGAGAAAA (PC-linker) UUUUUU (PC-linker) CUCUGG (PC-linker) AUGGUA (PC-linker) UGCCCG.
[0069] The nucleic acid RPA amplification system was carried out using an RPA amplification kit, including 0.5 μL of 10 μM primer A (sequence: SEQ ID NO.5: CATCTGTTTACCGGGCATACCATCCAGAGAAAA), 0.5 μL of 10 μM primer B (sequence: SEQ ID NO.6: TGTTGTCTTCTCTATTGTCACCGTGGTCCAG), 0.5 μL of 280 mM MgOAc), 6 μL of rehydration buffer, 0.2 μL of sample DNA and 2.5 μL of water, and the total reaction volume was 10 μL.
[0070] Add 10 µL of the RPA amplification system into a centrifuge tube, and then add 5 µL of 500 nM Cas12a, 5 µL of self-blocking photocontrolled crRNA at 500 nM, 10 µL of 5 μM G4 dimer, and 167.5 µL of 10 mM Tris-HCl buffer (containing 100 mM NaCl and 20 mM MgCl 2 ). After mixing by oscillation, incubate at 39 °C for 20 min. Then irradiate with a UV lamp for 90 s and incubate at 37 °C for 90 min. Finally, add 2.5 µL of 1 mM ThT respectively, incubate in the dark at room temperature for 30 min, and then measure the fluorescence intensity of the G4 dimer / ThT complex under different concentrations of Salmonella at a wavelength of 490 nm using a microplate reader. Among them, add DNA of Salmonella at different concentration gradients (0, 1.7×10 1 , 1.7×10 2 , 1.7×10 3 , 1.7×10 4 , 1.7×10 5 , 1.7×10 6 , 1.7×10 7 CFU / mL) into the nucleic acid RPA amplification system for detection.
[0071] Draw a curve with different wavelengths as the abscissa and fluorescence intensity as the ordinate. From the obtained results as Figure 10 , it can be seen from the figure that as the concentration of Salmonella increases, the fluorescence intensity of the G4 dimer / ThT complex gradually decreases, and the fluorescence intensity is the highest at 490 nm; and use the logarithm of the Salmonella concentration as the abscissa (lgC), and the corresponding fluorescence intensity at a wavelength of 490 nm as the ordinate to draw a scatter plot as Figure 11 shown. At the same time, draw a standard curve, which shows a linear relationship in the range of 1.7×10 1 to 1.7×10 8 CFU / mL, as Figure 12 shown. The linear equation is: FI = -2339.66 lgC + 33117.69, R 2 = 0.995, and the lowest detection limit of Salmonella is obtained as 4 CFU / mL.
[0072] Example 9 Detection of the specificity of the Salmonella nucleic acid target
[0073] The sequence of the self - closing photocontrolled crRNA targeting Salmonella nucleic acid is designed as UAAUUUCUACUAAGUGUAGAUCCGGGCAUACCAUCCAGAGAAAA (PC - linker) UUUUUU (PC - linker) CUCUGG (PC - linker) AUGGUA (PC - linker) UGCCCG.
[0074] The nucleic acid RPA amplification system is the same as that in Example 8.
[0075] In a centrifuge tube, add 5 μL of 500 nM Cas12a, 5 μL of 500 nM self - closing photocontrolled crRNA, 10 μL of 5 μM G4 dimer, and 167.5 μL of 10 mM Tris - HCl buffer (containing 100 mM NaCl, 20 mM MgCl 2 ), and then add 10 μL of the nucleic acid RPA amplification system of Staphylococcus aureus (J), Escherichia coli (D), Salmonella (S) and their mixtures J + D, J + S, S + D at a concentration of 1.7×10 5 CFU / mL respectively. Incubate at 39 °C for 20 min. After UV irradiation for 90 s, incubate at 37 °C for 90 min. Finally, add 2.5 μL of 1 mM ThT to each centrifuge tube. After incubating in the dark at room temperature for 30 min, detect the fluorescence intensity of the G4 dimer / ThT complex corresponding to different food - borne pathogenic bacteria at a wavelength of 490 nm.
[0076] The results obtained are as Figure 13 shown. It can be seen that the fluorescence intensity of the sample containing Salmonella (S) is the lowest, and the fluorescence intensity values of non - target food - borne pathogenic bacteria are similar to those of the negative control group. Therefore, it is verified that this method has good detection specificity and strong specificity.
[0077] Example 10 Practical application of detecting Salmonella nucleic acid targets
[0078] Similarly, Salmonella typhimurium was added to milk, pre - cut vegetables and chicken samples to evaluate the practical application of this method. The final spiked concentrations of Salmonella in each sample are 1.7×10 2 , 1.7×10 3 and 1.7×10 4CFU / mL, and then extract DNA. Configure the RPA amplification system according to Example 8. Add 10 µL of the RPA amplification system (the same as in Example 8) to a centrifuge tube, and then add 5 µL of 500 nM Cas12a, 5 µL of 500 nM self-blocking photocontrolled crRNA (the same as in Example 8), 10 µL of 5 μM G4 dimer, and 167.5 µL of 10 mM Tris-HCl buffer (containing 100 mM NaCl, 20 mM MgCl 2 ). After mixing by oscillation, incubate at 39 °C for 20 min. Then irradiate with a UV lamp for 90 s and incubate at 37 °C for 90 min. Finally, add 2.5 µL of 1 mM ThT respectively, incubate in the dark at room temperature for 30 min, and then measure the fluorescence intensity of the G4 dimer / ThT complex under different concentrations of Salmonella at a wavelength of 490 nm using a microplate reader. According to the linear equation obtained in Example 8, the recovery rate of Salmonella in each test sample can be obtained, and the results are shown in Table 2.
[0079] Table 2 Investigation on the practical applicability of Salmonella nucleic acid detection
[0080]
[0081] As can be seen from the results in Table 2, the recovery rate of Salmonella was 93.14% - 118.45%, further indicating that the detection method of the invention has good practical applicability.
Claims
1. A universal light-controlled CRISPR-Cas12a detection method based on crRNA "tailing self-silencing" strategy, characterized in that: This method is a detection method for non-diagnostic purposes. The crRNA in the detection system of the universal light-controlled CRISPR-Cas12a is a self-closed light-controlled crRNA, which is a "self-closed tail" added to the end of the crRNA. The "self-closed tail" contains both a light-cleavable PC-linker photosensitive molecule and a complementary base sequence that spontaneously forms a hairpin structure with the target binding sequence of the crRNA; The sequence of crRNA is SEQ ID NO.1: 5′–UAAUUUCUACUCUUGUAGAU NNNNNNNNNNNNNNNNNNNN –3′, wherein the underlined portion represents a guide sequence complementary to the specific target sequence of the gene to be tested, the sequence of the "self-sealing tail" is a 5′–N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′–3′ base sequence complementary to the guide sequence and spontaneously forming a hairpin structure, and the complementary sequence is labeled with a PC-linker photosensitive molecule every 4 to 6 bases; there are 2 to 6 bases U between N and N′; N and N′ represent bases selected from C, G, U, and A; PC-linker is 2-nitrophenyl phosphodiester; The universal light-controlled CRISPR-Cas12a detection system also includes an aptamer or RPA system, Cas12a and G4 dimer and a sample to be tested. During the detection, the sample is irradiated with ultraviolet light and incubated. Thioflavin T is then added to each reaction tube. After incubation at room temperature in the dark, the fluorescence signal intensity of the system is detected and the results are analyzed.
2. The detection method according to claim 1, characterized in that: The length of the "self-sealing tail" is 10~25 bases.
3. A method for detecting non-nucleic acid targets of Salmonella using a universal light-controlled CRISPR-Cas12a based on the crRNA "tailing self-silencing" strategy, characterized in that: This method is a method for non-diagnostic purposes. The detection system of the universal light-controlled CRISPR-Cas12a includes aptamer, Cas12a, self-enclosed light-controlled crRNA and G4 dimer and a bacterial solution sample to be tested; wherein the sequence of aptamer is shown in SEQ ID NO.2; the sequence of the self-enclosed light-controlled crRNA is shown in SEQ ID NO.3, and the 41st base of its sequence and every 5 bases thereafter are marked with PC-linker photosensitive molecules; During the detection, after irradiation with ultraviolet light, incubation is performed, and then Thioflavin T is added to each reaction tube. After incubation at room temperature in the dark, the fluorescence signal intensity of the detection system is detected and the results are analyzed to calculate the Salmonella content of the sample to be tested.
4. The detection method according to claim 3, characterized in that: The ultraviolet light irradiation time is 1-2 min; the incubation time is 60-120 min at 35-40° C., and the light-proof incubation time is 15-30 min.
5. A method for detecting Salmonella nucleic acid targets using a universal light-controlled CRISPR-Cas12a based on the crRNA "tailing self-silencing" strategy, characterized in that: This method is a method for non-diagnostic purposes. The universal light-controlled CRISPR-Cas12a detection system includes an RPA system, Cas12a, a self-enclosed light-controlled crRNA, a G4 dimer and a sample to be tested; the sequence of the self-enclosed crRNA is shown in SEQ ID NO.4, and the PC-linker photosensitive molecule is marked at the 44th base of the sequence and every 6 bases thereafter; the RPA system includes an upstream primer and a downstream primer as shown in SEQ ID NO.5 and SEQ ID NO.6; During the detection, after irradiation with ultraviolet light, incubation is performed, and then Thioflavin T is added to each detection system. After incubation at room temperature in the dark, the fluorescence signal intensity of the detection system is detected and the results are analyzed.
6. The detection method according to claim 5, characterized in that: The UV lamp irradiation time is 1 to 2 min.
7. The detection method according to claim 5, characterized in that: After the ultraviolet light irradiation, the incubation time is 60-120 min at 35-40° C., and the incubation time in the dark is 15-30 min.
Citation Information
Patent Citations
Nucleic acid detection system and nucleic acid detection method
CN118325715A
Modified crispr RNA and modified single crispr RNA and uses thereof
US20180179521A1