Kidney cancer metastasis related marker miRNA-12131 and application thereof

Abstract

The invention discloses a kidney cancer metastasis related marker miRNA-12131 and application thereof. The marker miRNA-12131 can be used for judging whether kidney cancer metastasis occurs or not or pre-judging the kidney cancer metastasis risk. The test proves that miRNA-12131 can effectively distinguish a kidney cancer metastasis sample from a non-metastasis sample, and miRNA-12131 is also applied to preparation of drugs for inhibiting kidney cancer metastasis or preventing kidney cancer metastasis. The invention provides a new diagnosis method for clinical diagnosis of renal carcinoma metastasis at a molecular level, and provides a new drug target for gene therapy of renal carcinoma metastasis.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and relates to a renal cancer miRNA marker and an application thereof, and specifically relates to a miRNA-12131 marker associated with renal cancer metastasis and an application thereof. Background Art

[0002] With the rapid development of modern biomedical technology, the role of biomarkers in disease diagnosis, treatment and prognosis assessment has become increasingly prominent. Especially in the field of cancer, finding and verifying effective molecular markers is of great significance for improving the treatment effect and quality of life of cancer patients. Renal cancer, as one of the common malignant tumors of the urinary system, has an increasing incidence year by year worldwide, posing a serious threat to human health. Early diagnosis and treatment of renal cancer are crucial to improving the survival rate of patients. However, renal cancer often lacks specific symptoms in the early stages, resulting in many patients being in the late stage or metastatic when diagnosed. At present, the diagnosis of renal cancer mainly relies on imaging examinations such as ultrasound, CT and MRI, but these methods can often only be detected after the tumor has developed to a certain stage. Therefore, the development of new biomarkers, especially molecular markers, is of great significance for the early detection and treatment of renal cancer.

[0003] In recent years, microRNA (miRNA), as a class of endogenous non-coding small RNA molecules, has attracted extensive attention due to its regulatory role in various biological processes. MiRNA regulates gene expression by binding to the 3' untranslated region (3'UTR) of target mRNA, and participates in various biological processes such as cell proliferation, differentiation, apoptosis and tumorigenesis. In the field of oncology, specific miRNA expression patterns are closely related to the occurrence, development and metastasis of tumors, and are therefore considered potential tumor markers.

[0004] In the study of renal cancer, a series of miRNAs related to the occurrence and development of renal cancer have been discovered, such as miR-21, miR-155, miR-210, etc. The expression levels of these miRNAs in renal cancer tissues are significantly different from those in normal tissues, and are closely related to the clinical characteristics of renal cancer, such as tumor stage, grade, and prognosis. However, there are still some problems and challenges in the current research on renal cancer miRNA markers: First, specificity and sensitivity: Many reported miRNA markers are expressed in renal cancer and other types of cancer and lack sufficient specificity, which limits their application in clinical diagnosis.

[0005] Second, stability and reliability: The stability of miRNA in vivo and the reliability of the extraction process are also important factors affecting its use as a biomarker. The extraction and detection methods of miRNA need to be further optimized to improve its detection accuracy in clinical samples.

[0006] Third, functional mechanism: Although some miRNAs are associated with the occurrence and development of renal cancer, their specific mechanism of action in renal cancer metastasis is still unclear, which limits their application in therapeutic strategies.

[0007] Fourth, clinical application: At present, most studies on miRNA markers are still at the basic research stage and lack large-scale clinical verification. Their clinical application value and feasibility need further evaluation. Summary of the invention

[0008] In view of the prior art, the present invention provides a new renal cancer metastasis-related marker miRNA-12131, and its application in the diagnosis and treatment of renal cancer metastasis.

[0009] The present invention verifies the mechanism of action of miRNA-12131 in renal cancer metastasis through a large number of experiments, and explores the potential application of miRNA-12131 as a diagnosis and treatment of renal cancer metastasis. miRNA-12131 is a miRNA that is specifically highly expressed in renal cancer tissue and is closely related to the metastasis of renal cancer. Through the present invention, it is expected to provide a new molecular tool for early diagnosis, metastasis monitoring and personalized treatment of renal cancer, and it is expected to significantly improve the treatment effect and survival rate of renal cancer patients.

[0010] In order to achieve the purpose of the present invention, the following technical solutions are adopted: The present invention provides a renal cancer metastasis-related marker, characterized in that the renal cancer metastasis-related marker is miRNA-12131 which is significantly overexpressed in renal cancer metastasis tissue, and the nucleotide sequence of miRNA-12131 is shown in SEQ ID NO: 1; the miRNA-12131 is selected from at least one of the following miRNAs: miRNA-12131 initial miRNA, miRNA-12131 precursor miRNA, and mature miRNA-12131; the miRNA-12131 initial miRNA can be cleaved in human cells and express mature miRNA-12131; the miRNA-12131 precursor miRNA can be cleaved in human cells and express mature miRNA-12131.

[0011] The present invention identifies miRNA-12131 as a potential biomarker for renal cancer metastasis through high-throughput sequencing and bioinformatics analysis. The expression level of miRNA-12131 in renal cancer metastatic tissue is significantly higher than that in renal cancer non-metastatic tissue, showing high specificity and sensitivity.

[0012] Furthermore, the present invention provides the use of miRNA-12131, a renal cancer metastasis-related marker, in the preparation of a renal cancer detection reagent.

[0013] The renal cancer detection reagent includes a tailing reverse transcription reagent and a QPCR reaction reagent. The tailing reverse transcription reagent contains a miRNA-12131 reverse transcription specific primer, and the nucleotide sequence of the miRNA-12131 reverse transcription specific primer is shown in SEQ ID NO: 2; the QPCR reaction reagent contains forward and reverse primers and a probe of the marker miRNA-12131, which are used to quantitatively detect the expression level of the marker miRNA-12131 in the sample, the nucleotide sequence of the miRNA-12131 forward primer is shown in SEQ ID NO: 3, the nucleotide sequence of the miRNA-12131 reverse primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the miRNA-12131 probe is shown in SEQ ID NO: 5.

[0014] Furthermore, the present invention provides the use of miRNA-12131, a renal cancer metastasis-related marker, in the preparation of a renal cancer detection kit.

[0015] The above-mentioned tailing reverse transcription reagent and QPCR reaction reagent used for QPCR quantitative detection of the marker miRNA-12131 in the present invention can be placed in a kit for easy detection and use.

[0016] The invention provides a use of the renal cancer metastasis-related marker miRNA-12131 in the preparation of a renal cancer detection kit, characterized in that the kit contains a tailing reverse transcription reagent and a QPCR reaction reagent, wherein the tailing reverse transcription reagent comprises: PolyA polymerase, ATP, dNTPs, reverse transcriptase, miRNA-12131 reverse transcription specific primer and enzyme-free water, wherein the nucleotide sequence of the miRNA-12131 reverse transcription specific primer is as shown in SEQ ID NO: 2; The QPCR reaction reagents include: 10×Buffer, dNTPs, MgCl2, DNA Taq polymerase, enzyme-free water, forward and reverse primers and probes of miRNA-12131 and forward and reverse primers and probes of internal reference genes, wherein the nucleotide sequence of the miRNA-12131 forward primer is shown in SEQ ID NO: 3, the nucleotide sequence of the miRNA-12131 reverse primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the miRNA-12131 probe is shown in SEQ ID NO: 5.

[0017] The QPCR reaction reagent in the kit can detect the expression level of miRNA-12131 in the renal cancer tissue of the subject. The test result is compared with the expression level of miRNA-12131 in the renal cancer tissue without metastasis. If the expression level of the marker miRNA-12131 in the renal cancer tissue is significantly increased, it is judged that the risk of renal cancer metastasis of the subject is high, or metastasis has occurred, or metastasis has recurred.

[0018] Application of miRNA-12131 in predicting the risk of renal cancer metastasis: The risk of renal cancer metastasis can be predicted by quantitatively detecting the expression level of miRNA-12131 in the patient's renal cancer tissue or body fluid samples. This method includes but is not limited to molecular biology techniques such as real-time quantitative PCR (qPCR), Northern blotting, in situ hybridization (ISH) and microarray analysis.

[0019] Application of miRNA-12131 in the diagnosis of renal cancer metastasis: By comparing the expression level of miRNA-12131 in the patient's renal cancer tissue with the expression level in normal kidney tissue or non-metastatic renal cancer tissue, it is possible to determine whether renal cancer has metastasized. This method can be used to assist clinical diagnosis and improve the accuracy of renal cancer metastasis diagnosis.

[0020] Application of miRNA-12131 in monitoring renal cancer metastasis and recurrence: By regularly detecting the expression level of miRNA-12131 in patients' renal cancer tissue or body fluid samples, the recurrence of renal cancer metastasis can be detected in time and can be used to assess the risk of metastasis and recurrence of renal cancer patients after treatment.

[0021] Furthermore, the present invention provides the use of the marker miRNA-12131 in the preparation of a chip for predicting the risk of renal cancer metastasis, diagnosing whether renal cancer metastasis has occurred, and judging whether renal cancer metastasis has recurred, characterized in that the chip includes a solid phase carrier, and an oligonucleotide probe fixed on the solid phase carrier, and the oligonucleotide probe specifically corresponds to part or all of the sequence of the marker miRNA-12131.

[0022] The experiments of the present invention prove that miRNA-1213 is related to the metastasis of renal cancer. On this basis, inhibiting the expression of miRNA-12131 can be used to inhibit the metastasis and invasion of renal cancer or reduce the risk of renal cancer metastasis and invasion. Based on this, the present invention also provides the use of miRNA-12131 inhibitor in the preparation of a drug for inhibiting the metastasis of renal cancer.

[0023] Furthermore, the present invention also provides the use of the marker miRNA-12131 in the preparation of a drug for inhibiting the metastasis of renal cancer, characterized in that the drug contains a miRNA-12131 inhibitor, which can inhibit the expression of miRNA-12131 or inhibit the function of miRNA-12131, thereby inhibiting the metastasis and invasion of renal cancer. The inhibition target of the miRNA-12131 inhibitor is not limited to miRNA-12131 itself, but also includes the upstream and downstream of miRNA-12131, including the genomic sequence encoding miRNA-12131, miRNA-12131 target gene, and protein or gene that regulates miRNA-12131.

[0024] The present invention provides a drug for inhibiting renal cancer metastasis, characterized in that the drug contains a miRNA-12131 inhibitor and a pharmaceutically acceptable carrier. The drug for inhibiting renal cancer metastasis is used to inhibit or prevent renal cancer metastasis and can be administered by injection, oral administration or other administration routes.

[0025] The inhibitor of miRNA-12131 is selected from: siRNA, dsRNA, shRNA, miRNA, antisense nucleotides that can reduce the expression of miRNA-12131; or constructs or small molecule compounds that can express or form siRNA, dsRNA, shRNA, miRNA, antisense nucleotides that can reduce the expression of miRNA-12131.

[0026] The preparation method of the marker miRNA-12131 and the miRNA-12131 inhibitor includes production by chemical synthesis, in vitro transcription or genetic engineering technology.

[0027] The miRNA-12131 marker of the present invention and its application not only provide a new diagnostic method for the diagnosis of renal cancer metastasis at the molecular level, but also provide a new drug target for gene therapy of renal cancer metastasis, which is expected to significantly improve the treatment effect and survival rate of renal cancer patients.

[0028] In summary, the present invention provides a new molecular tool for early diagnosis, treatment monitoring and personalized treatment of renal cancer, which is expected to significantly improve the treatment outcome and survival rate of patients with renal cancer. Through the detection and application of miRNA-12131, the metastasis risk of renal cancer can be more accurately predicted, providing important guidance for clinical treatment, and also providing a new perspective for the study of the mechanism of renal cancer metastasis. The miRNA-12131 marker for renal cancer metastasis diagnosis of the present invention and its application are not only innovative in theory, but also have broad clinical value and market prospects in practical applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The expression of miRNA-12131 in renal cancer tissues was detected by QPCR: Figure 2 Shows the expression of miRNA-12131 in renal cancer cell lines detected by QPCR; Figure 3 Showing the inhibitory effect of anti-miRNA-12131 on miRNA-12131 expression. DETAILED DESCRIPTION

[0030] The present invention is further described below in conjunction with specific examples. The examples of the present invention are only used to explain the present invention and are not intended to limit the protection scope of the present invention.

[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0032] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. The nucleotide sequence table of the present invention is shown in Table 1.

[0033] Table 1 - Nucleotide sequence listing name Sequence (5'—3') SEQ ID NO miR-12131 TTTGGAGAGGTGTACTACTCCCA SEQ ID NO: 1 miR-12131 reverse transcription specific primers CAGTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTVN SEQ ID NO: 2 miR-12131 forward primer TTGGAGAGGTGTACTAC SEQ ID NO: 3 miR-12131 reverse primer CAGTGCAGGGTCCGAGGT SEQ ID NO: 4 miR-12131 probe TGCCCAGGTGGCT SEQ ID NO: 5 Internal reference gene snRNA U6 forward primer CTCGCTTCGGCAGCACA SEQ ID NO: 6 Internal reference gene snRNA U6 reverse primer CAGTGCAGGGTCCGAGGT SEQ ID NO: 7 snRNA U6 probe TGCCCAGGTGGCT SEQ ID NO: 8 anti-miRNA-12131 TCCAGCATCTGCATTTCCTC SEQ ID NO: 9 Example 1 Screening and verification of renal cancer metastasis-related marker miRNA-12131 1. Sample acquisition and total RNA extraction: 1.1 Samples: 30 renal cancer tissues, including 15 renal cancer metastasis samples and 15 renal cancer non-metastasis samples.

[0034] The above samples are surgical resection specimens of patients with renal cancer. These specimens come from Qilu Hospital of Shandong University and Affiliated Hospital of Qingdao University. The acquisition of all the above specimens has been approved by the organization's ethics committee. The clinical data of the 30 renal cancer tissue samples include: gender, age, tumor size, pathological grade, metastasis, recurrence, etc.

[0035] 1.2 Extraction of total RNA from renal cancer tissue Add 1 mL Trizo1 to every 100 mg of renal cancer tissue, and grind the tissue block thoroughly with liquid nitrogen. Add about 1 / 5 volume of chloroform, mix thoroughly by inverting for about 1 minute, and let stand at room temperature for 5 minutes. After centrifugation at 4°C, 12,000 rpm for 15 minutes, carefully transfer the supernatant into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, gently invert and mix, and let stand at room temperature for 10 minutes. After centrifugation at 4°C, 12,000 rpm for 10 minutes, remove the supernatant, add 1 / 2 volume of 70% ethanol to the precipitate, and centrifuge at 4°C, 12,000 rpm to wash the precipitate for 5 minutes. Remove the supernatant, dry the precipitate at room temperature, add an appropriate amount of RNase-free water to fully dissolve it, and measure the OD260 and OD280 values. Use RNase-free DNase I treatment and QIAGEN RNeasy kit to purify total RNA. For detailed operation principles and methods, please refer to the kit instructions. The quality of total RNA was evaluated by agarose gel electrophoresis, and the gel imager was used to observe and photograph the RNA and save the image. It is generally believed that 28S:18S>2 can be used to preliminarily determine that the quality of total RNA is good.

[0036] 2. Extraction and labeling of miRNA 2.1 The miRNA was extracted using the Ambion miRNAs extraction kit. The specific operation was performed according to the corresponding instructions. The sample was labeled with T4 RNA ligase according to the Thomson method. The miRNA labeling method was as follows: 2 μg miRNA and 500 ng 5'-phosphate-cytosine-uracil cy3-3' (Novoprotein, Beijing, China) and 2 units of T4 RNA ligase (Novoprotein, Beijing, China), incubated at 4°C for 2 hours. Each miRNA sample was set with an equal amount of corresponding negative control.

[0037] 2.2 The labeled RNA was precipitated with 0.3 M sodium acetate and 2.5 volumes of ethanol, and then resuspended with 15 μL of hybridization solution containing 3× SSC, 0.2% SDS and 15% formamide. All hybridizations were repeated twice, and LifterSlipTM (Erie, PA USA) was used for hybridization to ensure that the hybridization solution flowed evenly between the chip and the cover slip.

[0038] 2.3 Place the hybridization chamber on the hybridizer BioMixerTMII (CapitalBio Corp, Beijing, China) and hybridize overnight in a 42°C water bath, then wash twice with washing solution.

[0039] 3. miRNA chip operation: 3.1 miRNA chip: The miRNA expression profile chip of Biobio Co., Ltd. was used to detect the miRNA expression profile according to the instructions of the manual.

[0040] 3.2 Analysis of the results of the miRNA chip expression profile showed that there was a significant difference in the expression of miRNA-12131 in renal cancer tissues that had metastasized and renal cancer tissues that had not metastasized. Compared with renal cancer tissues that had not metastasized, the level of miRNA-12131 in renal cancer tissues that had metastasized was significantly increased by about 4 times. The nucleotide sequence of miRNA-12131 is shown in SEQ ID NO: 1.

[0041] 4. QPCR verification of differentially expressed miRNA-12131 4.1 Select miRNA-12131 for large sample QPCR validation based on the detection results of miRNA chip According to the sample collection method in Example 1, 80 samples of renal cancer metastasis tissues and 80 samples of renal cancer tissues without renal cancer metastasis were selected.

[0042] 4.2 The RNA extraction process was the same as in Example 1.

[0043] 4.3 Tailing and reverse transcription The reagents for tailing reverse transcription are as follows: 10×Poly (A) Polymerase Buffer, E. coli Poly (A) Polymerase (5U / μl), ATP (10mM), dNTP Mix (10μM), HiScript Ⅱ Reverse Transcriptase (200U / μL), RNase inhibitor (40μM), miRNA-12131 reverse transcription specific primer (5μM), RNase-freeddH2O; Take 100pg-1μg RNA template and add 2μL 10×Poly (A) Polymerase Buffer, 0.5μL E.coliPoly (A) Polymerase (5U / μl), 1μL ATP (10mM), 1μL dNTP Mix (10μM), 1μL HiScript ⅡReverse Transcriptase (200U / μL), 1μL RNase inhibitor (40μM), 1μL miRNA-12131 reverse transcription specific primer (5μM), and RNase-free ddH2O to 20μL, mix well, and place in a gene amplification instrument for tailing and reverse transcription. The reaction conditions are 42℃, 60min; 85℃, 5min; 4℃, forever.

[0044] 4.4 QPCR reaction: The QPCR reaction reagents prepared in this experiment are as follows: 2×TaqMan miX, forward primer, reverse primer, template cDNA, enzyme-free water. Among them, 2×TaqMan miX includes 10×Buffer, DNA Taq polymerase, MgCl2, dNTPs, miRNA-12131 probe and internal reference gene probe; the forward primer contains miRNA-12131 forward primer and internal reference gene forward primer, and the reverse primer contains miRNA-12131 reverse primer and internal reference gene reverse primer.

[0045] A 20 μL reaction system was used, and 3 parallel tubes were set for each sample. All amplification reactions were repeated three times to ensure the reliability of the results. The following reaction system was prepared: 2×TaqMan miX 10 μL, forward primer (5 μM / mL) 1 μL, reverse primer (5 μM / mL) 1 μL, template cDNA 2.0 μL, enzyme-free water 6 μL. All operations were performed on ice. The amplification program was: 95°C, 10 min (95°C, 20 s; 60°C, 55 s) * 45 cycles. The TaqMan probe was used as a fluorescent marker, and the PCR reaction was performed on an ABI7500 real-time fluorescence quantitative PCR instrument.

[0046] In the above QPCR reaction, snRNA U6 was selected as the internal reference gene.

[0047] The nucleotide sequences of the forward and reverse primers, probe of the marker miRNA-12131, and the forward and reverse primers, probe of the internal reference gene snRNA U6 involved in the above QPCR reaction system are shown in Table 1.

[0048] The marker miRNA-12131 was relatively quantified by amplification curve analysis and the △CT method.

[0049] 4.5 Results Test results such as Figure 1 As shown, compared with renal cancer tissues without metastasis, the expression level of miRNA-12131 in renal cancer tissues with metastasis was significantly increased, which was consistent with the results of miRNA chip screening.

[0050] Based on the renal cancer metastasis-related marker miRNA-12131, the present invention provides an application of the renal cancer metastasis-related marker miRNA-12131 in the preparation of a renal cancer detection reagent, wherein the renal cancer detection reagent comprises a tailing reverse transcription reagent and a QPCR reaction reagent, wherein the tailing reverse transcription reagent contains a miRNA-12131 reverse transcription-specific primer, and the nucleotide sequence of the miRNA-12131 reverse transcription-specific primer is shown in SEQ ID NO: 2; the QPCR reaction reagent contains forward and reverse primers and a probe of the marker miRNA-12131, which are used to quantitatively detect the expression level of the marker miRNA-12131 in a sample, wherein the nucleotide sequence of the miRNA-12131 forward primer is shown in SEQ ID NO: 3, the nucleotide sequence of the miRNA-12131 reverse primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the miRNA-12131 probe is shown in SEQ ID NO: 5.

[0051] The above-mentioned tailing reverse transcription reagent and QPCR reaction reagent used for QPCR quantitative detection of the marker miRNA-12131 in the present invention can be placed in a kit for easy detection and use.

[0052] The QPCR reaction reagent in the kit can detect the expression level of miRNA-12131 in the renal cancer tissue of the subject. The test result is compared with the expression level of miRNA-12131 in the renal cancer tissue without metastasis. If the expression level of the marker miRNA-12131 in the renal cancer tissue is significantly increased, it is judged that the risk of renal cancer metastasis of the subject is high, or metastasis has occurred, or metastasis has recurred.

[0053] Example 2 Expression of miRNA-12131 in renal cancer cell lines 1. Cell culture Renal cancer cell lines 786-O, ACHN, 769-P, and RC-10 were cultured in RPMI1640 medium and 10% fetal bovine serum, and human normal renal epithelial cell line HEK-293 was cultured in DMEM medium and 10% fetal bovine serum in a 37°C, 5% CO2 incubator.

[0054] 2. QPCR 2.1 Extraction of total cell RNA: Total cell RNA was extracted using the RNA extraction kit from QINGEN according to the instructions.

[0055] 2.2 QPCR: The steps are the same as in Example 2.

[0056] 3. Results like Figure 2As shown, compared with the human normal renal epithelial cell line HEK-293, the expression of miRNA-12131 in renal cancer cell lines 786-O, ACHN, 769-P, and RC-10 was significantly increased (P<0.05).

[0057] The experiments in Examples 1-2 indicate that the marker miRNA-12131 provided by the present invention can be used as a miRNA marker for predicting the risk of renal cancer metastasis, diagnosing whether renal cancer metastasis occurs, and determining whether renal cancer metastasis recurs.

[0058] Example 3 Study on the effect of miRNA-12131 on the adhesion ability of renal cancer cells 1. Design and synthesis of antisense oligonucleotides targeting miRNA-12131 (anti-miRNA-12131) The sequence information of miRNA-12131 was found in the miRNA database (https: / / www.ncbi.nlm.nih.gov / gene / ), and anti-miRNA-12131 and random control sequences were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. based on the sequence of miRNA-12131.

[0059] anti-miRNA-12131: 5'-TCCAGCATCTGCATTTCCTC-3', SEQ ID NO: 9; 2. Cell culture: The 786-O culture method is the same as in Example 3.

[0060] 3. Cell transfection 786-O cells were divided into two groups, namely, negative control group (anti-NC inhibitor) and miRNA-12131 inhibition group (anti-miRNA-12131). The negative control group and inhibition group were transfected with anti-NC inhibitor and anti-miRNA-12131, respectively, using the transfection reagent LipofectamineTM 2000 for transfection. The transfection method was referred to the instruction manual. The working concentrations of anti-NC inhibitor and anti-miRNA-12131 were both 5mM. Cells in each group were collected 48h after transfection for subsequent experiments.

[0061] 4. QPCR experiment The steps of total cell RNA extraction and PCR were the same as those in Example 3.

[0062] The results are as follows Figure 3As shown, compared with the negative control group (anti-NC inhibitor), the level of miRNA-12131 in the miRNA-12131 inhibition group (anti-miRNA-12131) was significantly decreased, indicating that anti-miRNA-12131 can effectively inhibit the expression of miRNA-12131.

[0063] 5. Cell Adhesion Assay The 786-O cells transfected for 48 hours were digested with 0.25% trypsin to form a cell suspension. 4 100 μg / mL was inoculated into a 96-well cell culture plate, 0.1 mL per well. After 60 minutes, non-adherent cells were washed away with PBS at 37°C, and the light absorption value of each well at 490 nm was measured by MTT method. The light absorption value represents the relative number of adherent living cells.

[0064] 6. Results The relative optical density of the miRNA-12131 inhibition group (anti-miRNA-12131) was 0.279±0.034, and the relative optical density of the negative control group (anti-NC inhibitor) was 1.514±0.101. Compared with the negative control group (anti-NC inhibitor), the light absorption value of the miRNA-12131 inhibition group (anti-miRNA-12131) decreased significantly (P<0.05). The above experimental results show that anti-miRNA-12131 can significantly inhibit the adhesion ability of 786-O cells, and also indicate that miRNA-12131 is conducive to the adhesion of 786-O cells.

[0065] Example 4 Study on the effect of miRNA-12131 on the migration and invasion ability of renal cancer cells 1. Cell culture is the same as in Example 4 2. Migration experiment 786-O cells transfected for 48 hours were digested with trypsin and counted. 10 cells were placed in a 1.5mL EP tube, and 200μL serum-free medium was added to resuspend the cells. The cells were added to the transwell chamber, and DMEM medium containing 10% fetal bovine serum was added to the lower chamber. The cells were cultured in a 37°C, 5% CO2 incubator for 24 hours. The transwell chamber was taken, the cells inside were wiped with a cotton swab, and the remaining cells were gently washed with PBS. After fixation and staining, 8 random fields of view were taken under a microscope for counting.

[0066] 3. Invasion assay 786-O cells transfected for 48 h were digested with trypsin and counted. 10 5Place cells in a 1.5mL EP tube, add 200mL serum-free medium to resuspend the cells, add them to the transwell chamber covered with matrix gel, add 10% FBS DMEM medium to the lower chamber, and culture in a 37℃, 5% CO2 incubator for 24h. Take the transwell chamber, wipe the cells inside with a cotton swab, and gently wash off the remaining cells with PBS. After fixation and staining, take 8 random fields of view under a microscope for counting.

[0067] 4. Results Migration assay: Compared with the negative control group (anti-NC inhibitor), the number of cells in the miRNA-12131 inhibition group (anti-miRNA-12131) that passed through the basement membrane of the transwell chamber was reduced by 70%.

[0068] Invasion assay: Compared with the negative control group (anti-NC inhibitor), the number of cells in the miRNA-12131 inhibition group (anti-miRNA-12131) that passed through the basement membrane of the transwell chamber that had been covered with matrix gel was reduced by 77%.

[0069] The above experimental results show that anti-miRNA-12131 can significantly inhibit the migration and invasion ability of 786-O cells, and also indicate that miRNA-12131 is beneficial to the migration and invasion of 786-O cells.

[0070] The experiments of Examples 3 to 4 above provide experimental support for the use of the renal cancer marker miRNA-12131 provided by the present invention in the preparation of a drug for inhibiting renal cancer metastasis. The experiments of the present invention prove that miRNA-12131 is related to the metastasis of renal cancer. On this basis, inhibiting the expression of miRNA-12131 can be used to inhibit the metastasis and invasion of renal cancer or reduce the risk of renal cancer metastasis and invasion. Therefore, the drug for inhibiting the metastasis of renal cancer contains a miRNA-12131 inhibitor, which can inhibit the expression of miRNA-12131 or inhibit the function of miRNA-12131, thereby inhibiting the metastasis and invasion of renal cancer. The inhibition target of the miRNA-12131 inhibitor is not limited to miRNA-12131 itself, but also includes the upstream and downstream of miRNA-12131, including the genomic sequence encoding miRNA-12131, the miRNA-12131 target gene, and the protein or gene that regulates miRNA-12131.

[0071] The invention provides a new diagnostic method for clinical diagnosis of renal cancer metastasis at the molecular level, and also provides a new drug target for gene therapy of renal cancer metastasis.

[0072] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. For those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. A renal cancer metastasis-related marker, characterized in that: The renal cancer metastasis-related marker is miRNA-12131, which is significantly overexpressed in renal cancer metastasis tissue. The nucleotide sequence of miRNA-12131 is shown in SEQ ID NO: 1; the miRNA-12131 is selected from at least one of the following miRNAs: miRNA-12131 initial miRNA, miRNA-12131 precursor miRNA, and mature miRNA-12131; the miRNA-12131 initial miRNA can be cleaved in human cells and express mature miRNA-12131; the miRNA-12131 precursor miRNA can be cleaved in human cells and express mature miRNA-12131.

2. Use of the marker miRNA-12131 in the preparation of a renal cancer detection reagent, characterized in that: The renal cancer detection reagent includes a tailing reverse transcription reagent and a QPCR reaction reagent. The tailing reverse transcription reagent contains a miRNA-12131 reverse transcription specific primer, and the nucleotide sequence of the miRNA-12131 reverse transcription specific primer is shown in SEQ ID NO: 2; the QPCR reaction reagent contains forward and reverse primers and a probe of the marker miRNA-12131, which are used to quantitatively detect the expression level of the marker miRNA-12131 in the sample, the nucleotide sequence of the miRNA-12131 forward primer is shown in SEQ ID NO: 3, the nucleotide sequence of the miRNA-12131 reverse primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the miRNA-12131 probe is shown in SEQ ID NO:

5.

3. Use of the marker miRNA-12131 in the preparation of a renal cancer detection kit, characterized in that: The kit contains a tailing reverse transcription reagent and a QPCR reaction reagent, wherein the tailing reverse transcription reagent includes: PolyA polymerase, ATP, dNTPs, reverse transcriptase, miRNA-12131 reverse transcription specific primer and enzyme-free water, wherein the nucleotide sequence of the miRNA-12131 reverse transcription specific primer is shown in SEQ ID NO: 2; the QPCR reaction reagent includes: 10×Buffer, dNTPs, MgCl2, DNA Taq polymerase, enzyme-free water, forward and reverse primers and probes of miRNA-12131 and forward and reverse primers and probes of an internal reference gene, wherein the nucleotide sequence of the miRNA-12131 forward primer is shown in SEQ ID NO: 3, the nucleotide sequence of the miRNA-12131 reverse primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the miRNA-12131 probe is shown in SEQ ID NO:

5.

4. Use of the marker miRNA-12131 in the preparation of a chip for predicting the risk of renal cancer metastasis, diagnosing whether renal cancer metastasis has occurred, and judging whether renal cancer metastasis has recurred, characterized in that: The chip comprises a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier, wherein the oligonucleotide probe specifically corresponds to a part or all of the sequence of the marker miRNA-12131.

5. Use of the marker miRNA-12131 in the preparation of a drug for inhibiting renal cancer metastasis, characterized in that: The drug contains a miRNA-12131 inhibitor, which can inhibit the expression of miRNA-12131 or inhibit the function of miRNA-12131, thereby inhibiting the metastasis and invasion of renal cancer. The inhibition target of the miRNA-12131 inhibitor is not limited to miRNA-12131 itself, but also includes the upstream and downstream of miRNA-12131, including the genomic sequence encoding miRNA-12131, miRNA-12131 target gene, and protein or gene that regulates miRNA-12131.

6. Use of the marker miRNA-12131 according to claim 5 in the preparation of a drug for inhibiting renal cancer metastasis, characterized in that: The inhibitor of miRNA-12131 is selected from: siRNA, dsRNA, shRNA, miRNA, antisense nucleotides that can reduce the expression of miRNA-12131; or constructs or small molecule compounds that can express or form siRNA, dsRNA, shRNA, miRNA, antisense nucleotides that can reduce the expression of miRNA-12131.

7. A drug for inhibiting renal cancer metastasis, characterized in that: The drug contains a miRNA-12131 inhibitor and a pharmaceutically acceptable carrier.

Images