A SNP site and its application

By using the SNP locus at position 11947562 on honeybee chromosome 5 and its KASP primer combination, the inaccuracy of traditional honeybee identification methods has been solved, enabling accurate detection of the B4 trait of wing vein angle and the breeding of high-quality honeybee varieties.

CN119736411BActive Publication Date: 2025-11-25GUIZHOU PROVINCIAL MODERN AGRI DEV RES INST (GUIZHOU PROVINCIAL MODERN RURAL DEV RES CENT GUIZHOU PROVINCIAL RES INST OF RURAL ECONOMIC & SOCIAL DEV GUIZHOU PROVINCIAL AGRI PROD PROCESSING RES INST) +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510023410.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-07
Publication Date
2025-11-25
Estimated Expiration
2045-01-07

AI Technical Summary

Technical Problem

Traditional methods for bee identification and performance evaluation rely on morphological markers, which are easily affected by external interference factors. Furthermore, these methods are complex to operate and make it difficult to efficiently assess the wing vein angle B4 trait, thus affecting bee flight ability and energy consumption.

Method used

Using the SNP locus (polymorphism A/T) located at position 11947562 on chromosome 5 of honeybees and its KASP primer combination, the B4 trait of wing vein angle in honeybees was detected by gene sequencing and PCR amplification, providing a more accurate molecular marker method.

Benefits of technology

It enables precise identification of the B4 trait in bee wing vein angle, which can cultivate bee varieties with high flight efficiency and low energy consumption, thereby improving the efficiency of germplasm resource improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119736411B_ABST
    Figure CN119736411B_ABST
Patent Text Reader

Abstract

The application relates to the field of animal breeding technology, in particular to a SNP site and application thereof. The SNP site is located at the 11947562th position of chromosome 5 of a bee, and the polymorphism is A / T. The application comprises the following steps: i) breeding bees with high flight efficiency or low energy consumption rate; ii) improving the flight efficiency or energy consumption rate of bee germplasm resources; and iii) molecular marker assisted breeding of bees. The application adopts bee sample data, and a SNP site related to the wing vein angle B4 trait of the bee is screened through whole genome association analysis. The detection result of the SNP site can reflect the wing vein angle B4 trait of the bee. The SNP site provided by the application can be applied to breeding bees with specific wing vein angle B4 traits, thereby improving the germplasm resources of the bees and breeding bee varieties with high flight efficiency and low energy consumption rate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of animal breeding technology, and in particular to a SNP locus and its application. Background Technology

[0002] Chinese honeybee ( Apis cerana The Chinese honeybee (also known as the "Chinese honeybee") is a highly adaptable, disease-resistant, and foraging honeybee species that plays a vital role in natural ecosystems, contributing to the maintenance of biodiversity and ecological balance. Beyond its significant role in agricultural production, the Chinese honeybee also offers substantial benefits in ecological protection and economic returns. Improving the germplasm resources of the Chinese honeybee can promote sustainable development and maintain ecological balance.

[0003] Traditional and classic methods for bee species identification and performance evaluation focus on morphological markers. While morphological markers offer advantages such as low cost and ease of operation, they are directly related to the individual development of bees and are easily affected by external interference factors such as nutritional conditions during development. Furthermore, the precise morphological measurement of Chinese honeybees requires strict standards for the accuracy of measuring instruments and the operator's proficiency in morphological anatomy. Moreover, bee morphological measurement is a massive undertaking, making it impractical. The wing vein angle B4 trait is one of the important morphological traits in bees, influencing their flight ability, energy consumption, and pollen collection efficiency to a certain extent. Developing molecular markers related to the wing vein angle B4 trait is beneficial for breeding superior bee species. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides an SNP site and its application.

[0005] In a first aspect, the present invention provides an SNP locus located at position 11947562 on chromosome 5 of a honeybee, with a polymorphism of A / T.

[0006] Furthermore, the SNP site includes a nucleotide sequence as shown in SEQ ID NO.1, with a polymorphism at position 301, the polymorphism being A / T.

[0007] The nucleotide sequence shown in SEQ ID NO.1 is as follows:

[0008] .

[0009] Secondly, the present invention provides a KASP primer combination for amplifying the aforementioned SNP sites; the KASP primer combination comprises:

[0010] F1: TGCTTAAGGCATTCTTATATATTCTTTTTATA,

[0011] F2: TGCTTAAGGCATTCTTATATATTCTTTTTATT,

[0012] R: TCGAAAGAAGCATTTTCGACA.

[0013] The sequences of the primers above are from 5' to 3'.

[0014] Furthermore, F1 and F2 each carry different fluorescent markers, which include one or more of the following: FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC, or Texas Red.

[0015] For example, F1 connects to GAAGGTGACCAAGTTCATGCT (FAM) at 5', and F2 connects to GAAGGTCGGAGTCAACGGATT (HEX) at 5'.

[0016] Thirdly, the present invention provides a kit comprising the aforementioned SNP sites or the aforementioned KASP primer combinations.

[0017] Fourthly, the present invention provides the application of the aforementioned SNP sites, or the aforementioned KASP primer combinations, or the aforementioned kits in identifying the B4 trait of bee wing vein angle.

[0018] The present invention further provides the application of the aforementioned SNP sites, or the aforementioned KASP primer combinations, or the aforementioned kits in any of the following:

[0019] i) Breed bees with high flight efficiency or low energy consumption;

[0020] ii) Improvement of flight efficiency or energy consumption rate of bee germplasm resources;

[0021] iii) Molecular marker-assisted breeding of bees.

[0022] Fifthly, the present invention provides a method for identifying the B4 trait of bee wing vein angle, comprising:

[0023] Using the DNA of the bee to be tested as a template, the polymorphism of the aforementioned SNP sites was detected, and the wing vein angle B4 trait of the bee to be tested was determined based on the detection results.

[0024] Furthermore, polymorphisms at the aforementioned SNP sites can be detected through gene sequencing, specific probes, or PCR amplification.

[0025] Furthermore, the determination of the wing vein angle B4 trait of the bee under test based on the test results includes:

[0026] For the bees to be tested, those with a polymorphism detection result of A / A at the aforementioned SNP sites have a smaller wing vein angle B4 trait compared to those with a detection result of T / T.

[0027] Wing veins are an important morphological indicator for insects. Over long periods of evolution, insects have developed wing veins that adapt to various environmental factors. Well-adapted wing veins require consideration of factors such as weight and structural strength. Current research shows that bees experiencing low-temperature stress, pesticide contamination, or viral infection exhibit severe wing vein mutations, making it difficult for them to survive even after emerging from their cells.

[0028] The present invention has the following beneficial effects:

[0029] This invention, based on genome-wide association studies (GWAS) of bees, identified multiple SNP loci associated with different physiological traits in bees. One of these SNP loci is associated with the B4 wing vein angle trait in bees. The polymorphism of this SNP locus can be used to identify the size of the B4 wing vein angle trait in bees. The SNP loci provided by this invention can also be used for bee germplasm improvement, breeding bee varieties with high flight efficiency and low energy consumption, and has high application value. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0031] Figure 1 This is the statistical and genotyping result of the wing vein angle B4 trait of 106 Chinese honeybee samples provided in Embodiment 2 of the present invention. Detailed Implementation

[0032] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0033] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0034] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0035] Example 1

[0036] This invention identifies a SNP locus associated with the wing vein angle B4 trait through bee trait and genome association analysis, specifically including the following process:

[0037] 1. This invention is based on a sample of 110 colonies of Chinese honeybees, measuring the forewing vein angle B4. After dissection of worker bees, genomic DNA was extracted from their thorax tissue, and library construction was performed using the Trussq Nano DNA HT kit (Illumina, USA). The DNA was randomly fragmented into 350bp fragments, and after end repair, addition of polyA tails, addition of sequencing adapters, amplification, and purification, a DNA library was obtained. The insert size of the library was quality checked using an Agilent 2100, and the effective concentration of the library was accurately quantified using qPCR. Once the quality met the standards, the DNA library construction was completed.

[0038] 2. Genome Sequencing, Alignment, and SNP Identification: After successful library construction, genome sequencing was performed on the Illumina Hiseq PE150 platform (Illumina, USA). Low-quality reads were removed during sequencing to ensure result quality (quality control standards: reads containing more than 10% unknown nucleotides, reads containing adapter sequences, and reads with low-quality (phred quality < 5) bases exceeding 50% of their length were removed). Finally, each bee sample generated over 4.5G of high-quality, clean reads with paired ends, with Q20 and Q30 values ​​exceeding 90% and 85%, respectively.

[0039] 3. The high-quality paired-end clean reads obtained were aligned to the reference genome using BWA 0.7.8 software. Apis cerana (Genbank accession number: PRJNA738447). The alignment results were deduplicated using SAMTOOLS 1.15 software, and the average alignment rate of the population samples was guaranteed to be above 95%, with an average sequencing depth of over 20X for the genome.

[0040] 4. SNPs were detected using a Bayesian model in SAMTOOLS 1.15 software. High-quality SNPs were selected based on quality control criteria (deleting SNPs with a sequencing error rate >1% (Q20 quality control), deleting SNPs with a gap of <5 bases between adjacent SNP sites, and deleting SNPs with a coverage depth exceeding 1 / 3 to 5 times the average depth). The detected SNPs were annotated using ANNOVAR 20130520 software, identifying exon regions, intron regions, alternative splicing sites, upstream and downstream gene regions, and intergenic regions, and distinguishing between synonymous and non-synonymous SNPs.

[0041] 5. Genome-wide association studies (GWAS): Genome-wide association studies (GWAS) were conducted using mrMLM 1.3 software to clarify the association between the wing vein angle B4 trait and SNP loci. The quality control standard for SNPs was based on MAF > 5%, and a multi-locus randomized mixed linear model was selected.

[0042] Table 1. Association between the B4 phenotype of bee wing vein angle and SNPs

[0043]

[0044] Based on the above method and process, this invention screened out several SNP sites related to the physical and chemical traits of bees (wing vein angle B4) (as shown in Table 1). After verification, one of the SNP sites was found to be closely related to the wing vein angle B4 of bees. This SNP site (Chr5_11947562) is located at position 11947562 on bee chromosome 5 and has a polymorphism of A / T.

[0045] Example 2

[0046] 1. This invention selected 106 samples of Chinese honeybees to conduct verification work, and verified the effect of the SNP sites involved in Example 1. Specifically, whole genome sequencing and wing vein angle B4 measurement were performed on these 106 Chinese honeybees to obtain wing vein angle B4 data and SNP data of 106 bees.

[0047] Based on the genotyping at SNP loci, the data were grouped, and SPSS 16.0 software was used to perform a significance analysis on the wing vein angle B4 data of different groups to determine whether there were differences in wing vein angle B4 among different genotypes.

[0048] The combined measurement and sequencing results showed that 27 honeybees exhibited the A / A genotype, 51 exhibited the A / T genotype, and 28 exhibited the T / T genotype. LSD and Duncan data analysis yielded the following table and... Figure 1 The results shown are from Figure 1 The results show that the A / A genotype and the T / T genotype exhibit significant differences. P <0.05), the wing vein angle B4 trait in A / A genotype bees was significantly smaller than that in T / T genotype bees. Tables 2 and 3 also show that genotype 1 (A / A) has a smaller wing vein angle B4 trait than genotype 2 (T / T) (the difference is negative), and this difference is significant. P <0.05, which is significant.

[0049] Table 2. Comparison of wing vein angle B4 among individuals with different genotypes at the Chr5_11947562 locus in Apis cerana.

[0050]

[0051] * express P <0.05, the difference is significant.

[0052] Table 3. Comparison of wing vein angle B4 among individuals with different genotypes at the Chr5_11947562 locus in Apis cerana.

[0053]

[0054] Therefore, this invention can use a sequencing method similar to that described above to detect the polymorphism at position 11,947,562 of honeybee chromosome 5. The results show that honeybees with the A / A genotype tend to exhibit a smaller wing vein angle B4 trait compared to honeybees with the T / T genotype. Since the wing vein angle B4 trait is related to the flight efficiency and energy consumption efficiency of honeybees, this SNP locus can be used to breed honeybee varieties with high flight efficiency and low energy consumption efficiency.

[0055] 2. This invention further develops a KASP primer combination for detecting this SNP site, comprising:

[0056] F1: GAAGGTGACCAAGTTCATGCTtgcttgaaggcattcttatatattctttttatA,

[0057] F2:GAAGGTCGGAGTCAACGGATTtgcttgaaggcattcttatatattctttttatT,

[0058] R: TCGAAAGAAGCATTTTCGACA.

[0059] F1 carries FAM and F2 carries HEX. In practice, this KASP primer combination can be used to detect the sample to be tested. At the same time, it can be detected by existing fluorescence equipment. The genotype of the sample to be tested can be determined by the detection results of the FAM and HEX fluorescence channels: T / T (HEX fluorescence signal exceeds the threshold), A / T (both FAM and HEX fluorescence signals exceed the threshold), or A / A (FAM fluorescence signal exceeds the threshold).

[0060] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of SNP molecular markers, or KASP primer combinations, or kits in identifying the B4 trait of wing vein angle in Honeybee; The SNP molecular marker is a nucleotide sequence as shown in SEQ ID NO.1, with a polymorphism at position 301, which is A / T. The KASP primer combination is used to amplify the SNP molecular marker; The KASP primer combination includes: F1: TGCTTAAGGCATTCTTATATATTCTTTTTATA, F2: TGCTTAAGGCATTCTTATATATTCTTTTTATT, R: TCGAAAGAAGCATTTTCGACA; The kit includes the KASP primer combination.

2. A method for identifying the B4 trait of the wing vein angle in honeybees, characterized in that, include: Using the DNA of the bee to be tested as a template, the polymorphism of the SNP molecular markers mentioned in the application as described in claim 1 is detected, and the wing vein angle B4 trait of the bee to be tested is determined based on the detection results; The determination of the B4 wing vein angle trait of the bee under test based on the test results includes: For the bees to be tested, those with a polymorphism detection result of A / A for the SNP molecular markers mentioned in the application as described in claim 1 have a smaller wing vein angle B4 trait compared to those with a detection result of T / T.

3. The method according to claim 2, characterized in that, The polymorphism of the SNP molecular markers described in the application as claimed in claim 1 is detected by gene sequencing, specific probes, or PCR amplification.

Citation Information

Patent Citations

  • SNP marker for identifying variety of Chinese bees in Changbai Mountain and identification

    CN113186297A

  • SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in improving bee germplasm resources

    CN119144731A