Taqman probe method fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting cat babesia as well as detection method and application thereof

Abstract

The invention discloses a Taqman probe method fluorescent quantitative PCR kit for detecting cat babesia as well as a detection method and application thereof, the kit comprises a forward primer, a reverse primer and a probe for detecting cat babesia, the sequence of the forward primer is as shown in SEQ ID NO.1, the sequence of the reverse primer is as shown in SEQ ID NO.2, and the sequence of the probe is as shown in SEQ ID NO.3; the kit further comprises a positive control, Premix Taq and ddH2O, the positive control is a recombinant plasmid, and the sequence of the positive control is as shown in SEQ ID NO.4. The method disclosed by the invention is simple, convenient and rapid to operate, and has the advantages of high sensitivity, strong specificity, good repeatability and low detection limit when being used for detecting pathogens in a cat blood sample.

Description

Technical Field

[0001] The invention relates to the technical field of biomedicine, and in particular to a Taqman probe method fluorescent quantitative PCR kit for detecting Babesia felis, and a detection method and application thereof. Background Art

[0002] Babesia felis (B.felis) belongs to the phylum Apicomplexa, class Aconoidasida, order Piroplasmida, family Babesiidae, genus Babesia. Babesia, also known as pear plasm, is a single-celled protozoan parasitic on red blood cells. It can be transmitted by ticks or ibex mosquitoes, or by direct contact or vertical transmission to infect the host. In 1888, Romanian scholar Babes first discovered Babesia bigemina from bovine red blood cells. More than 100 species of Babesia have been identified, such as B.motasi and B.major, which are common in ruminants such as cattle, sheep, and horses.

[0003] Babesia is more susceptible to young animals and often causes parasitemia in infected animals. Clinical manifestations are often lethargy, loss of appetite, itching at the wound, sometimes accompanied by anemia and jaundice, blood in the stool, yellowing of the skin, gums, conjunctiva, etc., which may be fatal in severe cases. Clinically, it is often misdiagnosed due to mild symptoms. At present, the diagnosis of Babesia is mainly through blood smear morphological detection and serological detection. Babesia has various forms in red blood cells, such as pear-shaped and ring-shaped. It is common to have multiple worms in the same cell, forming triplets or quadruplets. Conventional blood smear microscopy can show blue cytoplasm, red nucleus and worm bodies, but this method is complicated and cannot specifically identify Babesia species. Studies have shown that colloidal gold serological detection can be used for the detection of canine Babesia, but serological detection methods for cat Babesia have not yet been developed, there is a lack of commercial reagents, and because the production of antibodies is time-dependent, it cannot achieve the purpose of early diagnosis.

[0004] In 2007, Bosman et al. used samples of B.felis serologically positive animals in South Africa as controls, designed primers and probes based on the V4 variable region of the 18S rRNA gene of B.felis, and detected one case of B.felis infection in 43 samples of felines (domestic cats and lions) by reverse linear transfer technology. However, this technology requires the observation of probe binding after PCR amplification and the determination of the results by transfer technology, which takes a long time in clinical testing. In 2018, Khan et al. designed primers based on the 18S rRNA of B.felis and established a common PCR detection method to detect 100 sick cat samples in Pakistan. The results showed that the B.felis infection rate measured by PCR reached 16%, while the detection rate of ordinary blood smear microscopy was only 6%. PCR showed better sensitivity than ordinary microscopy. However, ordinary PCR needs to be combined with agarose electrophoresis staining to determine the infection result, and the determination of positive samples with low copy numbers is susceptible to subjectivity.

[0005] Investigations have shown that multiple species of Babesia can be transmitted from sick animals to humans and pose a risk of zoonosis. Common species such as Babesia microti, Babesia divergens, and Babesia venatorum are widely prevalent in Japan, South Korea, India, and China. B.felis was first reported in South Africa and has become prevalent in Southeast Asian countries such as India and Pakistan. In addition, multiple cases of infection of domestic cats with different Babesia species have been reported in Europe and the United States. With the further increase in the number of domestic pet cats and the popularity of international travel, the risk of domestic cats contracting B.felis has further increased. Although there is currently no evidence that B.felis is zoonotic, its potential risk has an important impact on China's domestic cat population and its large base of pet owners.

[0006] At present, there is no effective vaccine and detection kit for Babesia felis. Primaquine phosphate is commonly used to treat Babesia felis infection in cats, and early infection is more likely to be cured. If it is misdiagnosed or treated at a late stage, it often presents subclinical manifestations and can still be infectious as a carrier. Based on the above background, the present invention proposes a Taqman PCR method based on the 18S rRNA gene sequence of B. felis to design primers for detecting feline Babesia felis. This method has the advantages of being rapid, sensitive, specific and economical, and can simplify the detection steps, save time and cost, reduce the risk of environmental pollution, and achieve high-throughput early detection of B. felis. Summary of the invention

[0007] The main technical problem solved by the present invention is to provide a Taqman probe method fluorescence quantitative kit for detecting feline Babesia felis and a detection method and application thereof. The detection method of the present invention has the advantages of high sensitivity, strong specificity, good repeatability and low detection limit.

[0008] In order to solve the above technical problems, a technical solution adopted by the present invention is: providing a PCR kit for detecting feline Babesia felis, the kit comprising a forward primer, a reverse primer and a probe for detecting feline Babesia felis, wherein the sequence of the forward primer is shown in SEQ ID NO.1, the sequence of the reverse primer is shown in SEQ ID NO.2, and the sequence of the probe is shown in SEQ ID NO.3.

[0009] Furthermore, the kit includes a positive control, which is a recombinant plasmid.

[0010] Furthermore, the sequence of the recombinant plasmid is shown in SEQ ID NO.4.

[0011] Furthermore, the kit also includes 2×Premix Ex Taq TM and ddH2O.

[0012] The invention discloses a PCR reaction system for detecting feline Babesia felis, wherein the reaction system comprises a DNA template, the forward primer, the reverse primer and the probe, and the 2×Premix Ex Taq TM and dd H2O.

[0013] Furthermore, the volume of the DNA template is 5 μL; the concentration of the forward primer and the reverse primer are both 10 μM and the volume is 0.2 μL; the concentration of the probe is 20 μM and the volume is 0.2 μL; the 2×Premix Ex Taq TM The volume of dH2O was 10 μL and the volume of dd H2O was 4.4 μL.

[0014] The present invention discloses a detection method of the above kit, and the specific steps are as follows:

[0015] S1: Collect and extract DNA from samples;

[0016] S2: prepare the above reaction system as the sample to be tested;

[0017] S3: Perform fluorescence quantitative PCR reaction.

[0018] Furthermore, the PCR reaction in S3 includes pre-denaturation at 95°C for 30s; denaturation at 95°C for 5s; annealing and extension at 55°C for 31s; and 40 cycles.

[0019] The invention also discloses the application of the kit in detecting pathogens in cat blood samples.

[0020] The beneficial effects of the present invention are:

[0021] (1) The method of the present invention is simple, convenient and fast to operate, has little limitation in primer design, makes data analysis simpler and more intuitive, and the entire experimental process can be completed within 2 hours;

[0022] (2) The method of the present invention has high sensitivity, strong specificity, and good repeatability. The detection limit is as low as 290.2 copies / reaction, and the probe method only binds to the target sequence, which significantly improves the sensitivity and specificity. The real-time monitoring of fluorescence data avoids agarose gel electrophoresis and contamination, ensuring the reliability and accuracy of the experimental results. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is the amplification curve diagram of the specificity experiment;

[0024] Figure 2 It is the amplification curve diagram of the sensitivity experiment;

[0025] Figure 3 This is the standard curve diagram for sensitivity experiments;

[0026] Figure 4 The specificity and sensitivity of the electrophoresis detection results are shown in Figure 1, where (a) is the electrophoresis result of the B.felis recombinant plasmid qPCR (quantitative Polymerase Chain Reaction) product, in which: 1: 100 bp DNA template, 2 and 12: blank control NTC (No template control), 3-11: B.felis recombinant plasmid 10 -12 -10 -3 (b) is the electrophoresis result of specific sample qPCR product, in which: 1: 100 bp DNA template, 2: B.felis recombinant plasmid 10 -5 , 3: Mycoplasma felis, 4: Leptospira, 5: Plasmodium, 6: Listeria monocytogenes, 7: Pseudomonas aeruginosa; 8: 100 bp DNA template;

[0027] Figure 5 This is the NCBI Blast comparison result of the B.felis positive control recombinant plasmid qPCR product;

[0028] Figure 6 This is the test amplification result diagram of 20 whole blood samples;

[0029] Figure 7 The figure shows the amplification results of 7 samples. DETAILED DESCRIPTION

[0030] The preferred embodiments of the present invention are described in detail below so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more definite definition of the protection scope of the present invention.

[0031] Example 1 Design and synthesis of primers and probes

[0032] According to the 18s rRNA gene sequence published in NCBI GenBank: AY452703.1, primers and probes for Babesia felis were designed and optimized using Primer3 primer design software. The optimized primer sequences and probe sequences are shown in Table 1. Both primers and probes were synthesized by Suzhou Hongxun Biotechnology Co., Ltd.

[0033] Table 1. Primer and probe sequences for Babesia felis

[0034] name Sequence 5'-3' SEQ ID NO Forward primer CGTGATGGGGATAGATTATTGCA 1 Reverse primer TCTCAGTCCGAATAATTCACCG 2 Probe Cy5-CTACGTCCCTGCCCTTTGTA-BHQ3 3

[0035] The 3' end of the nucleotide sequence of the probe is labeled with a BHQ3 fluorescent quencher group, and the 5' end is labeled with a Cy5 fluorescent reporter group. It should be noted that those skilled in the art can also use other common fluorescent quenchers and fluorescent reporter groups in the art to replace "BHQ3" and "Cy5" herein, all of which fall within the scope of protection claimed in the present invention.

[0036] Example 2 Method of using the kit

[0037] S1: Collect and extract DNA from samples

[0038] Depending on the sample type, different kits are used to extract nucleic acid.

[0039] S2: The reaction system is used as the sample to be tested

[0040] The total reaction volume was 20 μL, containing 2×Premix Ex Taq TM (Takara, Japan RR390A) 10 μL, forward primer and reverse primer mixture (concentration of 10 μM each) 0.2 μL, probe (concentration of 20 μM) 0.2 μL, 5 μL DNA template, 4.4 μL dd H 2 O. In a PCR instrument (BIO-RAD, USA CFX96 Maestro Real Time PCR System), pre-denaturation at 95°C for 30 s, denaturation at 95°C for 5 s, annealing and extension at 55°C for 31 s, signal acquisition, and 40 cycles were performed.

[0041] S3: Perform fluorescence quantitative PCR reaction

[0042] After amplifying the entire system, read the cycle number Cq value and amplification curve to determine the test results.

[0043] Result judgment:

[0044] When there is an amplification curve and the Cq value is ≤35.0, it is judged as B. felis positive.

[0045] If the Cq value is between 35-40, it is considered suspicious and it is recommended to repeat the experiment and repeat the test wells. If the results are similar, it is recommended to resample and test or re-extract the sample for testing. If the Cq value is still between 35-40, it is judged to be positive, otherwise it is judged to be B. felis negative.

[0046] When there is no amplification curve, the Cq value shows NaN, which is judged as B. felis negative.

[0047] It is expected that the blank control (NTC) has no amplification curve and no Cq value.

[0048] If there is no amplification curve and no Cq value in the positive control, the experiment is invalid and the sample needs to be retested.

[0049] Example 3 Specificity Experiment

[0050] The B. felis primers and probes designed and synthesized in Example 1 were used to detect the genomic DNA of four bacteria and one pathogenic parasite, and the B. felis synthetic plasmid was used as a positive control to test the specificity of this method.

[0051] (1) Specific samples

[0052] Mycoplasma felis (M.felis), Leptospira spp. (L.spp), Plasmodium spp. (P.spp), Listeria monocytogenes (L.monocytogens), Pseudomonas aeruginosa (P.aeruginosa). The above samples selected for specific testing are all stored in our company's laboratory. The above samples are pathogens that are easily mixed with B.felis infection, or pathogens that can produce symptoms similar to B.felis.

[0053] (2) DNA extraction

[0054] Different kits were used to extract nucleic acids according to the sample type. All specific samples were extracted with the Bacterial Genomic DNA Extraction Kit (Tiangen, China DP302). The operation was carried out according to the instructions of the kit, and the DNA was eluted with TE and stored at -20℃ for later use.

[0055] Using genomic DNA of five species, M.felis, L.spp, P.spp, L.monocytogens, and P.aeruginosa, as templates, the B.felis primers and probes of the present invention were used to detect nucleic acids by a fluorescent quantitative PCR method to verify the specificity of the method. The results are shown in Table 1. As can be seen from Table 1, the PCR primers of the present invention have good specificity for B.felis, and no positive results were found in nucleic acid detection of other pathogens. The amplification curve is Figure 1 .

[0056] Table 1. Samples for B.felis PCR-specific detection

[0057]

[0058] Note: P: positive; N: negative

[0059] Example 4 Sensitivity Detection

[0060] Sensitivity testing is essential to ensure the reliability and validity of qPCR assays in a variety of diagnostic, research, and clinical settings. In qPCR, sensitivity determination involves evaluating the ability of an assay to detect low levels of a target nucleic acid. This is done by analyzing serial dilutions of the target nucleic acid or plasmid to determine the lowest concentration that the assay can still reliably detect.

[0061] In the present invention, the recombinant plasmid synthesized by PCR amplification of the target fragment was used as a positive control, and a 10-fold gradient dilution was made into 10 -3 -10 -12 , 3 replicate wells were set for each dilution, and 2 negative controls (NTC) were used at the same time. Synthetic positive control refers to cloning the artificially synthesized conserved gene sequence into the pUC57 vector, then transforming it into Escherichia coli (DH5α), and extracting and purifying the plasmid with a plasmid extraction kit after shaking the bacteria for proliferation. The concentration was measured with a spectrophotometer, and the concentration of the positive control plasmid was diluted to 1.2×10 13 The gene synthesis and construction of the recombinant plasmid were completed by Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, Jiangsu, China). The synthetic sequence of the recombinant plasmid is shown in SEQ ID NO.4: CGT GATGGGGATAGATTATTGCA ATTATTAATCTTGAACGAGGAATGCCTAGTAGGCACGAGTCATCAGCTCGTGCCGA C TACGTCCCTGCCCTTTGTA CACACCGCCCGTCGCTCCTACCGATCGAGTGATC CGGTGAATTATTCGGACTGAGA

[0062] Determine the concentration of the extracted plasmid and calculate the number of copies per microliter of plasmid. -3 -10 -12 There are 10 concentrations in total, each containing 5.8×10 7 , 5.8×10 6 , 5.8×10 5 , 5.8×10 4 , 5.8×10 3 , 5.8×10 2 , 5.8×10 1 , 5.8×10 0 , 5.8×10 -1 , 5.8×10 -2 The copy number was calculated, and the PCR amplification efficiency E was 92.8% (acceptable range 90% to 110%), and the correlation coefficient value R 2 =1.00 (acceptable range is 0.98 to 1), the slope is -3.509, and the regression equation is Y = -3.509X + 42.094 (Table 2: B. felis recombinant plasmid sensitivity data, Figure 2 : Amplification curve diagram; Figure 3 :Linear regression graph). Three replicate wells were made for each dilution. The results showed that the concentration of the standard was 5.8×10 2 copies / reaction and 5.8×10 7 There is a good linear relationship in the copy / reaction range and the method has good sensitivity.

[0063] Table 2B. Felis recombinant plasmid sensitivity test results

[0064]

[0065]

[0066] Note: P: positive; N: negative; I: suspected.

[0067] Example 5 Repeatability and Limit of Detection (LOD) Test

[0068] In qPCR, repeatability evaluates the consistency and precision of test results when the experiment is performed multiple times under the same conditions. This evaluation measures the variation of repeated results when the same person uses different instruments on different days or different people use the same instrument on the same day under the same sample and reagent conditions. High repeatability means consistent and reproducible results, which is essential for reliable data interpretation and drawing scientific conclusions.

[0069] In qPCR, the limit of detection (LOD) represents the confidence level of the minimum amount of nucleic acid template that can be detected. It is experimentally determined to reflect the sensitivity of the assay, with a low LOD indicating a high sensitivity for the lowest sample concentration. LOD is critical for assessing the reliability of qPCR assays, especially in applications that require detection of low concentrations of targets, such as clinical diagnostics and scientific research applications.

[0070] The LOD was established by a sensitivity assay, where the lowest dilution corresponding to a positive Cq value was identified. In the present invention, the lowest dilution for which the Cq value of the B. felis synthetic plasmid was positive was 10 -8 (Table 2). Then 10 -8 The dilutions were further diluted to lower concentrations to test their reproducibility. The dilutions of the synthetic plasmids at the lowest concentrations mentioned above were tested for reproducibility to assess the precision, accuracy, and reproducibility of the results.

[0071] 10 -8 After two-fold serial dilution of the plasmid, 2.9 × 10 2 The recombinant plasmid of the copy / reaction was tested in 20 duplicate wells, and the experiment was repeated three times in parallel to test the accuracy and stability of the method of the present invention. The synthetic plasmid (Table 3) can be detected in each of the three PCR repeated tests, and the standard deviation of the Cq value of the three tests remains consistent (synthetic plasmid SD = 0.363 ± 0.087), the coefficient of variation CV value is less than 1.5% (acceptable value is less than 15%), and the 95% confidence interval (CI) is 0.170 ± 0.040, indicating that the method has good reproducibility and high stability, and the detection limit of the synthetic plasmid test method is 290.2 copies / reaction.

[0072] Table 3B. Felis recombinant plasmid repeatability test results

[0073]

[0074]

[0075] Example 6 Confirmation of specificity and sensitivity by electrophoresis of qPCR products

[0076] The qPCR products of the B.felis positive control recombinant plasmid and the qPCR products of the five specific samples, namely, M.felis, L.spp, P.spp, L.monocytogens, and P.aeruginosa, were taken respectively, and 100 bp DNA template was used as a reference, and 1.5% gel electrophoresis was performed. After electrophoresis at a voltage of 120 V for about 45 minutes, the photos were taken under ultraviolet light.

[0077] Results Figure 4 ,like Figure 4 As shown in a, the B. felis positive control recombinant plasmid was expressed at 10 -12 to 10 -3 , as the concentration increases, the band becomes thicker; Figure 4 As shown in b, B. felis positive control recombinant plasmid 10 -5 The product was approximately 155 bp, which was consistent with expectations. The specific sample had no band at the target size position, indicating that this method had good specificity.

[0078] In order to verify the results of electrophoresis, the qPCR amplification products were sequenced by Sanger sequencing, and the qPCR products of the B.felis positive control plasmid were sequenced and compared with NCBI Blast. The sequencing results are as follows: B.felis positive plasmid:

[0079] ATAGCGATGCTGTAGAGGATGCCTAGTAGGCACGAGTCATCAGCTCGTGCC

[0080] GACTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCCTACCGATCGAG

[0081] TGATCCGGTGAATTATTCGGACTGAGAAGNCBI Blast alignment results can be found in Figure 5 .

[0082] Based on the above results, it was finally confirmed that the minimum detection limit of the Taqman probe qPCR method for detecting B. felis synthetic plasmid as a positive control was 290.2 copies / reaction. The present invention established a Taqman probe-based qPCR method for specific detection of B. felis, optimizing the sensitivity, specificity and minimum detection limit.

[0083] Example 7 Application of the method of the present invention in actual detection

[0084] In order to verify the practicality of the present invention, a total of 20 whole blood samples were collected and nucleic acid was extracted using the LGC DNA extraction kit (LGC, China) according to the instructions. Before whole blood extraction, invert and mix well. Take 0.2 ml of whole blood for each sample, lyse the red blood cells with red blood cell lysis buffer, centrifuge at 12000rpm for 5min, aspirate the supernatant, keep about 100μL supernatant to resuspend the white blood cell pellet, repeat the lysis once, and then use the LGC kit to extract nucleic acid, and elute the DNA in 100μL buffer. The LGCDNA extraction kit (LGC, China) was used for clinical blood samples, and nucleic acid was extracted according to the instructions. The extracted nucleic acid was simultaneously detected using the qPCR method of the present invention, and the reaction system and reaction procedure were consistent with the above invention content. The test results are shown in Table 4 below. There were numerical values ​​in 5 samples, but they were all higher than LOD, and the other 15 samples were all negative. Figure 6 The figure shows the detection amplification results of 20 whole blood samples.

[0085] The 5 suspicious samples detected initially, plus 2 negative samples, a total of 7 samples were retested, and the nucleic acids extracted twice were marked as 0930 and 1008, respectively, and the qPCR method of the present invention was used for simultaneous detection. The reaction system and reaction procedure were consistent with the above invention content, and each sample was tested in 3 replicate wells. The test results are shown in Table 5 below. 6 samples appeared randomly (only 1 of the 3 wells had a value), and they were all higher than the LOD, so they were all judged to be negative. Figure 7 The figure shows the amplification results of 7 samples.

[0086] Table 4. Test results of B.felis samples

[0087]

[0088]

[0089] Table 5. Retest results of B.felis samples

[0090]

[0091] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A Taqman probe method fluorescent quantitative PCR kit for detecting feline Babesia felis, characterized in that: The kit comprises a forward primer, a reverse primer and a probe for detecting Babesia felis, wherein the sequence of the forward primer is shown as SEQ ID NO.1, the sequence of the reverse primer is shown as SEQ ID NO.2, and the sequence of the probe is shown as SEQ ID NO.

3.

2. The kit according to claim 1, characterized in that The kit includes a positive control, which is a recombinant plasmid.

3. The kit according to claim 2, characterized in that The sequence of the recombinant plasmid is shown in SEQ ID NO.

4.

4. The kit according to claim 2, characterized in that The kit also includes 2×Premix Ex Taq TM and ddH2O.

5. A PCR reaction system for detecting Babesia felis, characterized in that: The reaction system comprises a DNA template, the forward primer, the reverse primer and the probe according to claim 1, and the 2×Premix Ex Taq TM and ddH2O.

6. The PCR reaction system according to claim 5, characterized in that: The volume of the DNA template is 5 μL; the concentration of the forward primer and the reverse primer are both 10 μM and the volume is 0.2 μL; the concentration of the probe is 20 μM and the volume is 0.2 μL; the 2×Premix Ex Taq TM The volume of dH2O was 10 μL and the volume of dd H2O was 4.4 μL.

7. A detection method of the kit according to any one of claims 1 to 4, characterized in that: The specific steps are as follows: S1: Collect and extract DNA from samples; S2: preparing the reaction system according to any one of claims 5 to 6 as a sample to be tested; S3: Perform fluorescence quantitative PCR reaction.

8. The detection method according to claim 7, characterized in that The PCR reaction in S3 includes pre-denaturation at 95° C. for 30 s; denaturation at 95° C. for 5 s; annealing and extension at 55° C. for 31 s; and 40 cycles.

9. Use of the kit according to any one of claims 1 to 4 in detecting pathogens in cat blood samples.

Images