Amplification primer of KASP marker on D03 chromosome for cotton high lint percentage variety breeding

Abstract

The invention discloses an amplification primer of a KASP marker on a D03 chromosome for cotton high lint breed breeding, which comprises a forward primer F1 with an FAM fluorescent marker, a reverse primer F2 with an FAM fluorescent marker, a reverse primer F2 with an FAM fluorescent marker, a reverse primer F2 with an FAM fluorescent marker, and a reverse primer F2 with an FAM fluorescent marker, the sequence of the forward primer F2 is shown as SEQ ID No. 2; and the sequence of the reverse primer is shown as SEQ ID No.3. The method can effectively distinguish genotypes with obvious lint content difference, and provides a useful tool for molecular marker-assisted selection in cotton breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular assisted selection, and particularly relates to an amplification primer of a KASP marker on D03 chromosome for high lint content cotton variety selection. BACKGROUND

[0002] Cotton is one of the most important economic crops in the world, and Gossypium hirsutum L. is the main cultivated species, accounting for more than 90% of natural raw materials (fiber) for the global textile industry. Improving cotton fiber yield has always been an important issue for cotton breeders. Among the factors constituting cotton yield, lint percentage (LP) reflects the proportion of lint in seed cotton and is a key indicator of fiber yield. Therefore, improving lint percentage is an effective strategy to increase cotton yield without expanding planting area.

[0003] Cotton fiber originates from a single-cell epidermal hair highly elongated on the ovule surface. Fiber development undergoes four different but continuous stages: initiation, elongation, secondary cell wall thickening, and maturation. Fiber initiation occurs 2 days before anthesis (DPA), during which specific epidermal cells begin to differentiate and protrude outward. The time of fiber protrusion determines the cell fate: early-formed protrusions develop into long fibers (lint), and late-formed protrusions develop into short fibers (fuzz). Notably, fiber density on the day of anthesis (0 DPA) is positively correlated with lint percentage, and auxin accumulation in fiber cells also begins at this stage. Therefore, 0 DPA is a critical developmental period that affects fiber initiation efficiency and ultimately determines lint percentage.

[0004] Lint percentage, as a complex quantitative trait, is influenced by multiple genetic factors and environmental regulation, and major loci can explain about 60%-70% of phenotypic variation. Over the past few decades, through genetic mapping studies of both parent-offspring groups and natural populations, more than 1,400 QTLs associated with lint percentage have been identified on all 26 chromosomes of cotton, of which more than 60 are considered stable major QTLs. For example, Liu et al. (2023) used a recombinant inbred line population constructed from two short-season cotton varieties 'Dong 3' and 'Dong 4' to identify 3 stable QTLs and 28 candidate genes associated with lint percentage; although they confirmed the differential expression of these candidate genes, they did not further functionally validate them through additional biological experiments. Similarly, Chen et al. (2022) used 254 landraces and 41,413 high-quality single nucleotide polymorphisms (SNPs) to construct a genome-wide association study (GWAS) and identified 22 stable QTLs significantly associated with lint percentage in multiple environments; in addition, weighted gene co-expression network analysis (WGCNA) found significant correlation in the expression of Gh_D07G0463 and Gh_D01G0162, but this study did not develop molecular markers that could be directly used for breeding.

[0005] These studies greatly expand the scope of lint-related loci, but most QTLs are identified using low-density molecular markers such as SSR (simple sequence repeat), resulting in wide confidence intervals and making it difficult to accurately locate candidate genes. Therefore, high-resolution mapping and integrated omics methods have become necessary means to analyze the genetic structure of lint and achieve gene-level positioning.

[0006] On the basis of these QTL studies, a number of functional genes related to lint and fiber initiation have been identified in recent years, revealing the complex molecular mechanisms behind this trait. For example, the UGT71C4 gene, which encodes UDP-glucose glycosyltransferase, regulates seed size and thus lint by affecting lignin and flavonoid metabolic pathways; the transcription factor GaHD1 mediates the early signaling cascade of H2O2 and Ca 2 ⁺ in the fiber initiation process and is an upstream regulator of epidermal hair differentiation. In addition, transcriptional regulatory factors homologous to the Arabidopsis MYB-bHLH-WD40 complex (such as GhMYB25, GhMYB109, and GhHD-1) have also been confirmed to be involved in cotton fiber initiation and elongation.

[0007] However, despite these advances, no well-defined and conserved regulatory complex similar to the Arabidopsis epidermal hair system has been found in cotton, indicating that fiber initiation and lint formation may involve a unique and complex transcriptional network. Integrated analysis of transcriptome and QTL data has identified more than 90 lint candidate genes preferentially expressed during fiber initiation and elongation, but the key regulatory elements and their genetic hierarchy remain unclear. SUMMARY

[0008] The purpose of the present application is to provide an amplification primer of KASP marker on D03 chromosome for breeding high-lint cotton varieties, which can effectively distinguish genotypes with significant differences in lint, providing a useful tool for molecular marker-assisted selection in cotton breeding.

[0009] The technical scheme adopted by the present application to solve its technical problems is: An amplification primer of KASP marker on D03 chromosome for breeding high-lint cotton varieties, comprising: a forward primer F1 with FAM fluorescent labeling: GAAGGTGACCAAGTTCATGCTCTCGGTGTTTTGAAAGTTAAACTAC; a forward primer F2 with HEX fluorescent labeling: GAAGGTCGGAGTCAACGGATTCTCGGTGTTTTGAAAGTTAAACTAG; Reverse primer: AAATTTTACTCCTTTGCCCGAGG.

[0010] The cotton variety is upland cotton.

[0011] A kit for detecting KASP markers on D03 chromosome for high lint percentage variety selection of cotton, the kit comprising the amplification primer.

[0012] A PCR reagent for detecting KASP markers on D03 chromosome for high lint percentage variety selection of cotton, the PCR reagent comprising the amplification primer.

[0013] Application of the amplification primer in high lint percentage variety selection of cotton.

[0014] A molecular marker assisted selection method for high lint percentage variety of upland cotton, using the amplification primer for KASP markers on D03 chromosome for high lint percentage variety selection of cotton, performing KASP reaction on the cotton to be tested, detecting the reaction product, and if only FAM fluorescently labeled fluorescence is detected, the cotton to be tested is high lint percentage genotype cotton, and if only HEX fluorescently labeled fluorescence is detected, the cotton to be tested is low lint percentage genotype cotton.

[0015] The present application has the beneficial effect of effectively distinguishing genotypes with significant lint percentage differences, and provides a useful tool for molecular marker assisted selection in cotton breeding. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 is the phenotype variation and correlation analysis of lint percentage in 4 environments.A-D: Frequency distribution of lint percentage in 4 environments, A is E1 (Sanya-2022-2023), B is E2 (Liaocheng-2023), C is E3 (Huanggang-2023) and D is E4 (Sanya-2023-2024);E: Distribution of BLUP value of lint percentage in multiple environments;F: Correlation matrix of lint percentage among 4 environments.

[0017] Figure 2 is the scanning electron microscope analysis of ovule fiber initiation of 'TM-1' and 'CRI50'. The ovule observation period is -1, 0, 1DPA. A: Schematic diagram of cotton ovary (red arrow indicates ovule); B, C: Number statistics of epidermal protrusions at 0 DPA and 1 DPA (**P<0.01); D-I: 'TM-1' ovule, D, F, H are overall views of ovule, E, G, I are enlarged views of fiber initiation cells in the central region of ovule; J-O: 'CRI50' ovule, J, L, N are overall views of ovule, K, M, O are enlarged views of fiber initiation cells in the central region of ovule. Scale bar: overall view 0.2 mm, enlarged view 40 μm, all scale bars are marked in the lower right corner of the image.

[0018] Figure 3 is the BSR-seq based QTL mapping of lint percentage. A: Distribution of identified SNPs on chromosomes; B: Functional classification of detected SNPs; C: QTL mapping based on allele frequency difference (ASNP-index), blue and red lines represent 95% and 99% confidence intervals, respectively; D: QTL mapping based on G' value, red line represents the significance threshold.

[0019] Figure 4 is the analysis of differentially expressed genes within qLP-D03-1 locus. A: Differentially expressed genes between two extreme pools within qLP-D03-1 region, white numbers represent FPKM values; B-E: qPCR validation of differentially expressed genes at -1, 0, 1 DPA in parents ('TM-1' and 'CRI50'), B for Ghicr24_D03G124100, C for Ghicr24_D03G124300, D for Ghicr24_D03G124400, E for Ghicr24_D03G135300. Data are presented as mean ± standard deviation, asterisks indicate significant differences between parents (*P < 0.05, **P < 0.01).

[0020] Figure 5 is the fine mapping of qLP-D03-1 and the analysis of tissue-specific expression of candidate genes. A: Manhattan plot of association analysis in qLP-D03-1 region; B: Linkage disequilibrium (LD) pattern within candidate interval; C: Schematic diagram of overlap between candidate interval and reported QTLs related to lint percentage, gray vertical lines represent chromosome D03, red fragment indicates qLP-D03-1 interval, red thick horizontal line highlights the key sub-interval (D03:42056420-42306503), colored horizontal lines represent reported QTLs (see Table S11 for details), red arrow marks the location of GhLPA1 in the genome; D: Tissue-specific expression profile of GhLPA1.

[0021] Figure 6GhLPA1 silencing reduces lint percentage in cotton. A: Phenotype comparison between GhLPA1 silenced plants and control plants (pCLCrV:00); B: Relative expression of GhLPA1 in leaves of pCLCrV:00 and pCLCrV:GhLPA1 plants; C: Lint percentage comparison between GhLPA1 silenced plants and control plants; D, E: Representative images of bolls and seeds of GhLPA1 silenced plants and control plants, blue boxes indicate pCLCrV:GhLPA1, red boxes indicate pCLCrV:00; F: Boll weight (BW), G: Seed index (SI), based on 3 technical replicates (20 bolls, 100 seeds per replicate, samples from different plants); H: Seed length, I: Seed width (50 seeds were measured); J: Expression of GhLPA1 in -1, 0, 1 DPA ovules of pCLCrV:00 and pCLCrV:GhLPA1 plants; K-O: Expression of fiber development related genes (GhPDF1, GhHOX3, GhEXPA1, GhEXPA2, GhHDA5) in pCLCrV:00 and pCLCrV:GhLPA1 plants. Data are presented as means ± standard errors of at least 3 independent biological replicates, significance was judged by Student's t test: *P < 0.05, **P < 0.01.

[0022] Figure 7 Haplotype analysis of GhLPA1 and its application in cotton genetic improvement. A: Genomic structure and SNP distribution in the 2 kb region upstream and downstream of GhLPA1, SNP nucleotide positions are: Pos.1 (rsD03_42213681), Pos.2 (rsD03_42214174), Pos.3 (rsD03_42214210), Pos.4 (rsD03_42214745), Pos.5 (rsD03_42215602), Pos.6 (rsD03_42215603), Pos.7 (rsD03_42215686); B: Haplotype classification of GhLPA1 in 355 cotton materials; C: Frequency change of high lint percentage haplotype in different breeding years; D: Fst analysis of SNPs near GhLPA1; E: Nucleotide diversity (π) of SNPs around GhLPA1; F: Lint percentage comparison of different haplotypes, blue indicates ‘CRI50’ haplotype (Hap1), pink indicates ‘TM-1’ haplotype (Hap2); G: Boll weight comparison of different haplotypes; H: Genotyping results of GhLPA1 haplotype in recombinant inbred line population based on developed KASP markers, blue indicates Hap1 (‘CRI50’ type), pink indicates Hap2 (‘TM-1’ type); I: Lint percentage phenotype comparison of two haplotypes in recombinant inbred line population. DETAILED DESCRIPTION

[0023] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0024] In this invention, unless otherwise specified, all raw materials and equipment used are commercially available or commonly used in the field. The methods described in the following embodiments are conventional methods in the field, unless otherwise specified.

[0025] Example 1: 1. Materials and Methods 1.1 Experimental Materials and Construction of the Mapping Population To elucidate the genetic basis of lint percentage in upland cotton, this study constructed a recombinant inbred line (RIL) population using two parents with significantly different lint percentages. The maternal parent, 'CRI50', is characterized by high lint percentage, early maturity, and stable yield. It is a conventional variety containing insect-resistant genes and exhibits strong stress resistance and agronomic adaptability. The paternal parent, 'TM-1', is a standard genetic line whose entire genome has been sequenced, revealing its clear genetic background. It is a widely used reference genome in cotton genome research.

[0026] A recombinant inbred line population of 300 lines was constructed through continuous self-pollination of the F2 generation. F1 hybrids were bred at the Pingshan Experimental Station of Zhejiang A&F University in 2019; the F2 population was planted in Sanya, Hainan in 2019-2020; and F2:3 and F2:4 populations were planted in Liaocheng, Shandong in 2021 and 2022, respectively. Seeds from F2:5 to F2:8 generations were used for multi-environment phenotypic identification and genetic analysis to ensure the stability and heritability of lint percentage measurements. Furthermore, a genome-wide association study (GWAS) was conducted using a natural population containing 355 upland cotton accessions (Li LB, Zhang C, Huang JQ, Liu QB, Wei HL, Wang HT, Liu G Y, Gu LJ, Yu SX. 2021. Genomic analyses reveal the genetic basis of early maturity and identification of loci and candidate genes in upland cotton (Gossypium hirsutum L.). Plant Biotechnology Journal, 19, 109–123.).

[0027] 1.2 Field identification and phenotypic data collection Phenotypic identification of 300 recombinant inbred lines and their parents were conducted in four locations in China during 2022-2024 growing seasons. The locations and years were as follows: Sanya, Hainan (2022-2023, 2023-2024, denoted as E1, E4, respectively); Liaocheng, Shandong (2023, denoted as E2); Huanggang, Hubei (2023, denoted as E3); Hangzhou, Zhejiang (2024, denoted as E5).

[0028] All field trials were designed with randomized complete blocks, with three replicates and managed uniformly according to local standard agronomic practices. At the boll opening stage in September, 20 fully opened bolls were manually harvested from each line, and then ginned using a laboratory gin. The lint and seed cotton weights were measured, and lint percentage was calculated according to the formula: LP (%) = (Lint weight / Seed cotton weight) × 100%.

[0029] The environmental correlation analysis and ANOVA of lint percentage were conducted using R software. The generalized heritability (H 2(Bates D, Maechler M, Bolker B, Walker S. 2014. Fitting linear mixed-effects models using lme4. Statistics & Computing, 1406, 133-199.). Phenotypic data of lint percentage and boll weight (BW) of natural populations were derived from published literatures (Su J J, Fan S L, Li L B, Wei H L, Wang C X, Wang H T, Song M Z, Zhang C, Gu L J, Zhao S Q, Mao G Z, Wang C S, Pang C Y, Yu S X. 2016. Detection of favorable QTL alleles and candidate genes for lint percentage by GWAS in Chinese upland cotton. Frontiers in Plant Science. 7, 1576.; Feng Z, Li L B, Tang M Q, Liu Q B, Ji Z H, Sun D L, Liu G D, Zhao S Q, Huang C J, Zhang Y N, Zhang G Z, Yu S X. 2022. Detection of Stable elite haplotypes and potential candidate genes of boll weight across multiple environments via GWAS in upland cotton. Frontiers in Plant Science. 13, 929168.).

[0030] 1.3 Scanning electron microscope comparative observation of parent ovule development Ovules at different developmental stages of parents were collected and immediately fixed in 0.2 mol / L phosphate buffer solution (PBS, pH 7.2) containing 3% glutaraldehyde at 0-4 ℃ for 2 h. After washing with PBS for 3 times, the samples were dehydrated by gradient ethanol (30%, 50%, 70%, 80%, 90%, 95%, 100%). The dehydrated samples were replaced with tert-butyl alcohol and then freeze-dried. After gold spraying treatment, the dried samples were observed using a Hitachi S-3000N scanning electron microscope (Hitachi High-Technologies, Japan). All experiments were set up in triplicate biological replicates.

[0031] 1.4 BSR-seq library construction and association analysis Based on the best linear unbiased prediction (BLUP) value of lint percentage in four environments (E1-E4), 20 high lint percentage lines and 20 low lint percentage lines were selected from the recombinant inbred line population to construct high lint percentage pool (LP-high) and low lint percentage pool (LP-low), respectively. The parents and two extreme pool materials were planted in E5 environment, and ovules were collected on the day of flowering (0 DPA) (a total of 42 genotypes). RNA sequencing was performed by Wuhan Benya Technology Co., Ltd.

[0032] After quality control of sequencing data using Fastp (v0.12.4) software, high-quality reads were aligned to the ‘ZM24’ reference genome using HISAT2 (v2.2.1) software. Variants were detected and annotated according to the established variant detection process in the laboratory (Li L B, Chang H, Zhao S Q, Liu R J, Yan M Y, Li F F, El-Sheery N I, Feng Z, Yu S X. 2024. Combining high-throughput deep learning phenotyping and GWAS to reveal genetic variants of fruit branch angle in upland cotton. Industrial Crops and Products, 220, 119180.).

[0033] The criteria for screening high-quality SNPs were as follows: reference allele frequency 0.3-0.7, total sequencing depth 100-5000, and genotype quality (ΔSNP) score ≥99. High-quality SNPs were analyzed using the QTLseqr R package to identify genome regions associated with lint percentage. The G' statistic of each SNP was calculated, and sites with a q value ≤0.01 were considered to be significantly associated with lint percentage. The critical value corresponding to the 99th percentile of G' distribution was 45.

[0034] 1.5 Differential expression genes and functional enrichment analysis The R language related packages were used to analyze and visualize the differential expression genes (DEGs): the ggplot2 package was used to draw the volcano plot, the pheatmap package (https: / / github.com / raivokolde / pheatmap) was used to draw the heat map, and the VennDiagram package was used to draw the Venn diagram.

[0035] The TBtools-II software was used to perform gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) functional enrichment analysis on the screened differential expression genes, the GO enrichment and KEGG enrichment analysis modules were applied, and the ggplot2 package was used to visualize the KEGG results.

[0036] 1.6 Real-time fluorescent quantitative PCR (qRT-PCR) gene expression analysis To analyze the expression of target genes, the ovules of ‘TM-1’ and ‘CRI50’ at-1, 0, 1 DPA and the ovules of GhLPA1 (i.e. ZM24 reference genome number Ghicr24_D03G124100 gene) silenced plants in the background of ‘CRI50’ were collected, and total RNA was extracted; total RNA extraction, cDNA synthesis and real-time fluorescent quantitative PCR (qRT-PCR) analysis were performed according to the method described by Chang et al. (Chang H, Ji H H, Liu R J, Feng J L, Wang J Y, Zhao SQ, Li W, Qiu Z H, Elsheery N I, Yu S X, Li L B, Feng Z. 2025. Genome-wide association study reveals significant loci and candidate genes for fruit branch length in upland cotton. Plant Genome, 18, e70041.). Each reaction was set up in triplicate biological replicates, and the results were visualized using GraphPad Prism (v8.0.2.263) software.

[0037] 1.7 Subcellular localization of GhLPA1 To determine the subcellular localization of GhLPA1, its coding sequence was fused into the green fluorescent protein (GFP) gene frame and inserted into the pCAMBIA1305 vector controlled by the dual 35S promoter (d35S), constructing the recombinant vector d35S::GhLPA1-GFP. The recombinant plasmid and the empty vector control (d35S::GFP) were transformed into Agrobacterium tumefaciens strain GV3101, respectively.

[0038] Nicotiana benthamiana plants were cultured in an artificial climate chamber (model LT-36VL; Percival Scientific, USA) under the following conditions: 25°C, 16 h light / 8 h dark, and a light intensity of 150 μmol m⁻. 2 s⁻ 1 The relative humidity was 60%. Leaves from 4-week-old plants were selected and infiltrated with Agrobacterium suspension containing GhLPA1-GFP fusion vector or GFP control vector (for specific methods, refer to: Voinnet O, Rivas S, Mestre P, Baulcombe D. 2003. An enhanced transient expression system in plants based on suppression of genesilencing by the p19 protein of tomato bushy stunt virus. The Plant Journal, 33, 949–956.). After 36–48 hours of infiltration, fluorescence signals were observed using a Zeiss LSM 900 confocal laser scanning microscope (Carl Zeiss AG, Germany).

[0039] 1.8 Association analysis and population genetic analysis of the qLP-D03-1 region Based on resequencing data from 355 upland cotton germplasm resources, 3,050 SNPs were identified in the qLP-D03-1 region. Genome-wide association analysis of lint was performed using the linear mixture model (LMM) in GEMMA (v0.98.3) software. Manhattan plots were generated using the ggplot2 package in R language to display the association analysis results. Nucleotide diversity (π) was estimated using VCFtools (v0.1.16) software. The fixation index (Fst) of 355 cultivated materials and 68 semi-wild materials within the candidate genome region was calculated to quantify the degree of population differentiation.

[0040] 1.9 Development and Genotyping of the KASP Marker for the Ghicr24_D03G124100 Gene To verify the association of Ghicr24_D03G124100 gene with lint, KASP marker was developed for the homozygous SNP (rsD03_42213681) in the 3' untranslated region (UTR) of the gene. The allele-specific forward primers with FAM and HEX fluorescent labels [KASP-F1 (GAAGGTGACCAAGTTCATGCTCTCGGTGTTTTGAAAGTTAAACTAC, SEQ ID No. 1) / KASP-F2 (GAAGGTCGGAGTCAACGGATTCTCGGTGTTTTGAAAGTTAAACTAG, SEQ ID No. 2)] and reverse primer (KASP-R: AAATTTTACTCCTTTGCCCGAGG, SEQ ID No. 3) were designed using Primer Premier 5 and Phytozome software; genotyping was performed on LGC High-Throughput Genotyping Platform (Shanghai Lifecontrol Biotech Co., Ltd.).

[0041] 1.10 VIGS-based functional verification of GhLPA1 To verify the function of GhLPA1 by VIGS, the specific fragment of the gene was cloned into the pCLCrV vector to construct the pCLCrV:GhLPA1 recombinant vector, which was introduced into the Agrobacterium tumefaciens LBA4404 strain. The agrobacterium liquid containing pCLCrV:GhLPA1, pCLCrV:00 (negative control) and pCLCrV:GhCLH (positive control) was mixed with the helper vector (pCLCrVB) to infiltrate the cotyledons of 12-day-old ‘CRI50’ seedlings (for specific methods, see: Ma L, Hu T L, Kang M, Fu X K, Chen P Y, Wei F, Jian H L, Lü X Y, Zhang M, Yang Y L. 2024. Identification of candidate genes for early-maturity traits by combining BSA-seq and QTL mapping in upland cotton (Gossypium hirsutum L.). Journal of Integrative Agriculture, 23, 3472-3486.; Yuan W M, Li Y, Zhang W J, Ju J S, Guo X F, Yang J N, Lin H, Wang C X, Ma Q, Su J J. 2025. Pinpointing MQTLs and candidate genes related to early maturity in upland cotton through the integration of metaanalysis, RNA-seq, and VIGS approaches. Industrial Crops & Products, 223, 120195.).

[0042] The infiltrated plants were placed in a greenhouse for culture, and the occurrence of yellowing phenotype was observed regularly. The silencing efficiency was analyzed by qRT-PCR. When compared with the control group, only the plants confirmed to be successfully silenced were included in the final analysis.

[0043] 2 Results 2.1 Phenotypic variation and heritability analysis of lint percentage in the recombinant inbred line population Phenotypic analysis of the recombinant inbred line population revealed significant and stable differences in lint percentage between the parents: the lint percentage of the paternal parent 'TM-1' was significantly lower than that of the maternal parent 'CRI50' in all environments, with differences ranging from 16.42% to 20.13%. The lint percentage phenotypic values ​​and their best linear unbiased prediction (BLUP) values ​​exhibited a near-normal continuous distribution. Figure 1 The AE in the data shows a significant correlation between the different environments. Figure 1 (F in the middle).

[0044] In all environments, the pelt percentage of the recombinant inbred lines showed out-of-parent segregation, with a broad-sense heritability of 81.65%. Genetic analysis confirmed that pelt percentage is a quantitative trait dominated by genetic factors.

[0045] 2.2 QTL Localization Analysis Based on BSR-seq Based on the pelargoniographic values ​​and BLUP values ​​of recombinant inbred lines in three environments, 20 high-pelargoniographic lines and 20 low-pelargoniographic lines were selected to construct a high-pelargoniographic pool (LP-high) and a low-pelargoniographic pool (LP-low), respectively. The pelargoniographic phenotypes of the two pools were significantly different.

[0046] To determine the optimal sampling time, the fiber development of the parental ovules was observed using an electron microscope at -1, 0, and 1 DPA. Figure 2 In the A, D, F, H, J, L, N range: -1 DPA, no protrusions were observed on the epidermis of either parent ovule ( Figure 2 (E, K in the text); protrusions begin to appear at 0 DPA, and the protrusions elongate significantly at 1 DPA; and at both 0 DPA and 1 DPA, the number of protrusions in 'CRI50' is greater than that in 'TM-1' ( Figure 2 (B, C, G, I, M, O in the text).

[0047] Based on the above observations, transcriptome sequencing was performed on mixed pool samples and parental 0 DPA ovules. The sequencing yield for each sample was approximately 10 Gb, with an average sequencing depth of 6×. 33,475,141 sequences were obtained from the high-leaf and low-leaf pools, and 44,585,495 sequences were obtained from the low-leaf pools. After quality control, the high-quality sequences were aligned to the upland cotton 'ZM24' genome.

[0048] A total of 95,230 high-quality SNPs were identified through variant site detection. These were relatively evenly distributed across the At subgenome (46,617) and Dt subgenome (48,613), with a higher SNP density on the Dt chromosome than on the At chromosome. Figure 3 Of the 95,205 annotable SNPs, approximately 29% are located in exon regions, of which 62% are non-synonymous SNPs. Figure 3 The B in the figure indicates that there are significant genetic differences between the parents.

[0049] BSR-seq analysis of 95205 SNPs was performed using QTLseq R package, and the tricube-smoothed ΔSNP index and G' value were calculated by 4 Mb sliding window, 8 QTLs were identified with more than 95% and 99% confidence interval (Fig. 2A-C), among which 5 QTLs had G' value more than 45 (Fig. 2D). Figure 3 Figure 3 On chromosome A08 and D03, 3 QTLs were detected by both methods, and the G' value of the region 39.34-44.79 Mb on chromosome D03 was the highest, which was determined as the candidate region and named as qLP-D03-1, and this region contained 226 annotated genes.

[0050] 2.3 Identification of differentially expressed genes in qLP-D03-1 region 0 The transcriptome analysis of 0 DPA ovules showed that the samples were divided into two obvious expression clusters: the high lint pool was clustered with ‘CRI50’, and the low lint pool was clustered with ‘TM-1’, which confirmed the reliability of the transcriptome data.

[0051] Differential expression analysis showed that 2138 differentially expressed genes (DEGs) were identified between parents, and 537 differentially expressed genes were identified between extreme pools; among them, 135 differentially expressed genes showed consistent expression patterns in the comparison between parents and extreme pools.

[0052] Gene ontology (GO) enrichment analysis showed that these genes were mainly involved in basic metabolic processes, including translation, ribosome activity, and membrane and cytoplasmic components, indicating that the difference in basic metabolism might be one of the reasons for the difference in lint phenotype.

[0053] Within the qLP-D03-1 region, 4 differentially expressed genes (Ghicr24_D03G124100, Ghicr24_D03G124300, Ghicr24_D03G124400, Ghicr24_D03G135300) showed consistent expression trends between parents and extreme pools. Among them, Ghicr24_D03G124100 had the highest expression, and the expression of this gene in the high lint pool and ‘CRI50’ was 5.78 times and 2.55 times that in the low lint pool and ‘TM-1’, respectively (Fig. 2A). Figure 4

[0054] Real-time fluorescent quantitative PCR verification showed that at -1 DPA and 0 DPA, the expression of these 4 genes in ‘CRI50’ was significantly higher than that in ‘TM-1’ (Fig. 2B-E). In summary, these genes might be potential candidate genes related to lint. Figure 4

[0055] ​​​2.4 Association localization and candidate gene identification of qLP-D03-1 site To narrow down the candidate region and identify potential candidate genes related to lint percentage, association analysis was performed on the qLP-D03-1 site using the average lint percentage of 355 upland cotton materials in four environments. A linear mixture model was used to analyze 3,050 high-quality SNPs within this region, detecting two significant association peaks exceeding the threshold, and nearby SNPs exhibited strong linkage disequilibrium (LD).

[0056] The most significant SNP (rsD03_42178383) is the -log 10 The value of (P) is 4.31 ( Figure 5 Linkage disequilibrium analysis further narrowed the candidate region to a 250.1 kb interval (D03:42056420-42306503), which contained 23 annotated genes (A in the original text). Figure 5 (B in the middle).

[0057] This interval overlaps with 7 previously reported QTLs related to clothing percentage, with LOD values ​​ranging from 5.07 to 110.1. Figure 5 The region (C) was confirmed as a major hotspot QTL region. Notably, the differentially expressed gene Ghicr24_D03G124100 was located within this region, flanked by two significant SNPs and overlapping with six already mapped QTLs. Based on these consistent genetic results, this gene was named GhLPA1 for further research.

[0058] GhLPA1 shares approximately 84.35% amino acid sequence identity with its Arabidopsis homology gene (At3g62870), which encodes a ribosomal protein involved in cell proliferation. This high degree of conservation suggests that GhLPA1 may play a role in translation-related processes during fiber development. Public transcriptome data show that GhLPA1 expression peaks in early ovule development (-1, 0, 5 DPA). Figure 5 The D in the figure suggests that it may be involved in the regulation of fiber initiation.

[0059] 2.5 GhLPA1 is a positive regulator of cotton lint percentage. To explore the potential biological functions of GhLPA1, its subcellular localization was first analyzed: fluorescence microscopy showed that the GhLPA1-GFP fusion protein was distributed in both the cytoplasm and the nucleus, indicating that GhLPA1 may play a role in these two regions.

[0060] Since the expression level of GhLPA1 in 'CRI50' was significantly higher than that in 'TM-1' at 0 DPA ( Figure 4A, B) in the previous study, we selected 'CRI50' as the recipient material for VIGS experiment. At the boll opening stage, pCLCrV:GhCLH plants showed the expected leaf yellowing phenotype (Fig. 1 Figure 6 A) in the previous study, we selected 'CRI50' as the recipient material for VIGS experiment. At the boll opening stage, pCLCrV:GhCLH plants showed the expected leaf yellowing phenotype (Fig. 1

[0061] Real-time quantitative PCR analysis showed that the expression level of GhLPA1 in the leaves of silenced plants was significantly reduced, only 44-63% of that in pCLCrV:00 control plants (Fig. 2 Figure 6 B); the lint percentage of GhLPA1 silenced plants was reduced to 37%, significantly lower than that of the control plants (43%) (Fig. 2 Figure 6 C); while the boll weight (BW) showed no significant difference between the two groups of plants (Fig. 2 Figure 6 D, F). Notably, the seed index (SI) of GhLPA1 silenced plants was significantly increased, and the seed length and width were also significantly increased (Fig. 2 Figure 6 E, G-I); in addition, the transcription level of GhLPA1 in -1, 0, 1 DPA ovules of silenced plants was significantly lower than that of the control (Fig. 2 Figure 6 J).

[0062] At 0 DPA, multiple key fiber development related genes (including GhPDF1, GhHOX3, GhEXPA1, GhEXPA2 and GhHDA5) were significantly down-regulated (Fig. 2 Figure 6 K-O) in silenced plants, while GhPDF2, GhHOX1 and GhPIN1a were up-regulated; the expression of GhMML3, GhHD1 and GhMYB25 showed no significant change.

[0063] 2.6 Haplotype analysis of GhLPA1 and KASP marker development Based on the SNPs in the 2 kb region upstream and downstream of GhLPA1, 355 Upland cotton natural population materials were divided into two haplotypes: 'CRI50' type (Hap1) and 'TM-1' type (Hap2), which contains two non-synonymous mutations (Fig. 3 Figure 7 A). Among the 355 materials, 242 belonged to Hap1, and 98 belonged to Hap2 (Fig. 3 Figure 7 B).

[0064] Analysis of 328 cultivars in China's four cotton regions found that the frequency of Hap1 and Hap2 was comparable in the inland cotton region of Northwest China, while the frequency of Hap1 was higher in the other three cotton regions; over the past 20 years, the proportion of Hap1 materials has gradually increased, from 14.4% to 49.7% (Fig. 3 Figure 7 C).

[0065] The fixation index (Fst) of the genomic region around GhLPA1 was more than 0.2 (Fig. 3 Figure 7D) and the genetic diversity showed a decreasing trend over time (Figs. 1E and 1G), which collectively indicated that Hapl was subjected to artificial selection in the recent breeding process. Figure 7

[0066] In addition, the lint percentage of Hapl materials was significantly higher than that of Hap2, while the boll weight of the two groups of materials showed no significant difference (Figs. 1F and 1G), indicating that Hapl could increase the cotton lint yield without affecting the boll weight. Figure 7

[0067] To apply GhLPA1 to breeding practice, SNPs in the 2 kb region upstream and downstream of the gene were screened for the development of KASP markers. A SNP, rsD03_42213681, was identified in the 3' untranslated region (UTR): Hapl was C, and Hap2 was G.

[0068] The sequence covering the SNP was targeted: CTCGGTGTTTTGAAAGTTAAACTACAAAATATATAAGTAATCCTCGGGCAAAGGAGTAAAATTT (SEQ ID No. 4, the SNP site is at the 25th position of the sequence, with C / G polymorphism) to design specific primers for the development of functional KASP markers. The KASP marker amplification primers developed were: F1: Forward primer with FAM fluorescent label: GAAGGTGACCAAGTTCATGCTCTCGGTGTTTTGAAAGTTAAACTAC (SEQ ID No. 1); F2: Forward primer with HEX fluorescent label: GAAGGTCGGAGTCAACGGATTCTCGGTGTTTTGAAAGTTAAACTAG (SEQ ID No. 2); Reverse primer: AAATTTTACTCCTTTGCCCGAGG (SEQ ID No. 3).

[0069] Genotyping of 278 randomly selected recombinant inbred lines (RILs) and their parents using this marker could clearly distinguish the two haplotypes (Fig. 1H): 98 lines carried the 'CRI50' haplotype, and 180 lines carried the 'TM-1' haplotype; the lint percentage of RILs with the 'CRI50' genotype was significantly higher than that of RILs with the 'TM-1' genotype (Fig. 1I). Further verification in natural populations also confirmed that the lint percentage of Hapl materials was significantly higher than that of Hap2. These results indicated that this KASP marker could be used for high-lint cotton breeding. Figure 7 Figure 6 ​​​​

[0070] 3 Discussion 3.1 Field phenotyping and statistical analysis to screen extreme germplasm resources Among the main components of cotton yield, lint percentage is the key indicator that determines the total yield of fiber, which reflects the proportion of lint in seed cotton and directly affects the lint yield. Compared with other yield components such as boll number per plant and boll weight, lint percentage is more stable in different environments and is the key to genetic improvement of cotton yield. The genetic standard line of upland cotton, 'TM-1', was developed from Deltapine 14 through 17 generations of pedigree selection, with a highly homozygous genetic background and a stable lint percentage of about 37%. 'CRI50' is the control variety of the regional cotton test in the Yangtze River Basin of China, with a higher lint percentage (about 43%) and stable yield performance in multiple environments. Under the same environmental conditions, there is a significant and stable difference in lint percentage between the two parents, indicating significant genetic differentiation at the sites related to lint yield.

[0071] The recombinant inbred line population constructed from these two parents is an ideal genetic material for analyzing the genetic basis of lint percentage. The recombinant inbred line population, with a close-to-homozygous genetic background, can achieve precise genotype-phenotype association analysis and reduce the interference of residual heterozygosity.

[0072] In this study, the generalized heritability of lint percentage in four test environments was 81.65%, which is consistent with the heritability reported in other cotton populations (61.21%-91.47%). The high heritability indicates that lint percentage is significantly affected by genetic factors, and also confirms that the recombinant inbred line population is suitable for subsequent multi-omics QTL identification and functional gene mining.

[0073] 3.2 Multi-omics analysis reveals that qLP-D03-1 is a stable QTL controlling lint percentage in cotton In this study, we integrated BSR-seq, GWAS, and transcriptome analysis of the recombinant inbred line population, significantly improving the resolution and reliability of QTL mapping for lint percentage in upland cotton and identifying the stable locus qLP-D03-1. Traditional QTL mapping is often limited by wide confidence intervals, complex genetic backgrounds, and other factors, leading to ambiguous signals and false positives. Previous studies using low-density markers such as SSR or SLAF-seq (specific locus amplified fragment sequencing) often identified QTLs covering a genomic interval of 5-10 Mb or even larger, greatly hindering the precise positioning of candidate genes.

[0074] In contrast, the recombinant inbred line BSR-seq method used in this study has two major advantages: first, compared with temporary mapping populations such as F2, recombinant inbred line BSR-seq can reduce false positive signals and ensure that allele frequencies and expression differences reflect true genetic effects rather than random separation noise.

[0075] Second, BSR-seq provides an economic and efficient high-resolution approach for dissecting complex traits in large-genome species. For polyploid crops such as G. hirsutum (genome size ~2.3 Gb), whole-population resequencing or high-density GWAS still face challenges in economy and computation; while BSR-seq efficiently captures causal variants by sequencing only the phenotypically extreme pools at a lower cost, a similar strategy has been successfully applied to fine mapping of yield-related loci in Setaria italica and Triticum aestivum.

[0076] Combining GWAS, the complementary advantages of the two approaches efficiently narrowed down qLP-D03-1 to a 250.1-kb interval, which contains 23 annotated genes. Importantly, this interval overlaps with multiple reported fiber-related QTLs in different populations, confirming it as a recurrent and stable hotspot QTL region. Moreover, the expression level of GhLPA1 at 0 DPA is highly consistent with the causal variants revealed by BSR-seq and GWAS. The integration of linkage analysis, association analysis, and expression analysis provides strong mechanistic evidence for the direct causal relationship between genotype and phenotype, fully supporting GhLPA1 as a reliable candidate gene. Such multi-level validation strategies have been successfully applied to the identification of stable QTLs for yield and quality traits in Triticum aestivum and fruit quality in Citrullus lanatus, but less in cotton.

[0077] 3.3 Functional verification of GhLPA1 candidate gene In this study, GhLPA1 was identified as the key candidate gene of major QTL qLP-D03-1, which positively regulates lint percentage in G. hirsutum. To further explore its molecular basis and potential biological functions, we analyzed its subcellular localization and compared its amino acid sequence with Arabidopsis homologs.

[0078] Fluorescence microscopy observation showed that GhLPA1 was localized in the cytoplasm and nucleus, consistent with its predicted function as a ribosomal protein involved in translation and cellular metabolic processes. Sequence analysis revealed that GhLPA1 shares about 84.35% amino acid sequence identity with Arabidopsis homolog RPL7aB (At3g62870), which is a structural component of the 60S ribosomal large subunit. The 60S subunit is assembled from 5.8S, 25S, and 5S rRNAs and about 40-48 ribosomal proteins (RPLs). In plant cells, these subunits form in the nucleus and are then transported to the cytoplasm for maturation, which also explains why many RPL proteins exhibit nucleocytoplasmic localization features.

[0079] Although RPL proteins are essential for ribosome biogenesis and translation, increasing evidence suggests that many RPL proteins also have ribosome-extracellular functions that regulate plant development. However, their potential roles in cotton fiber development are still poorly understood.

[0080] Previous studies have shown that the rosette leaves and leaf blades of the At3g62870 mutant are significantly smaller than those of the wild type, which is due to reduced cell proliferation. Furthermore, the mutant also exhibits reduced chlorophyll a and b content, fewer chloroplasts, and pale, reticulate leaves, indicating that this gene is involved in cell proliferation and chloroplast biosynthesis. Given that cotton fiber initiation requires rapid epidermal cell expansion and increased metabolic activity, these findings suggest that GhLPA1 may promote active cell growth in the early stages of ovule development.

[0081] Consistent with this hypothesis, silencing GhLPA1 can significantly reduce lint content ( Figure 6 (C in the middle); although there was no significant difference in bell weight ( Figure 6 The F in the text is missing, but while the lint percentage decreases, the seed size and seed index increase, indicating a developmental balance between fiber and seed growth. Figure 6 In addition, at 0 DPA, several key fiber development-related genes (GhPDF1, GhHOX3, GhEXPA1, GhEXPA2, and GhHDA5) were significantly downregulated in silenced plants. Figure 7 These genes (JO in the gene pool) are known to play key roles in fiber initiation and elongation. In summary, these results suggest that GhLPA1 may be a candidate gene involved in fiber development.

[0082] 3.4 GhLPA1 is subject to selection during the breeding process The identification of two major haplotypes at the GhLPA1 locus revealed the contribution of allelic differentiation to lint percentage variation in upland cotton. Materials carrying the 'CRI50' haplotype (Hap1) had significantly higher lint percentages than those carrying the 'TM-1' haplotype (Hap2), consistent with parental phenotypic differences. Since there was no significant difference in boll weight between the two haplotypes, the increased lint percentage associated with Hap1 could directly increase lint yield without reducing boll weight, highlighting its potential value in yield improvement.

[0083] Based on seven SNPs (including two non-synonymous mutations) identified within a 2 kb region upstream and downstream of GhLPA1, 355 cotton varieties were mainly divided into two haplotypes: 'CRI50' (Hap1) and 'TM-1' (Hap2). ​ The KASP marker (rsD03_42213681) developed based on the GhLPA1 3' untranslated region (UTR) SNP can effectively distinguish between high and low lint percentage phenotypes in recombinant inbred lines and natural populations. This marker has promising applications in molecular breeding to improve lint percentage.

[0084] 4. Conclusion In this study, we identified a major QTL qLP-D03-1 and candidate gene GhLPA1 controlling lint percentage by combining recombinant inbred line BSR-seq, GWAS and transcriptome analysis. Through VIGS verification, we confirmed that GhLPA1 could positively regulate the cotton yield and did not affect the boll weight. In addition, the functional KASP marker developed based on the SNP in the 3' untranslated region (UTR) of GhLPA1 could effectively distinguish the high lint percentage haplotype, providing valuable resources for cotton yield improvement.

[0085] The above-described embodiments are only a preferred scheme of the present application, and do not limit the present application in any form. Other variants and modifications can be made without departing from the technical scheme recited in the claims.

Claims

1. An amplification primer for the KASP marker on chromosome D03 used in the breeding of high-yield cotton varieties, characterized in that, include: Forward primer F1 with FAM fluorescent label: GAAGGTGACCAAGTTCATGCTCTCGGTGTTTTGAAAGTTAAACTAC; Forward primer F2 with HEX fluorescent label: GAAGGTCGGAGTCAACGGATTCTCGGTGTTTTGAAAGTTAAACTAG; Reverse primer: AAATTTTACTCCTTTGCCCGAGG.

2. The amplification primer according to claim 1, characterized in that, The cotton variety in question is upland cotton.

3. A kit for detecting KASP markers on chromosome D03 used in the breeding of high-yield cotton varieties, characterized in that, The kit includes the amplification primers as described in claim 1.

4. A PCR reagent for detecting KASP markers on chromosome D03 used in the breeding of high-yield cotton varieties, characterized in that, The PCR reagent includes the amplification primers as described in claim 1.

5. The application of the amplification primer as described in claim 1 in the breeding of high-leaf-ratio cotton varieties.

6. A molecular marker-assisted breeding method for high-yield upland cotton varieties, characterized in that, Using the amplification primers for the KASP marker on chromosome D03, as described in claim 1, for the breeding of high-lint-ratio cotton varieties, the cotton to be tested was subjected to a KASP reaction. The reaction product was detected. If only the fluorescence of the FAM fluorescent marker was detected in the reaction product, then the cotton to be tested was a high-lint-ratio genotype cotton.

Images