KASP molecular markers closely linked to the major gene locus of BNS series of wheat male sterility and its application

By developing KASP molecular markers that are closely linked to the major effect gene loci of BNS series wheat male sterility, the problems of heavy workload, high cost and environmental impact in traditional breeding methods have been solved, rapid and accurate breeding selection has been achieved, and the efficiency and selection quality of wheat breeding have been improved.

CN119736427BActive Publication Date: 2025-10-14HENAN INST OF SCI & TECH +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411756625.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-03
Publication Date
2025-10-14
Estimated Expiration
2044-12-03

AI Technical Summary

Technical Problem

Traditional methods of breeding using the BNS series of wheat male sterility genes require large-scale phenotypic investigations and self-pollination fruit set rate testing, which is labor-intensive, costly, and easily affected by the environment, making it difficult to accurately select breeding materials.

Method used

Develop KASP molecular markers that are tightly linked to the major male sterility gene loci of the BNS series of wheat, use KASP technology for high-precision genotyping, design specific KASP primers to locate and detect genes in the BNS series of wheat, screen out molecular markers that are tightly linked to the major effect genes, and achieve rapid and accurate breeding selection.

Benefits of technology

It improves the accuracy and efficiency of breeding selection, reduces workload and cost, and can complete the screening and phenotypic prediction of large quantities of materials in a short period of time, ensuring the clarity and accuracy of selection targets.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119736427B_ABST
    Figure CN119736427B_ABST
Patent Text Reader

Abstract

The application discloses a KASP molecular marker closely linked to a BNS series of wheat male sterility major gene site and application thereof, the BNS series of wheat male sterility major gene site is located on a wheat 2A chromosome, and the KASP molecular marker closely linked to the BNS series of wheat male sterility major gene site is AX-174216228 and AX-109413735; two KASP markers AX-174216228 and AX-109413735 provided by the application are used to verify 97 wheat materials, and the result is completely consistent with expectation. The KASP marker provided by the application has the characteristics of rapidness, convenience, high specificity and good accuracy, and can complete screening and phenotype prediction work of the male sterility major gene site in a large number of materials in a short time.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical fields of biotechnology and molecular breeding, and particularly relates to a KASP molecular marker tightly linked to a major gene locus of male sterility in BNS series wheat and an application thereof. Background Art

[0002] The use of photothermosensitive male sterility (PTSMS) in wheat is a major advancement in hybrid wheat research. Photothermosensitive male sterility lines discovered in my country, such as ES, C49S, ZP, BS, YS, and BNS, have become important test materials for hybrid wheat research.

[0003] Thermo-sensitive genic male sterile wheat (BNS), successfully developed by Ru Zhengang in 2002, exhibits complete sterility and complete fertility transition. Its fertility transition trend is from complete sterility to semi-sterility to complete fertility. Low temperatures are the primary factor affecting BNS's fertility transition, resulting in sterility at low temperatures and fertility at high temperatures. The sensitive part of BNS to low temperatures is the developing panicle. The sensitive period for fertility transition in BNS occurs 5-18 days before heading, from the stage of pistil differentiation to tetrad formation. During this temperature-sensitive period, when the daily minimum temperature falls below 8°C, the sterile line is completely sterile. 8-12°C is the fertility transition temperature. Above 12°C, the line becomes fully fertile, forming a fertile line known as the maintainer line. In northern Henan Province, seeds sown between September 23rd and October 17th exhibit complete sterility and can be used for hybrid production. Seeds sown after November 18th exhibit complete fertility and can be self-pollinated to propagate sterile seed. The BNS sterile line exhibits excellent sterility, easy conversion, and specific resilience in my country's major wheat-producing regions of the Huanghuai region, making it a highly valuable sterile line for hybrid wheat. BNS366, developed through a saturation backcross between BNS and Zhengmai 366, shares the same sterility characteristics and fertility conversion patterns as BNS, while also exhibiting more stable sterility. Using BNS and similar thermosensitive nuclear male sterile lines (collectively referred to as the BNS series) as parents, more new sterile lines can be developed, providing a rich germplasm resource for efficient hybrid wheat seed production.

[0004] Creating new sterile lines using BNS wheat as a parent can be accomplished through traditional hybridization and backcrossing with other parents. This often requires large populations and extensive phenotypic investigation. Furthermore, the manifestation of thermosensitive male sterility requires extensive bagging and self-pollination seed set testing, significantly increasing the workload and cost of breeding. Fine mapping of sterile genes in BNS wheat has led to the development of molecular markers strongly linked to the functional loci of these genes. This allows for the identification of genetic combinations that contribute to sterility in breeding materials. Based on the breeding improvement goals for sterile lines, sterile genes can be introduced to create new thermosensitive nuclear sterile germplasm resources, which has important application value. Sterility traits are easily affected by environmental temperature and difficult to accurately assess during breeding. However, identifying combinations of alleles strongly linked to sterility genes can replace phenotypic investigation of sterility traits and is unaffected by environmental factors. This increases the accuracy and efficiency of selection, accelerating the breeding process.

[0005] Traditional linked marker analysis is complex, has low throughput, and is labor-intensive. KASP genotyping technology is a unique competitive allele-specific PCR that enables high-precision biallelic typing of SNPs and indels (insertion deletions) in a variety of genomic nucleic acid samples. KASP technology offers simple operation, stable and accurate analysis, and low cost. Using BNS366 (male sterile) as the female parent and Zhoumai 18 (male fertile) as the male parent, the seeds of the hybrid were hybridized under normal autumn sowing conditions (sown in Xinxiang, Henan Province, from October 10 to October 13) and late sowing conditions (from December 1 to December 3). After self-pollination, the international self-pollination fruit set rate [= (number of grains per spike / (2*number of spikelets)*100%) was less than 5%. It was even lower under normal autumn sowing conditions, close to zero, indicating that there was no BNS366 restoration gene in Zhoumai 18. Then, the seeds produced by the F1 generation were collected and planted to form different individual plants of the F2 generation. The leaves were preserved for DNA extraction and their international self-pollination fruit set rate was tested. After the seeds formed by the F2 generation were collected per plant and per spike, they were planted under normal autumn sowing conditions to form F3 generation plants. The international self-pollination fruit set rate of each individual plant in the F3 generation spike row was tested to determine whether the male fertile phenotype of the F2 generation individual plant would be separated in the next generation. The DNA of the male sterile individual plants, male fertile individual plants (the corresponding individual plants of the F3 generation all maintain the male fertile phenotype), BNS366 and Zhoumai 18 were constructed into four samples: male sterile pool, male fertile pool, male sterile parent and male fertile parent. The samples were detected using 660K chip. The SNP sites of the male sterile pool that were consistent with the male sterile parent but inconsistent with the male fertile parent were detected, namely data 1. At the same time, the SNP sites of the male fertile pool that were consistent with the male fertile parent but inconsistent with the male sterile parent were detected, namely data 2. The intersection of data 1 and data 2 was obtained, namely data 3. Then, the design was carried out based on data 3. KASP primers are used to detect their typing in BNS366, Zhoumai 18, male sterile plants, and male fertile plants, and to screen out functional molecular markers that are closely linked to a set of BNS366 male sterility major effect genes. The main effect gene loci of BNS366 male sterility can be located and detected, and the sterility genes of BNS series wheat or intermediate materials in the process of breeding new sterile lines with BNS series wheat as the original material can be identified, and the sterility genes can be transferred and aggregated. This can avoid the blindness in traditional breeding, greatly reduce the population size, save costs, and increase the accuracy and efficiency of selection. Summary of the Invention

[0006] The application aims to provide a KASP molecular marker closely linked to a BNS series of wheat male sterility major gene site and an application thereof, so as to locate and detect the BNS series of wheat male sterility major gene site by using the molecular marker, to purposefully select offspring in BNS series of male sterile wheat new germplasm breeding, and to provide a guidance basis for creating a new wheat line with BNS series of male sterility characteristics.

[0007] The application adopts the following technical scheme to achieve the above-mentioned purpose: a KASP molecular marker closely linked to a BNS series of wheat male sterility major gene site, characterized in that the BNS series of wheat male sterility major gene site is located on a wheat 2A chromosome, and the KASP molecular marker closely linked to the BNS series of wheat male sterility major gene site is AX-174216228 and AX-109413735.

[0008] The KASP molecular marker primer of the AX-174216228 is an upstream primer AL1 (FAM) with a nucleotide sequence as shown in SEQ ID NO: 1, an upstream primer AL2 (VIC) with a nucleotide sequence as shown in SEQ ID NO: 2, and a downstream primer C (COM) with a nucleotide sequence as shown in SEQ ID NO: 3.

[0009] The KASP molecular marker primer of the AX-109413735 is an upstream primer AL1 (FAM) with a nucleotide sequence as shown in SEQ ID NO: 4, an upstream primer AL2 (VIC) with a nucleotide sequence as shown in SEQ ID NO: 5, and a downstream primer C (COM) with a nucleotide sequence as shown in SEQ ID NO: 6.

[0010] The application provides a KASP molecular marker closely linked to a BNS series of wheat male sterility major gene site and an application thereof.

[0011] The application provides a KASP molecular marker closely linked to a BNS series of wheat male sterility major gene site and an application thereof.

[0012] The application provides a KASP molecular marker closely linked to a BNS series of wheat male sterility major gene site and an application thereof.

[0013] The application provides a KASP molecular marker closely linked to a BNS series of wheat male sterility major gene site and an application thereof.

[0014] (1) extracting DNA of a wheat sample to be detected;

[0015] (2) After receiving the dry powder of primer synthesis, dilute it with ddH2O to 100mmol / L -1 , and fully vortex to dissolve, respectively, to obtain primer AL1 (FAM) solution, AL2 (VIC) solution and C (COM) solution, take 2D tubes and caps and add 230 μL of 10MmTris-HCl, take 60 μL of AL1 (FAM) solution and AL2 (VIC) solution, and 150 μL of C (COM) solution, mix and centrifuge to obtain a primer mixture, and put it into the library; wherein the KASP molecular marker primers of AX-174216228 are respectively the upstream primer AL1 (FAM) with the nucleotide sequence shown in SEQ ID NO: 1, the upstream primer AL2 (VIC) with the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer C (COM) with the nucleotide sequence shown in SEQ ID NO: 3, and the primer mixture is named primer (AX-174216228) mix; the KASP molecular marker primers of AX-109413735 are respectively the upstream primer AL1 (FAM) with the nucleotide sequence shown in SEQ ID NO: 4, the upstream primer AL2 (VIC) with the nucleotide sequence shown in SEQ ID NO: 5, and the downstream primer C (COM) with the nucleotide sequence shown in SEQ ID NO: 6. The upstream primer AL2 (VIC) shown in NO:5 and the downstream primer C (COM) whose nucleotide sequence is shown in SEQ ID NO:6, and the primer mixture thereof is named primer (AX-109413735) mix;

[0016] (3) Using Nexar, the diluted DNA in the 384 plate and the MIX and KASP markers required for the PCR reaction are automatically dispensed onto the 384Array Tape and sealed;

[0017] (4) Perform PCR reaction using a Soellex water bath system;

[0018] PCR reaction system:

[0019] The 1.6 μL PCR amplification reaction system includes: 0.4 μL of 2× Master mix, 0.022 μL of primer mix, 0.8 μL of DNA to be tested, and 0.4 μL of ddH2O. When detecting the KASP molecular marker of AX-174216228, the primer mix added is primer (AX-174216228) mix; when detecting the KASP molecular marker of AX-109413735, the primer mix added is primer (AX-109413735) mix.

[0020] PCR reaction procedure:

[0021]

[0022] (5) After the Soellex water bath PCR is completed, remove the Array Tape, wipe each tape dry, and centrifuge it using a dedicated Array Tape centrifuge at 700 rpm for 10-15 minutes.

[0023] (6) After centrifugation, the Array Tape was automatically scanned using an Araya high-throughput pipeline fluorescence signal scanner. All data were automatically transmitted to the central server, and the results were analyzed and interpreted using Kraken software, and a test report was issued. The alleles AX-174216228-C and AX-174216228-T were excellent alleles with positive and negative effects on the male sterility phenotype of the BNS series wheat, respectively. The alleles AX-109413735-C and AX-109413735-A were excellent alleles with positive and negative effects on the male sterility phenotype of the BNS series wheat, respectively.

[0024] The present invention provides a BNS series wheat male sterility-related typing detection kit, comprising the aforementioned KASP molecular marker tightly linked to the BNS series wheat male sterility major gene locus. The present invention also provides a BNS series wheat male sterility-related typing detection kit for use in developing new wheat lines possessing BNS series male sterility traits.

[0025] The present invention uses an F2 recombinant inbred line population with BNS366 as the female parent and Zhoumai 18 as the male parent as the material, conducts phenotypic identification of the international method self-pollination fruit set rate under normal autumn sowing conditions, and combines a high-density linkage map constructed with a 660K SNP chip to locate the major gene locus controlling the male sterility trait of thermo-sensitive genic male sterile wheat BNS366 on chromosome 2A, and closely links to the AX-174216228 and AX-109413735 molecular markers, and obtains primer sequences corresponding to the molecular markers. The two KASP markers developed by the present invention were used to provide 97 materials, including BNS366 (19 plants, male sterile), Zhoumai 18 (11 plants, male fertile), the F1 generation after the hybridization of BNS366 and Zhoumai 18 (16 plants, male sterile), the male fertile homozygous materials in the F4 generation after the hybridization of BNS366 and Zhoumai 18 (25 plants, male fertile), the two parents BNS when BNS366 was created (13 plants, male sterile) and Zhengmai 366 (5 plants, male fertile), Wenmai No. 6 (5 plants, male fertile) and Zhengmai 9023 (3 plants, male fertile), and were verified under normal autumn sowing conditions. The experimental results were consistent with expectations.

[0026] The innovation of the present invention is:

[0027] 1. The application locates the major gene of the BNS series of wheat temperature-sensitive male sterility genes on chromosome 2A, and is closely linked to the molecular markers AX-174216228 and AX-109413735, and develops two KASP molecular markers that are closely linked to the major gene locus of the BNS series of wheat male sterility traits for the first time. Experiments have proved that the major gene locus controlling the BNS series of wheat male sterility is a major locus that can be stably expressed under normal autumn sowing conditions.

[0028] 2. The KASP molecular marker developed by the application is based on a 660K high-density SNP chip, and compared with traditional molecular markers, it has the characteristics of rapidness, simplicity, high specificity and good accuracy, and can complete the screening and phenotype prediction work of a large number of materials in a short time.

[0029] 3. The KASP molecular marker based on the major gene of the BNS series of wheat male sterility developed by the application has the effect of assisting selection of its male sterility characteristics, and can be used for molecular marker assisted selection breeding, greatly speeding up the breeding process of wheat varieties.

[0030] The KASP molecular marker closely linked to the major gene locus of the BNS series of wheat male sterility provided by the application is applied to wheat breeding, which not only screens quickly and accurately, is not affected by the environment, has clear selection target, but also saves cost, greatly improves the selection efficiency and selection quality of high-yield wheat varieties or lines. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1 The genotyping results of AX-174216228 locus in 58 wheat materials of male sterile single plant (43), male fertile single plant (12, 11 high-quality samples selected by quality inspection), BNS366 (parent 1, male sterile, 2) and Zhoumai 18 (parent 2, male fertile, 2) in F2 population (BNS366 (male sterile) as female parent, Zhoumai 18 (male fertile) as male parent to cross to obtain hybrid F1, F1 selfing to produce F2). Among them, the blue dot represents the genotype CC, the red dot represents the genotype TT, the green dot represents the genotype CT, and the black dot represents the no DNA template control.

[0032] Figure 2Genotyping results of AX-10941373 locus in male sterile single plants (43), male fertile single plants (12, 11 high quality samples selected from 12 by quality inspection), BNS366 (parent 1, male sterile, 2) and Zhoumai 18 (parent 2, male fertile, 2) in total 58 wheat materials in F2 population (F1 hybrid obtained by crossing BNS366 (male sterile) as female parent and Zhoumai 18 (male fertile) as male parent, F2 obtained by selfing F1). Blue dots represent genotype CC, red dots represent genotype AA, green dots represent genotype CA, and black dots represent no DNA template control. DETAILED DESCRIPTION

[0033] The following examples facilitate a better understanding of the present application, but are not limited to the present application. The experimental methods in the following examples are conventional methods, unless otherwise specified. The test materials, reagents, etc. used in the examples, unless otherwise specified, can be obtained from commercial channels.

[0034] Example 1

[0035] Obtaining of a close linkage molecular marker of a male sterile gene candidate locus of a temperature-sensitive nuclear sterile wheat BNS366

[0036] (1) Hybrid F1 was obtained by crossing BNS366 (male sterile) as female parent and Zhoumai 18 (male fertile) as male parent, and F2 (231) was obtained by selfing F1. The flag leaves of each single plant in F2 generation were taken and preserved for later use.

[0037] (2) Phenotypic identification of male sterile and male fertile characteristics of wheat

[0038] Two panicles of main stem or large tiller panicle were selected and bagged for selfing before flowering after wheat heading. After harvest, the materials were examined and tested for international selfing seed setting rate, and the average value was calculated. The material with an average value of selfing seed setting rate of 0 was considered as completely sterile material (male sterile material, the same below), and the material with an average value of selfing seed setting rate greater than or equal to the selfing seed setting rate of Zhoumai 18 was considered as male high fertile material (male fertile material, the same below).

[0039] (3) Genotype scanning and BNS366 male sterile gene mapping

[0040] a) Genomic DNA extraction, CTAB method was used to extract DNA of male sterile single plants (43), male fertile single plants (12), BNS366 (parent 1, male sterile, 2 plants) and Zhoumai 18 (parent 2, male fertile, 2 plants) of the F2 population, and the concentration was detected and diluted to 50-100 ng / μL. The DNA of F2 generation male sterile single plants (43) was mixed to construct male sterile pool 1 (12, 9 high quality samples were actually selected after quality inspection) and male sterile pool 2 (31, 16 high quality samples were actually selected after quality inspection), and the DNA of F2 generation male fertile single plants (12, 8 high quality samples were actually selected after quality inspection) was mixed to construct male fertile pool.

[0041] b) Wheat 660K SNP scanning

[0042] Genotype information was determined by scanning with wheat 660K SNP chip (Zhongyujin Biotechnology Co., Ltd. (Beijing)), and the genotyping results were quality controlled to obtain 397087 high quality SNP markers, and 362593 SNP markers were obtained by removing sites without physical location. There were 75196 homozygous difference sites between parents. There were 691 sites where the male sterile parent and male sterile pool 1 were consistent in genotyping, and the markers were inconsistent with the male fertile pool; there were 3014 sites where the male sterile parent and male sterile pool 2 were consistent in genotyping, and the markers were inconsistent with the male fertile pool, and the sites obtained by male sterile pool 2 were the union of the two male sterile pools (data 1). There were 9364 sites where the male fertile parent and the male fertile pool were consistent in genotyping, and the markers were inconsistent with the male sterile pool 1 and male sterile pool 2 (data 2). The intersection between data 1 and data 2 was calculated (data 3), and referring to Triticum-aestivum v1.0 version, 2 SNP markers were found to be closely linked to the sterile gene of BNS366 on chromosome 2A, which were AX-174216228 (position 778024123 on the chromosome) and AX-109413735 (position 780762484 on the chromosome), and the SNP sequences of the two molecular markers were as follows:

[0043] The SNP sequence of molecular marker AX-174216228 in one case is as follows:

[0044]

[0045] The SNP sequence of molecular marker AX-174216228 in another case is as follows:

[0046]

[0047] The sequence flanking the SNP of molecular marker AX-109413735 in one case is:

[0048]

[0049] The sequence flanking the SNP of molecular marker AX-109413735 in another case is:

[0050]

[0051] (4) Development of KASP markers

[0052] In order to facilitate the identification and assisted selection of the two SNP markers AX-174216228 and AX-109413735 in the progeny of BNS366 and Zhoumai 18 hybridization, and at the same time to reduce the cost and workload of breeding, and to enhance the operability in breeding work, it is necessary to develop the probe sequence of the target molecular marker into KASP marker which can be used for identification and screening based on conventional molecular biology means. We designed two upstream primers [AL1 (FAM), AL2 (VIC)] and a common downstream primer C (COM) for the two target molecular markers:

[0053] The nucleotide sequence of the upstream primer AL1 (FAM) of AX-174216228 is:

[0054] 5'-3' GAAGGTGACCAAGTTCATGCTATGATGATAACACACGTCTGTTCG, as shown in SEQ ID NO: 1;

[0055] The nucleotide sequence of the upstream primer AL2 (VIC) of AX-174216228 is:

[0056] 5'-3' GAAGGTCGGAGTCAACGGATTACATGATGATAACACACGTCTGTTCA, as shown in SEQ ID NO: 2;

[0057] The nucleotide sequence of the downstream primer C (COM) of AX-174216228 is:

[0058] 5'-3' TCGGTTGAGCAACCTAATGGACGAT, as shown in SEQ ID NO: 3;

[0059] The nucleotide sequence of the upstream primer AL1 (FAM) of AX-109413735 is:

[0060] 5'-3' GAAGGTGACCAAGTTCATGCTGTTGTTGCCAACCTCATAGACG, as shown in SEQ ID NO: 4;

[0061] Nucleotide sequence of the upstream primer AL2 (VIC) of AX-109413735:

[0062] 5'-3' GAAGGTCGGAGTCAACGGATTAAGTTGTTGCCAACCTCATAGACT, as shown in SEQ ID NO: 5;

[0063] Nucleotide sequence of the downstream primer C (COM) of AX-109413735:

[0064] 5'-3' CGTGCACACGACCAGTGACAAAAAT, as shown in SEQ ID NO: 6.

[0065] (5) Primer detection

[0066] a) 58 samples of wheat genomic DNA, including 43 male sterile single plants, 12 male fertile single plants (11 high-quality samples selected after quality inspection), 2 BNS366 (male sterile) and 2 Zhoumai 18 (male fertile) from the F2 generation of hybridization between BNS366 (male sterile) and Zhoumai 18 (male fertile), were used as templates, and the primers shown in SEQ ID NO: 1 (FAM), SEQ ID NO: 2 (VIC), SEQ ID NO: 3 (COM) and SEQ ID NO: 4 (FAM), SEQ ID NO: 5 (VIC), SEQ ID NO: 6 (COM) were used to amplify the templates by PCR.

[0067] b) After receiving the dry powder of the synthesized primer, 12000 rpm, 10 min, dilute it into 100 mmol / L with ddH2O respectively, and fully vortex to dissolve, to obtain primer FAM, VIC and COM solutions respectively. Take 2D tube and caps, add 10Mm Tris-HCL 230μL, take FAM and VIC solutions 60μL each, COM solution 150μL, mix and centrifuge to obtain primer mixture, and store in the library;

[0068] The KASP molecular marker primers for AX-174216228 are an upstream primer (FAM) with a nucleotide sequence as shown in SEQ ID NO: 1, an upstream primer (VIC) with a nucleotide sequence as shown in SEQ ID NO: 2, and a downstream primer (COM) with a nucleotide sequence as shown in SEQ ID NO: 3, and the primer mixture is named primer (AX-174216228) mix; the KASP molecular marker primers for AX-109413735 are an upstream primer (FAM) with a nucleotide sequence as shown in SEQ ID NO: 4, an upstream primer (VIC) with a nucleotide sequence as shown in SEQ ID NO: 5, and a downstream primer (COM) with a nucleotide sequence as shown in SEQ ID NO: 6, and the primer mixture is named primer (AX-109413735) mix.

[0069] c) Using Nexar, the diluted DNA in the 384 plate and the MIX and KASP markers required for the PCR reaction are automatically dispensed onto the 384 Array Tape and sealed.

[0070] d) performing PCR reaction using a Soellex water bath system;

[0071] PCR reaction system:

[0072] The 1.6 μL PCR amplification reaction system includes: 2× Master mix 0.4 μL, primer mix 0.022 μL, DNA to be tested 0.8 μL, and ddH2O 0.4 μL;

[0073] When the KASP molecular marker of AX-174216228 is detected, the primer mix added is primer (AX-174216228) mix; when the KASP molecular marker of AX-109413735 is detected, the primer mix added is primer (AX-109413735) mix;

[0074] PCR reaction procedure:

[0075]

[0076] e) After the Soellex water bath PCR is complete, remove the Array Tape, wipe each tape dry, and centrifuge using a dedicated Array Tape centrifuge at 700 rpm for 10-15 minutes.

[0077] f) After centrifugation, the Array Tape is automatically scanned using the Araya high-throughput pipeline fluorescence signal scanner. All data is automatically transmitted to the central server, where Kraken software is used to analyze and interpret the results and issue a test report.

[0078] (6) Genotyping and verification results

[0079] The alleles AX-174216228-C and AX-174216228-T are excellent allele types with positive and negative effects on the male sterility phenotype of BNS366 wheat, respectively; the alleles AX-109413735-C and AX-109413735-A are excellent allele types with positive and negative effects on the male sterility phenotype of BNS366 wheat, respectively.

[0080] Example 2

[0081] Application of the developed KASP molecular marker in identifying and screening male sterility traits in BNS series wheat

[0082] (1) A total of 97 accessions were collected, including BNS366 (19 plants, male sterile), Zhoumai 18 (11 plants, male fertile), F1 generation after hybridization of BNS366 and Zhoumai 18 (16 plants, male sterile), male fertile homozygous materials in F4 generation after hybridization of BNS366 and Zhoumai 18 (25 plants, male fertile), the two parents of BNS366 (13 plants, male sterile) and Zhengmai 366 (5 plants, male fertile), Wenmai No. 6 (5 plants, male fertile), and Zhengmai 9023 (3 plants, male fertile). Phenotypic identification was carried out under normal autumn sowing conditions.

[0083] (2) KASP marker detection was performed on the harvested wheat materials. The specific method was as follows: total genomic DNA of leaves was extracted at the three-leaf stage; genomic DNA of 97 materials was used as substrate, and PCR amplification was performed using the developed KASP marker primers carrying different fluorescent marker signals. The primers were:

[0084] Upstream primer AL1 (FAM) for AX-174216228:

[0085] 5'-3'GAAGGTGACCAAGTTCATGCTATGATGATAACACACGTCTGTTCG (SEQ ID NO: 1),

[0086] Upstream primer AL2 (VIC) of AX-174216228:

[0087] 5'-3'GAAGGTCGGAGTCAACGGATTACATGATGATAACACACGTCTGTTCA (SEQ ID NO: 2),

[0088] Downstream primer C (COM) of AX-174216228:

[0089] 5'-3' TCGGTTGAGCAACCTAATGGACGAT (SEQ ID NO: 3),

[0090] Upstream primer AL1 (FAM) of AX-109413735:

[0091] 5'-3' GAAGGTGACCAAGTTCATGCTGTTGTTGCCAACCTCATAGACG (SEQ ID NO: 4),

[0092] Upstream primer AL2 (VIC) of AX-109413735:

[0093] 5'-3' GAAGGTCGGAGTCAACGGATTAAGTTGTTGCCAACCTCATAGACT (SEQ ID NO: 5),

[0094] Downstream primer C (COM) of AX-109413735:

[0095] 5'-3' CGTGCACACGACCAGTGACAAAAAT (SEQ ID NO: 6).

[0096] PCR amplification system, PCR reaction program and PCR product detection thereof are shown in Example 1.

[0097] (3) Genotyping and verification results

[0098] The two KASP molecular markers of the application are closely linked to the male sterile phenotype in 97 materials. It is shown that the male sterile excellent alleles identified from the BNS366 and Zhoumai18 F2 population are also applicable in the F1 generation, F4 generation materials after hybridization of BNS366 and Zhoumai18, BNS and other conventional materials, and the experimental results are consistent with the expectation. It is shown that the markers closely linked to the male sterile gene of BNS series wheat of the application indeed have the effect of assisted selection on the male sterile phenotype. Allele AX-174216228-C and AX-174216228-T are excellent alleles with positive effect and negative effect on the male sterile phenotype of BNS series (BNS and BNS366) wheat, respectively; and alleles AX-109413735-C and AX-109413735-A are excellent alleles with positive effect and negative effect on the male sterile phenotype of BNS366 series (BNS and BNS366) wheat, respectively.

[0099] Table 1 Genotyping and verification results

[0100]

[0101] The two KASP molecular markers of the application have clear sequences, clear primer and clear chromosome position, are efficient and accurate, and can be directly used in molecular marker assisted selection breeding.

[0102] The application has been described in detail above with general description and specific embodiments, but some modifications or improvements can be made on the basis of the application, which is easy for the person skilled in the art to operate. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the application, all belong to the protection scope of the application.

Claims

1. Application of the KASP molecular marker, which is tightly linked to the major male sterility locus of the BNS series wheat, in the development of new wheat lines with BNS series male sterility characteristics, characterized by: The major effect gene locus of BNS series wheat male sterility is located on wheat chromosome 2A, and the KASP molecular markers closely linked to it are AX-174216228 and AX-109413735; The nucleotide sequence of AX-174216228 is shown in SEQ ID NO: 7 or SEQ ID NO: 8; The nucleotide sequence of AX-109413735 is shown in SEQ ID NO: 9 or SEQ ID NO:

10.

2. Application of KASP molecular markers tightly linked to the major male sterility gene loci of BNS series wheat in selective breeding of BNS series wheat, characterized by: The major effect gene locus of BNS series wheat male sterility is located on wheat chromosome 2A, and the KASP molecular markers closely linked to it are AX-174216228 and AX-109413735; The nucleotide sequence of AX-174216228 is shown in SEQ ID NO: 7 or SEQ ID NO: 8; The nucleotide sequence of AX-109413735 is shown in SEQ ID NO: 9 or SEQ ID NO:

10.

3. The use according to claim 1 or 2, characterized in that The specific process is: (1) extracting DNA from the wheat sample to be tested; (2) After receiving the dry powder of primer synthesis, dilute it with ddH2O to 100mmol / L -1 , and fully vortex to dissolve, respectively, to obtain primer AL1 solution, AL2 solution and C solution, take 2D tube and caps, add 10Mm Tris-HCl230μL, take AL1 solution and AL2 solution 60μL each, C solution 150μL, mix and centrifuge to obtain primer mixture, and put into storage; wherein the KASP molecular marker primers of AX-174216228 are respectively the upstream primer AL1 as shown in SEQ ID NO:1, the upstream primer AL2 as shown in SEQ ID NO:2, and the downstream primer C as shown in SEQ ID NO:3, and the primer mixture is named primer AX-174216228-mix; the KASP molecular marker primers of AX-109413735 are respectively the upstream primer AL1 as shown in SEQ ID NO:4, the upstream primer AL2 as shown in SEQ ID NO:5, and the downstream primer C as shown in SEQ ID The downstream primer C shown in NO:6, and its primer mixture is named primer AX-109413735-mix; (3) Using Nexar, the diluted DNA in the 384 plate and the MIX and KASP markers required for the PCR reaction are automatically dispensed onto the 384Array Tape and sealed; (4) Perform PCR reaction using a Soellex water bath system; PCR reaction system: The 1.6 μL PCR amplification reaction system includes: 0.4 μL of 2× Master mix, 0.022 μL of primer mix, 0.8 μL of DNA to be tested, and 0.4 μL of ddH2O. When detecting the KASP molecular marker of AX-174216228, the primer mix added is primer AX-174216228-mix; when detecting the KASP molecular marker of AX-109413735, the primer mix added is primer AX-109413735-mix. PCR reaction procedure: (5) After the Soellex water bath PCR is completed, remove the Array Tape, wipe each tape dry, and centrifuge it using a dedicated Array Tape centrifuge at 700 rpm for 10-15 minutes. (6) After centrifugation, the Array Tape was automatically scanned using an Araya high-throughput pipeline fluorescence signal scanner. All data were automatically transmitted to the central server, and the results were analyzed and interpreted using Kraken software, and a test report was issued. The alleles AX-174216228-C and AX-174216228-T were excellent alleles with positive and negative effects on the male sterility phenotype of the BNS series wheat, respectively. The alleles AX-109413735-C and AX-109413735-A were excellent alleles with positive and negative effects on the male sterility phenotype of the BNS series wheat, respectively.

4. Application of the BNS series wheat male sterility-related typing detection kit in the creation of new wheat lines with BNS series male sterility characteristics, characterized by: The detection kit comprises the KASP molecular marker tightly linked to the BNS series wheat male sterility major gene locus as claimed in claim 1.

Citation Information

Patent Citations

  • Triple crossing wheat seed purity molecular marker and primer pair and application thereof

    CN105671041A