SV molecular marker related to content of branched and amylose of cassava and application of SV molecular marker

Abstract

The invention provides an SV molecular marker related to cassava branched chain and amylose content and application, and belongs to the technical field of molecular biology, the SV molecular marker is Chr142634494926345058 and is used for predicting the cassava branched chain and / or amylose content; a primer group for amplifying the SV molecular marker comprises a forward primer, a reverse primer, a forward primer, a reverse primer and a reverse primer, wherein the sequence of the forward primer is 5 '-AGATCATACAGCCCATTTT-3'; the sequence of the reverse primer is 5 '-ATCCACCAAAGTTCGTAA-3', and the sequence of the reverse primer is 5 '- The primer group is used for preparing the kit; the primer group or the kit is used for carrying out PCR amplification on the DNA of the cassava to be detected so as to predict the branched chain and / or amylose content of the cassava. The SV molecular marker provided by the invention can accurately and efficiently predict the high or low content of branched chain and amylose of cassava without planting and waiting for cassava adult plants, and greatly improves the breeding selection efficiency.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to an SV molecular marker related to the content of amylopectin and amylose in cassava and its application, which solves the problem of long breeding time and high breeding cost for new cassava varieties with specific amylopectin content level or amylose content level in starch in the prior art. Background Art

[0002] Cassava, also known as sweet potato, tree sweet potato, and wood root, is a tropical and subtropical perennial shrub crop that is widely cultivated in tropical and subtropical regions around the world. Cassava tubers are large and rich in starch. They have a rough and rustic appearance. The tubers are of various shapes and rough skin, but the internal starch content is extremely high, the texture is fine, the powder is white, and the taste is soft. It is an important food and industrial raw material, and is known as the "king of starch", "treasure of tropical crops", and "energy crop". Mature cassava tubers are rich in starch, and their starch particles are large and high in purity. They have excellent processing properties and important edible and industrial value. Therefore, the development of cassava production will greatly promote the development of related industries such as food processing, bioenergy, papermaking, textiles, and feed, which is of great significance.

[0003] The content of amylopectin and amylose in cassava starch is of great significance in the cultivation and utilization of cassava. In the food industry, cassava starch with a high content of amylopectin usually has better gelatinization properties and stability, and is suitable for making cakes, sauces and other foods. Cassava starch with a high content of amylose has better gelling properties and resistant starch properties, and is suitable for making low-sugar and low-fat foods. There is usually a certain negative correlation between the content of amylopectin and the content of amylose in cassava. When the content of amylopectin increases, the content of amylose usually decreases, and vice versa.

[0004] In traditional cassava molecular breeding, farmers or breeders mainly select individual plants with excellent traits and fix the excellent traits through hybridization or backcrossing. At present, if you want to obtain new cassava varieties with specific levels of branched and amylose content in starch, you need to wait for the plants to mature and investigate the branched and amylose content in the root starch to screen for excellent plants. This breeding method takes a long time and has high breeding costs. Summary of the invention

[0005] In view of the above problems, the present invention provides an SV molecular marker related to the content of cassava branched and straight-chain starch and its application.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is: An SV molecular marker related to the content of branched and straight-chain starch in cassava, the SV molecular marker is a large fragment deletion occurring at bases 26344949-26345058 of chromosome 14 of the cassava genome, the sequence deletion length is 110 bp, named Chr14_26344949_26345058, and the sequence is shown in SEQ ID NO: 1; The amylopectin content of cassava carrying SV molecular markers was significantly higher (i.e., greater than) that of cassava lacking SV molecular markers (i.e., a large deletion of bases 26344949 to 26345058 of chromosome 14); The amylose content of cassava carrying the SV molecular marker is lower (i.e., less than) than the amylose content of cassava lacking the SV molecular marker (i.e., a large deletion of bases 26344949 to 26345058 of chromosome 14); The cassava carrying the SV molecular marker has a higher amylopectin content and a lower amylose content, which is a cassava with high amylopectin content and low amylose content; The cassava lacking the SV molecular marker has a lower amylopectin content and a higher amylose content, and is a cassava with low amylopectin content and high amylose content.

[0007] An application of the above SV molecular markers related to the content of cassava amylopectin and amylose is to predict the content of cassava amylopectin and / or amylose by detecting whether cassava carries the SV molecular markers.

[0008] A primer set for amplifying the above-mentioned SV molecular marker related to the content of branched and straight-chain starch in cassava, wherein the primer set is a set of primers designed upstream and downstream of the above-mentioned SV molecular marker, that is, the forward primer is designed based on the sequence upstream of nucleotide 26344949 of chromosome 14 of the cassava genome, and the reverse primer is designed based on the sequence downstream of nucleotide 26345058 of chromosome 14 of the cassava genome, comprising: The sequence of the forward primer was 5′-AGATCATTCAGCCCATTT-3′; The sequence of the reverse primer was 5'-ATCCACCAAAGTTCGTAA-3'.

[0009] A kit comprising the above primer set.

[0010] Furthermore, the kit includes conventional reagents for PCR amplification.

[0011] Furthermore, the kit includes: 2× Rapid Taq Master Mix and ddH2O.

[0012] A method for identifying the content of amylopectin and amylose in cassava, the method comprising using the above primer set to perform PCR amplification on the DNA of the cassava to be tested, so as to predict the content of amylopectin and / or the content of amylose in the cassava to be tested; Alternatively, the above kit is used to perform PCR amplification on the DNA of the cassava to be tested, so as to predict the amylopectin content and / or the amylose content of the cassava to be tested.

[0013] Further, predicting the amylopectin content and / or amylose content of the cassava to be tested is to sequence the PCR amplification product to determine whether it carries the SV molecular marker to predict the amylopectin content and / or amylose content of the cassava to be tested; When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, the length is 267 bp, and the 112th to 221th bases of the sequence from the 5' end (i.e., the front end of the sequence) are SV molecular marker fragments, and the product to be tested carries the SV molecular marker, then the amylopectin content of the cassava to be tested is high and the amylose content is low, and it is a cassava with high amylopectin content and low amylose content; Otherwise, the cassava to be tested lacks the SV molecular marker, that is, a large fragment deletion occurs in the 26344949-26345058 bases of chromosome 14 in the sample genome, and the length of the PCR amplification product is 157bp. In this case, the cassava to be tested has a low amylopectin content and a high amylose content, and is a cassava with low amylopectin content and high amylose content.

[0014] Further, predicting the amylopectin content and / or the amylose content of the cassava to be tested is to perform electrophoresis detection on the PCR amplification product, and interpret the electrophoresis detection result to predict the amylopectin content and / or the amylose content of the cassava to be tested; When only a 267 bp band appears in the electrophoresis detection result, the cassava to be tested carries the SV molecular marker, and the amylopectin content of the cassava to be tested is high, and the amylose content is low, that is, the cassava with high amylopectin content and low amylose content; When only a 157 bp band appears in the electrophoresis detection result, the cassava to be tested lacks the SV molecular marker, and the amylopectin content of the cassava to be tested is low, and the amylose content is high, namely, the cassava with low amylopectin content and high amylose content.

[0015] Furthermore, the PCR amplification system includes: 2× Rapid Taq Master Mix 12.5 μL, the forward primer 1 μL at a concentration of 10 μM, the reverse primer 1 μL at a concentration of 10 μM, the cassava DNA template 1 μL to be tested and ddH2O 9.5 μL; The reaction program of PCR amplification was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, 35 cycles; 72°C for 5 min.

[0016] The beneficial effects of the SV molecular markers related to the content of cassava branched and straight chain starch and the application of the present invention are: The present invention develops an SV molecular marker related to the amylopectin and amylose content of cassava. The SV molecular marker can be used to accurately and efficiently predict the high or low amylopectin content and amylose content of cassava without planting and waiting for the cassava to mature, thereby greatly improving the selection efficiency of cassava breeding, efficiently assisting the breeding selection of cassava, and having extremely high economic value. The present invention develops an SV molecular marker related to the content of amylopectin and amylose in cassava, and establishes a method for accurately and quickly identifying the content of amylopectin and amylose in cassava, which provides a more effective theoretical and practical basis for molecular marker-assisted breeding of new cassava varieties with specific amylopectin and amylose content levels; the molecular marker-assisted breeding technology can accelerate the investigation of the content level of amylopectin and amylose in tuber starch, which is beneficial to the screening of excellent plants, shortening the breeding cycle and improving the breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The Manhattan plot of the whole genome chromosome association analysis positioning of 337 cassava amylopectin content trait data in Example 1 of the present invention; Figure 2 The Manhattan plot of the whole genome chromosome association analysis positioning of the 337 cassava amylose content trait data in Example 1 of the present invention; Figure 3 is the T-test result of the amylopectin content level of 109 cassava samples in Example 5 of the present invention; wherein, REF represents cassava carrying SV molecular markers, n=39 represents a sample size of 39 samples; SV represents cassava lacking SV molecular markers, n=70 represents a sample size of 70 samples; Figure 4 It is the T-test result of the straight chain starch content level of 109 cassava samples in Example 5 of the present invention; wherein, REF represents cassava carrying SV molecular marker, n=39 represents the sample size of 39 samples; SV represents cassava lacking SV molecular marker, n=70 represents the sample size of 70 samples. DETAILED DESCRIPTION

[0018] The technical solutions in the embodiments of the present invention are described clearly and completely below. In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention can also be implemented in other ways different from those described herein, and those skilled in the art can make similar generalizations without violating the connotation of the present invention, so the present invention is not limited by the specific embodiments disclosed below. The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0019] Example 1 Obtaining SV molecular markers related to the content of amylopectin and amylose in cassava The genome resequencing data of 337 cassava samples grown in Danzhou City, Hainan Province, China (109.5°E, 19.5°N) were collected. The quality-controlled sequencing data were aligned to the cassava reference gene to obtain the cassava whole-genome SV molecular marker map. The whole-genome association analysis was performed in combination with the phenotypic data of amylopectin content and amylose content in cassava starch. The results are as follows: Figure 1 and Figure 2 As shown, it can be seen that there is an SV molecular marker on the cassava genome that is significantly associated with the amylopectin content and the amylose content level of cassava ( Figure 1 and Figure 2 (where the arrow points).

[0020] The SV molecular marker related to the content of branched and amylose in cassava is a large deletion occurring at bases 26344949-26345058 of chromosome 14 of the cassava genome. The sequence deletion is 110 bp in length and is named Chr14_26344949_26345058. The sequence is shown in SEQ ID NO: 1.

[0021] Using the SV molecular marker, cassava breeding materials were tested, and the results showed that the amylopectin content of cassava carrying the SV molecular marker was significantly higher than that of cassava lacking the SV molecular marker (i.e., a large deletion of bases 26344949-26345058 on chromosome 14), and the amylose content of cassava carrying the SV molecular marker was lower than that of cassava lacking the SV molecular marker (i.e., a large deletion of bases 26344949-26345058 on chromosome 14).

[0022] Therefore, the use of this SV molecular marker can accurately and efficiently predict the high or low amylopectin content and / or amylose content of cassava without planting and waiting for the cassava to mature, which greatly improves the selection efficiency of cassava breeding, can effectively assist in the breeding selection of cassava, and has extremely high economic value.

[0023] Example 2 Primer set and kit for identifying the content of amylopectin and amylose in cassava Using the characteristics of the SV molecular marker related to the content of cassava branched and straight-chain starch on the cassava genome in Example 1, a set of primers were designed upstream and downstream of the SV molecular marker, that is, the forward primer was designed based on the sequence upstream of nucleotide 26344949 of chromosome 14 of the cassava genome, and the reverse primer was designed based on the sequence downstream of nucleotide 26345058 of chromosome 14 of the cassava genome.

[0024] The sequence of the forward primer was 5′-AGATCATTCAGCCCATTT-3′; The sequence of the reverse primer was 5'-ATCCACCAAAGTTCGTAA-3'.

[0025] Among them, the sequence upstream of nucleotide 26344949 of chromosome 14 of the cassava genome based on the forward primer is: 5'-TCTAAAGTTTCGGGATAAGACTAAAAAATAAGGTATATAAGATCATTCAGCCCATTTTGTTTAACTAAATTAGTCATACCCAGTAAAGCATTACAAAAAATACATCAGATGATTACAAAGAGTCATACCCAGTAGAGCTTACATGGAGTA-3'; The reverse primer was based on the sequence downstream of nucleotide 26345058 of chromosome 14 of the cassava genome: 5'-AGTTGAATTACGAATTTAATTTTTGAGATTACGAACTTTGGTGGATTGTGTATGAGAAGTTTATTTCAGAAACATTTTTCACGAGACTAATTCTGTGGCGGATAGCTTAGCGAAATCGTCAGTTGAAGGCCCTATTGAGATGTAAATTCT-3'.

[0026] When designing primers, in order to enhance the applicability and sensitivity of the primers, the designed primer length is between 18 and 25 bp, and the primers do not interfere with each other. The above two primers can be obtained by artificial synthesis.

[0027] This embodiment also provides a kit for identifying the content of amylopectin and amylose in cassava, which includes the above primer set.

[0028] The kit also includes common reagents for PCR amplification, such as 2× Rapid Taq Master Mix and ddH2O.

[0029] The primer set designed by the present invention has strong specificity and can accurately amplify the sequence carrying / lacking the SV molecular marker of the present invention.

[0030] By using the primer set or the kit of the present invention, the high or low amylopectin content and / or amylose content of cassava can be accurately and efficiently predicted without planting and waiting for the cassava to mature.

[0031] Example 3 Method for Identifying the Content of Amylopectin and Amylose in Cassava This embodiment provides a method for identifying the content of amylopectin and amylose in cassava, and the specific method comprises the following steps: S1, extracting the DNA of the cassava to be tested as a DNA template; S2, using the primer set in Example 2 to perform PCR amplification on the DNA template of cassava to be tested; The reaction system for PCR amplification was: 2× Rapid Taq Master Mix 12.5 μL, forward primer 1 μL at a concentration of 10 μM, reverse primer 1 μL at a concentration of 10 μM, DNA template 1 μL, and ddH2O 9.5 μL. Mix (amplification buffer) was purchased from Novozyme Biotech Co., Ltd., and the primer set was commissioned to be synthesized by Beijing Aoke Dingsheng Biotechnology Co., Ltd.

[0032] The reaction program of PCR amplification was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, 35 cycles; 72°C for 5 min.

[0033] S3. Sequence the obtained PCR amplification product to determine whether it carries the SV molecular marker fragment.

[0034] When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, the length is 267bp, and the 112th to 221st bases of the sequence from the 5' end (i.e. the front end of the sequence) are SV molecular marker fragments, and the product to be tested carries the SV molecular marker, then the amylopectin content of the cassava to be tested is high and the amylose content is low, and it is a cassava with high amylopectin content and low amylose content.

[0035] Otherwise, the cassava to be tested lacks the SV molecular marker, that is, a large fragment deletion occurs in the 26344949-26345058 bases of chromosome 14 in the sample genome, and the length of the PCR amplification product is 157bp. In this case, the cassava to be tested has a low amylopectin content and a high amylose content, and is a cassava with low amylopectin content and high amylose content.

[0036] Alternatively, the PCR amplification product is subjected to electrophoresis detection, and the electrophoresis detection result is interpreted; When only a 267 bp band appears in the electrophoresis detection result, the cassava to be tested carries the SV molecular marker, and the amylopectin content of the cassava to be tested is high, and the amylose content is low, that is, the cassava with high amylopectin content and low amylose content; When only a 157 bp band appears in the electrophoresis detection result, the cassava to be tested lacks the SV molecular marker, and the amylopectin content of the cassava to be tested is low, and the amylose content is high, namely, the cassava with low amylopectin content and high amylose content.

[0037] Among them, the amylopectin content of cassava with high amylopectin content and low amylose content is generally greater than 75.5%, and the amylose content is generally ≤24.5%; Low amylopectin content and high amylose content The amylopectin content of cassava is generally ≤75.5%, and the amylose content is generally >24.5%.

[0038] Example 4 Detection and verification of SV molecular markers in cassava In order to verify the practicality of the SV molecular marker, several cassava plants (excluding the 337 cassava plants used for the development of SV molecular markers) were randomly selected in the cassava planting area of ​​Danzhou City, Hainan Province, China (109.5° east longitude, 19.5° north latitude). The method in Example 3 was used to amplify the SV molecular markers by PCR to determine whether they carried the SV molecular markers, and the contents of straight-chain and branched starch in these cassava samples were detected. The results are shown in Tables 1 to 3 below.

[0039] Table 1 Whether 20 cassava plants carry SV molecular markers and the content of branched and amylose (%)

[0040] Table 2 Statistics of whether 20 cassava plants carry SV molecular markers and amylopectin content (%)

[0041] Table 3 Statistics of whether 20 cassava plants carry SV molecular markers and amylose content (%)

[0042] It can be seen from Tables 1 to 3 that the method of the present invention can identify that the cassava carrying the SV molecular marker has a higher amylopectin content and a lower amylose content, and is a cassava with a high amylopectin content and a low amylose content; the cassava lacking the SV molecular marker has a lower amylopectin content and a higher amylose content, and is a cassava with a low amylopectin content and a high amylose content, indicating that the method of the present invention can be used to identify whether the amylopectin content and / or amylose content of cassava is high or low.

[0043] Example 5 Detection of SV molecular markers in cassava Further, 103 cassava samples were typed using the method in Example 3. The results are as follows: Figure 3 to Figure 4 As shown in the figure, 39 samples carried SV molecular markers and 70 samples lacked SV molecular markers. The levels of amylopectin and straight-chain starch in these samples were detected and T-test was performed. The results showed that the P value was 0.0000052, that is, the amylopectin content of cassava carrying SV molecular markers was higher than that of cassava lacking SV molecular markers, and there was a significant difference; at the same time, the straight-chain starch content of cassava carrying the SV molecular marker was lower than that of cassava lacking the SV molecular marker, and there was a significant difference.

[0044] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, rather than all the embodiments. A person skilled in the art can also obtain other embodiments based on the embodiments without inventiveness, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A SV molecular marker related to the content of amylopectin and amylose in cassava, characterized in that: The sequence of the SV molecular marker is shown in SEQ ID NO: 1; The amylopectin content of cassava carrying SV molecular markers was greater than that of cassava lacking SV molecular markers; The amylose content of cassava carrying the SV molecular marker is lower than that of cassava lacking the SV molecular marker.

2. An application of the SV molecular marker related to the content of amylopectin and amylose in cassava according to claim 1, characterized in that: The application is to predict the amylopectin content and / or the amylose content of cassava by detecting whether cassava carries SV molecular markers.

3. A primer set for amplifying the SV molecular marker related to the content of amylopectin and amylose in cassava according to claim 1, characterized in that: The primer set comprises: The sequence of the forward primer was 5′-AGATCATTCAGCCCATTT-3′; The sequence of the reverse primer was 5'-ATCCACCAAAGTTCGTAA-3'. A kit comprising the primer set according to claim 3.

5. The kit according to claim 4, characterized in that The kit includes conventional reagents for PCR amplification.

6. The kit according to claim 5, characterized in that The kit includes: 2× Rapid TaqMaster Mix and ddH2O.

7. A method for identifying the content of amylopectin and amylose in cassava, characterized in that: The method comprises using the primer set of claim 3 to perform PCR amplification on the DNA of the cassava to be tested, so as to predict the amylopectin content and / or the amylose content of the cassava to be tested; Alternatively, the kit according to any one of claims 4 to 6 is used to perform PCR amplification on the DNA of the cassava to be tested, so as to predict the amylopectin content and / or amylose content of the cassava to be tested.

8. The method for identifying the content of amylopectin and amylose in cassava according to claim 7, characterized in that: Predicting the amylopectin content and / or amylose content of the cassava to be tested is to sequence the PCR amplification product to determine whether it carries the SV molecular marker to predict the amylopectin content and / or amylose content of the cassava to be tested.

9. The method for identifying the content of amylopectin and amylose in cassava according to claim 7, characterized in that: Predicting the amylopectin content and / or the amylose content of the cassava to be tested is to perform electrophoresis detection on the PCR amplification product and interpret the electrophoresis detection result to predict the amylopectin content and / or the amylose content of the cassava to be tested; When only a 267 bp band appears in the electrophoresis test results, the cassava to be tested carries the SV molecular marker; When only a 157 bp band appears in the electrophoresis detection result, the cassava to be tested lacks the SV molecular marker.

10. The method for identifying the content of amylopectin and amylose in cassava according to claim 7, characterized in that: The PCR amplification system includes: 2× Rapid Taq Master Mix, the forward primer, the reverse primer, the DNA template of cassava to be tested and ddH2O; The reaction program of PCR amplification was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, 35 cycles; 72°C for 5 min.

Images