Application of a set of SSR primers for evaluating Oryza myrtilla resources
By developing the SSR primers of wart wild rice and using the genome resequencing data of Hainan and Yunnan wart wild rice genome resequencing data for SSR-seq detection, the genetic diversity evaluation problem of wart wild rice resources was solved, and the effective protection and utilization of wart wild rice resources were achieved.
Patent Information
- Application Number
- CN202510260005.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-06
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2045-03-06
AI Technical Summary
The resource of wart wild rice is reduced, the genetic integrity is unclear, the seed preservation vitality is low, the genomic information is unclear, and the inability to pass conventional hybrid breeding affects its utilization value in rice breeding.
A set of SSR primers of wart wild rice were developed, based on the genome resequencing data of Hainan and Yunnan wart wild rice, and SSR-seq detection was carried out to evaluate the genetic diversity of wart wild rice resources, providing objective evaluation of germplasm resources and mining and utilization of excellent germplasm.
Effective protection and utilization of wart wild rice resources are achieved, molecular level evaluation of the genetic diversity of wart wild rice is provided, and the excavation and utilization of excellent germplasm resources are supported.
Smart Images

Figure CN119736433B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular markers, and in particular relates to the application of a group of Oryza melongena SSR primers in evaluating Oryza melongena resources. Background Art
[0002] In China, Oryza ovata ( O. meyeriana Baill. is primarily distributed in Yunnan, Hainan, and Taiwan. Oryza melongena exhibits strong disease and insect resistance (particularly resistance to bacterial leaf blight, sheath blight, and rice blast), strong temperature sensitivity, weak photosensitivity, and exceptional drought tolerance. Currently, resources of Oryza melongena are dwindling rapidly. O. melongena belongs to the GG genome and is strictly self-pollinating, distantly related to cultivated rice (the AA genome), making conventional hybridization impractical. However, it possesses abundant sterile material. Existing populations are mostly exposed to moderate to severe environmental disturbance, resulting in numerous challenges such as unclear reproductive characteristics and genetic integrity, difficulty in safely storing seed stems, and low seed viability. These challenges hinder the safe, effective, and permanent conservation of wild rice. Furthermore, as a close relative of cultivated rice, the genome of Oryza melongena remains largely unknown, and its potential for utilization in rice breeding remains largely untapped.
[0003] At present, there is an urgent need to effectively preserve resources through the collection and protection of germplasm resources, and to discover beneficial genes and create new germplasm through modern biology and genomics technologies. Summary of the Invention
[0004] The present invention aims at the protection and utilization of Oryza melongena resources and aims to provide a set of Oryza melongena SSR primers for use in evaluating Oryza melongena resources to solve the above technical problems.
[0005] One aspect of the present invention relates to the use of a set of Oryza melongena SSR primers in evaluating Oryza melongena resources, wherein the primer sequences are one or more primer sequences among SEQ ID NO:1-SEQ ID NO:48, the GC content of the primers is between 50-60%, the length is between 18-23 bp, and the annealing temperature is between 57-63°C.
[0006] Preferably, the Oryza verrucae is collected from Hainan Province and / or Yunnan Province.
[0007] Preferably, the collection location of the Oryza tuberosa is Changjiang Li Autonomous County, Hainan Province, Dongfang City, Hainan Province, Wuzhishan City, Hainan Province, Ledong Li Autonomous County, Hainan Province, Sanya City, Hainan Province, Dongfang City, Hainan Province, Ledong Li Autonomous County, Hainan Province, Baoting Li and Miao Autonomous County, Hainan Province or Lincang City, Yunnan Province.
[0008] Preferably, the collection sites of the tuberculinous wild rice are Wangxia Township, Changjiang Li Autonomous County, Hainan Province, Banqiao Town, Dongfang City, Hainan Province, Tuolei Village, Tian'an Township, Dongfang City, Hainan Province, Watongwan Village, Tian'an Township, Dongfang City, Hainan Province, Wen Village, Tian'an Township, Dongfang City, Hainan Province, Changhao Township, Wuzhishan City, Hainan Province, Jianfengling Nature Reserve, Ledong Li Autonomous County, Hainan Province, Luhuitou Scenic Area, Jiyang District, Sanya City, Hainan Province, Gancheng Town, Dongfang City, Hainan Province, Liguo Town, Ledong Li Autonomous County, Hainan Province, Jianfengling Nature Reserve, Ledong Li Autonomous County, Hainan Province, Baocheng Town, Baoting Li and Miao Autonomous County, Hainan Province, or Cangyuan County, Lincang City, Yunnan Province.
[0009] This study aims to protect and utilize Oryza melongena resources. Using SSR primers developed based on genome resequencing data from Oryza melongena in Hainan and Yunnan, SSR-seq testing was performed on Oryza melongena resources. This molecular-level genetic diversity assessment and SSR genotyping enabled objective evaluation of Oryza melongena resources collected from Hainan or Yunnan provinces, providing data reference for the exploration and utilization of superior Oryza melongena germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Figure 1 Figure 3 shows the UPGMA clustering results of 13 populations, including HN12: Baoting Baocheng; HN1: Changjiang; HN9: Dongfang; HN2: Dongfang Banqiao; HN3: Dongfang Tuolei; HN5: Dongfang Wencun; HN4: Dongfang Watongwan; HM7: Ledong Jianfengling; HN11: Ledong Jianfengling; HN10: Ledong Liguo; HN8: Sanya Luhuitou; HN6: Wuzhishan Changhao; YN: Yunnan.
[0011] Figure 2 K value variation diagram drawn for the ΔK method of structure analysis.
[0012] Figure 3 These are the principal coordinate analysis results of 201 samples, including: HN12: Baoting Baocheng; HN1: Changjiang; HN9: Dongfang; HN2: Dongfang Banqiao; HN3: Dongfang Tuolei; HN5: Dongfang Wencun; HN4: Dongfang Watongwan; HM7: Ledong Jianfengling; HN11: Ledong Jianfengling; HN10: Ledong Liguo; HN8: Sanya Luhuitou; HN6: Wuzhishan Changhao; YN: Yunnan. DETAILED DESCRIPTION
[0013] The following is further described in detail through specific implementation methods:
[0014] 1. Experimental Materials
[0015] A total of 201 samples of Oryza versicolor ( O. meyerianaBaill.) materials, young leaves collected in August 2023 for DNA extraction. The 201 accessions of Oryza melongena were collected from 13 populations, including 12 populations in Hainan and one population in Yunnan, where Oryza melongena is naturally distributed. Detailed sampling information is shown in Table 1.
[0016] Table 1: Detailed information of population materials
[0017]
[0018] 2. Experimental methods and results
[0019] 2.1 SSR locus development and primer design
[0020] A total of 201 Oryza verruca accessions were resequenced. After DNA samples were built, they were sequenced on HiSeq2000 with a sequencing depth of >20× and clean reads were obtained.
[0021] The simple sequence repeat identification software MISA (MIcroSAtellite identification tool) was used to analyze the whole-genome SSR site information, and then the whole-genome SSR differential site information was obtained by comprehensive comparison. Subsequently, single-copy gene analysis and comprehensive SSR differential site analysis were performed. The analysis was based on the base number of the SSR marker repeat unit, and primers were designed and developed based on the conserved sequences at both ends.
[0022] By analyzing the obtained whole-genome data, a total of 50,108 SSR loci were identified, including 0 mononucleotide loci, 28,890 dinucleotide loci, 15,079 trinucleotide loci, 1,078 tetranucleotide loci, 173 pentanucleotide loci, 137 hexanucleotide loci, and 4,751 complex loci, with the proportions of 0%, 57.66%, 30.09%, 2.15%, 0.35%, 0.27%, and 9.48%, respectively. The specific experimental results are shown in Table 2.
[0023] Table 2: Distribution of SSR loci with different repeat motifs in the whole genome of Oryza melongena
[0024]
[0025] For the SSR loci identified above, the present invention randomly selected 198 SSR loci with a repeat base of 3 sequences for primer design. After primer synthesis, PCR detection was performed on one Oryza melongena germplasm resource. It was found that 190 primer pairs could effectively amplify. These 190 primer pairs were further used in 8 Oryza melongena germplasm resources from different geographical origins, and 24 pairs of SSR primers with good amplification effects were screened out (Table 3).
[0026] Primer design was performed using Primer 3 software, following the principles of primer design. Forward and reverse amplification primers were designed with a GC content of 50-60%, a length of approximately 18-23 bp, and an annealing temperature of 57-63°C, with 58°C being optimal. A 3' terminal base and potential secondary structure were avoided during design. The fluorescent primer sequences to be synthesized were selected and prepared by Hainan Times Biotechnology Co., Ltd.
[0027] Table 3: 24 pairs of primer sequences and extended information
[0028]
[0029] SEQ ID NO: 1: GACAATGCCACTGCTGAAA.
[0030] SEQ ID NO:2: GCGTGGAACTGAACAAGACG.
[0031] SEQ ID NO: 3: GTCGAGGTTGACGAGGAAGG.
[0032] SEQ ID NO: 4: TCGTCCCTCTCCACTTCCTC.
[0033] SEQ ID NO:5:TCCCTGCAATTCGAGCTGTT.
[0034] SEQ ID NO:6: GCGTAAAGCGAGATGGCAAG.
[0035] SEQ ID NO:7: TGTGATATCGCACGAGCTCC.
[0036] SEQ ID NO:8: TGACGAACAAGACCGACCAG.
[0037] SEQ ID NO:9: ATCACCGCCATGTCCACTTT.
[0038] SEQ ID NO: 10: TCAAGAAGGCGGCCAAAGAT.
[0039] SEQ ID NO: 11: GGTACGACGCCCAAAGATGT.
[0040] SEQ ID NO: 12: TCATCTCCCTCCTCGACCTC.
[0041] SEQ ID NO:13:AAACGAGTCAGCTCAGCTCC。
[0042] SEQ ID NO:14:TGGGGTTTGATGCTCTCGAC。
[0043] SEQ ID NO:15:CGCTGTTGCTTCCAGATTCG。
[0044] SEQ ID NO:16:GCGCCTCAATTGACGATTCC。
[0045] SEQ ID NO:17:GCCACGCTATCTCGCTAGTT。
[0046] SEQ ID NO:18:AACGAGCTAGGAGAGGAGCA。
[0047] SEQ ID NO:19:ACTGGCGGAGATTGGAACAG。
[0048] SEQ ID NO:20:CAAGTGCAAATTGCCCACGA。
[0049] SEQ ID NO:21:CACAAGTAGAGTGTGGCCGT。
[0050] SEQ ID NO:22:AAACCGGGCCATGTGTTTTC。
[0051] SEQ ID NO:23:TCCACGGAGATGTGCTTAGC。
[0052] SEQ ID NO:24:AGCCAAATGTCCTCAAGGCT。
[0053] SEQ ID NO:25:TCCGCCTTCCATTGATTGCT。
[0054] SEQ ID NO:26:AGCGGGCTTTCCAAATTTGC。
[0055] SEQ ID NO:27:GCCTACTGTCGCTCACCTTT。
[0056] SEQ ID NO:28:ATCGGGCATATGAGAGCGTG。
[0057] SEQ ID NO:29:ATCCACTCTCTTCCTCCGCT。
[0058] SEQ ID NO:30:GGAAATGGGGGAAAGGGGAG。
[0059] SEQ ID NO:31:GCCCACTGCAGTTTCTTCAC。
[0060] SEQ ID NO:32:ACCAATGCCATGTTTCACGC。
[0061] SEQ ID NO:33:GCTGCTCGGCCTCTAAATCT。
[0062] SEQ ID NO:34:GCGTAGTTTCCGTGACGAGA。
[0063] SEQ ID NO:35:TATCTGGATTCGGTCGCGTG。
[0064] SEQ ID NO:36:AACGGCCGGATGTAAGTTGT。
[0065] SEQ ID NO:37:CCGCGAGAGTTGCTCCTAAT。
[0066] SEQ ID NO:38:GGTGGGTTTTTGGGATGCAT。
[0067] SEQ ID NO:39:TTTGCGTCACGGAGGATCAT。
[0068] SEQ ID NO:40:CACGTACGAGAGAGAGCGAC。
[0069] SEQ ID NO:41:GCCCTTCCGGTCATCAGATC。
[0070] SEQ ID NO:42:GACGAGCCCTTCTCAAAGCT。
[0071] SEQ ID NO:43:GAGATGTCTTGCGAGCCCAT。
[0072] SEQ ID NO:44:GCGGATCATCGTACTACGCA。
[0073] SEQ ID NO:45:GTCAGAGGCAGGGTTTCTCC。
[0074] SEQ ID NO:46:ATCAATTGTCCCCTGCACC.
[0075] SEQ ID NO:47: GCAGGCAAATGATCCGCAAT.
[0076] SEQ ID NO:48: AACCTGATGTGTGCACTGCT.
[0077] 2.3 Population fluorescence PCR amplification
[0078] 201 population samples were amplified using 23 pairs of polymorphic primers, and the reactions were performed on a Veriti384 PCR instrument.
[0079] The PCR reaction program is shown in Table 4. The PCR reaction system is shown in Table 5.
[0080] The PCR amplification program was set as follows: pre-denaturation at 95°C for 5 min; 10 cycles of denaturation at 95°C for 30 s, gradient annealing at 62-52°C for 30 s, and extension at 72°C for 30 s; 25 cycles of denaturation at 95°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 30 s; and finally, extension at 72°C for 20 min, followed by storage at 4°C.
[0081] Table 4: PCR amplification system and amplification procedure
[0082]
[0083] Table 5: Fluorescence PCR reaction system of Oryza melongena
[0084]
[0085] After the PCR reaction is completed, the amplified products are detected by fluorescence capillary electrophoresis. GeneMarker software is used to analyze the results, providing the number of alleles, peak patterns, and genotype for each sample. Each PCR amplification worksheet corresponds to a 96-well PCR amplification well and records experimental information such as the order number, amplification plate number, amplification conditions, amplification sites (fluorescent marker / upstream primer number, downstream primer number), and the DNA template in each amplification well (sample storage plate number minus well number) to ensure accurate experimental procedures.
[0086] 2.4 Detection of PCR products by fluorescence capillary electrophoresis
[0087] According to the experimental requirements, add the fluorescent PCR product diluted to a uniform concentration to the upper plate, and add the upper detection reagents according to the system provided in Table 5. After centrifugation, place the plate to be tested with samples and reagents on the PCR instrument and run the denaturation program (95°C, 3 minutes). Cool it immediately after denaturation is completed. Refer to the ABI 3730xL upper plate operation process, select the test file corresponding to the name of the plate to be tested, and run the SSR sample analysis test program.
[0088] The raw data in fsa format were exported from the ABI 3730xL genetic analyzer, classified and archived by detection locus, and then imported into GeneMarker analysis software to read the genotype data. Excel raw genotype data and PDF typing peak diagram files were exported by locus name to obtain the number of alleles, peak diagram and genotype of each sample.
[0089] SSR loci and population genetic diversity: POPGENEv1.31, PowerMarker v3.25, GenAlExversion 6.501 and other software were used to calculate AMOVA molecular variation analysis, various genetic diversity indicators of SSR loci and populations, including observed alleles (Na), effective alleles (Ne), Shannon index (I), polymorphism information index (PIC), observed heterozygosity (Ho), expected heterozygosity (He) and inbreeding coefficient (Fis).
[0090] The genetic diversity of the 13 populations was analyzed using GenALEx software. The results in Table 6 showed that the Na of the 13 populations ranged from 1.034 to 2.957, with an average of 1.783. The Ne ranged from 1.026 to 2.159, with an average of 1.380. I The effective number of alleles (Ne) and Shannon index (I) of HN10 population were the highest, which were 2.159 and 0.770, respectively; the HN8 population was second, which were 1.993 and 0.756, respectively; the YN population had the lowest, which were 1.026 and 0.055, respectively; the remaining 10 populations were between 1.830-1.087 and 0.666-0.060, respectively, indicating that the genetic diversity among the 13 populations was rich, among which the YN population had the lowest genetic diversity, and the HN10 and HN8 populations had high genetic diversity.
[0091] Table 6: Genetic diversity among populations
[0092]
[0093] Note: N a: observed allele; N e: effective allele; I : Shannon Information Index; H o: observed heterozygosity; H e: expected heterozygosity; F : Fixed index
[0094] Molecular analysis of variance (AMOVA) is a method that measures and calculates genetic variation between haplotypes (or genotypes) using evolutionary distance. To reveal the genetic variation of Oryza melanogaster, molecular variance analysis (AMOVA) was performed. The results revealed that genetic variation between populations was 43%, between individuals was 37%, and within individuals was 20%, indicating that genetic variation between populations was higher than both within and between individuals (Table 7). Pairwise AMOVA analysis revealed that the coefficient of differentiation between populations ranged from 0.021 to 4.750, gene flow ranged from 0.038 to 0.921, and genetic distances ranged from 0.046 to 0.877, indicating low gene flow between populations.
[0095] Table 7: Analysis of molecular variance (AMOVA) of populations
[0096]
[0097] 2.5 Population structure analysis of O. melitensis germplasm
[0098] To reveal the population structure of 201 Oryza versicolor germplasm resources, the genetic structure of 13 populations from different geographical origins was analyzed using a Bayesian analysis method. The estimated population size was expressed as a K value. Standard STRUCTURE analysis was performed, testing 15 K values (K = 1-15) one by one. Ten independent runs were performed for each K value. The optimal population size was found to be 2 (K = 2) ( Figure 2 Therefore, with K = 2, the genetic structure of 201 accessions of Oryza melongena from 13 populations was analyzed. The results showed that the 201 accessions were divided into two subpopulations. Four accessions (S04340, S04335, S04336, and S04337) from population HN10 and three accessions (S04217, S04224, and S04225) from population HN3 contain unique genotypes and may also have a small amount of gene flow between populations. Combined with the results of the genetic diversity index gene flow (Nm) (Table 8), this indicates that there is little gene flow among the 201 Oryza melongena accessions.
[0099] 2.6 UPGMA clustering and PCoA analysis of Oryza melongena germplasm resources
[0100] The Nei's unweighted group average method (UPGMA) of genetic distance was used to perform cluster analysis on 201 Oryza melongena germplasm resources from 13 populations. The optimal K value was determined to be 2 according to the principle of maximum likelihood. The results showed that the populations were clustered into two subpopulations. The populations in Yunnan were clustered into one subpopulation (YN); the 12 populations in Hainan were clustered into one subpopulation (Tables 8, 9, Figure 1 The second group is divided into two small groups. Group I includes three populations: HN4, HN8, and HN9; Group II includes eight populations: HN12, HN1, HN2, HN3, HN5, HN11 (two populations in Ledong), HN10, and HN6.
[0101] Table 8: Gene flow between populations (upper triangle) and genetic differentiation coefficient (lower triangle)
[0102]
[0103] Table 9: Genetic distances between populations
[0104]
[0105] 2.7 F-statistic and gene flow analysis of the total population
[0106] The F-statistic can be used to assess the level of population differentiation and inbreeding. Table 10 shows the F-statistic and gene flow for the total population at 23 SSR loci. The overall inbreeding coefficient ranged from -0.579 to 0.983, with an average of 0.683, indicating a high degree of inbreeding among individuals and a large amount of genetic variation. The genetic differentiation coefficient ranged from 0.242 to 0.768, with an average of 0.586, indicating a high degree of genetic differentiation. The Nm values ranged from 0.032 to 0.782, with Nm values for all polymorphic loci less than 1, with an average of 0.204, indicating low gene flow among the 201 Oryza melongena germplasm accessions, consistent with the results of the population structure analysis.
[0107] Table 10: Inbreeding coefficient and gene flow of 23 primer pairs
[0108]
[0109] Note: Nm :Gene flow( N m = 0.25(1-Fst) / Fst)
[0110] Inbreeding coefficient: It refers to the degree of gene purification expressed as a percentage based on the number of generations of inbreeding. It also refers to the percentage of homogeneous genes or homozygotes when the number of heterogeneous genes in an individual is reduced due to inbreeding.
[0111] Gene flow: The transfer of genes from one population to another.
[0112] 2.8 Population genetic structure analysis and UPGMA clustering and PCoA analysis
[0113] Population structure analysis was performed on 201 samples using STRUCTURE 2.3.4. K was set to 1-20, the burn-in period was 10,000, and the MCMC (Markov Chain Monte Carlo) method was set to 100,000. Each K value was run 20 times, and the optimal ΔK value (i.e., optimal population stratification) was calculated. The results of the optimal K value were plotted. Genetic distances between populations were calculated using Powermarker, and cluster analysis was performed using the Unweighted Group Mean (UPGMA) method based on Nei genetic distances.
[0114] Based on the results of population genetic structure analysis, the variation and differentiation between and within populations were calculated and significance tests were performed using GenALEx version 6.501 software. The genetic differentiation coefficient (Fst) and gene flow (Nm) were calculated according to Wright's (1931) formula: Nm=0.25(1-Fst) / Fst. Principal coordinate analysis (PCoA) was performed using GenALEx v6.3 software.
[0115] The principal coordinates of Oryza melongena germplasm resources were analyzed using GenAIex software. The distance of the material position on the two-dimensional plane represents the degree of its genetic relationship. 201 Oryza melongena germplasm resources were analyzed in the following ways: Figure 3 As shown in the figure, the relationship between clusters 1 and 2 is clearly visible. A small number of germplasms in the two clusters cannot be clearly separated, and the relationship is close. Most germplasms can be clearly separated, and the relationship is distant, verifying the analysis results of the genetic structure. It was found that the first principal coordinate and the second principal coordinate accounted for 67.7% and 8.58% of the total genetic variation, respectively ( Figure 3 ). This shows that the results of PCoA analysis are basically consistent with those of cluster analysis.
[0116] To demonstrate the effectiveness of SSR fluorescent primers in analyzing the genetic diversity of Oryza spp., primer polymorphism analysis was performed. Table 11 shows the polymorphism information of 23 pairs of SSR fluorescent primers in 201 samples. A total of 103 alleles (Na) were detected in the 201 samples, with an allele range of 2-18 and an average value of 4.478. N e) The total number is 52.698, the range of values is 1.595 (YLYSD084)-8.816 (YLYSD186), and the average number of effective alleles per site is 2.291; Shannon index ( I) ranged from 0.569 (YLYSD167) to 2.374 (YLYSD186), with an average of 0.903; the observed heterozygosity ( Ho ) ranged from 0.1 (YLYSD006) to 0.746 (YLYSD282), with an average of 0.107; the expected heterozygosity ( He ) ranged from 0.373 (YLYSD084) to 0.887 (YLYSD186), with an average of 0.496; the polymorphic information content ( PIC ) ranged from 0.308 (YLYSD167) to 0.876 (YLYSD186), among which the highly polymorphic markers ( PIC≧ 0.5) has 5, medium polymorphic markers (0.25≦ PIC< 0.5) with 18, low polymorphic markers ( PIC< The results showed that the 23 SSR fluorescent primer pairs exhibited varying degrees of allelic variation in O. melograna germplasm and could reflect individual heterozygosity, indicating that the 23 SSR fluorescent primer pairs had good polymorphism and could be used for genetic diversity analysis.
[0117] Table 11: Polymorphisms of 23 pairs of SSR primers
[0118]
[0119] Note: Prob : P value; Signif : Significance (ns means not significant, that is, the group conforms to HWE; * means significant difference P < 0.05, ** means significant difference P < 0.01, *** means significant difference P < 0.001)
[0120] Observed alleles ( N a): The number of observed alleles is an important indicator of genetic diversity. The more alleles there are, the more different alleles there are at the locus, which means that the genetic variation between individuals is richer. Conversely, a smaller number of alleles indicates that the genetic differences between individuals are relatively small. Effective alleles (Ne): The more evenly alleles are distributed in a population, the closer Ne is to the actual number of alleles detected. Shannon index ( I ): A measure of biodiversity index, indicating the uniformity of individual distribution in many categories. The more species, the more evenly distributed the individuals, and the greater the biodiversity. H o): The probability that the alleles of two randomly selected samples are different. This includes determining the distribution of genes and genetic diversity in a population, thereby reflecting the genetic distance between different individuals in the population. Expected heterozygosity ( He): refers to the distribution under the heterozygosity assumption, which is based on the assumption of measuring the genetic diversity of the species group. F ): An indicator to evaluate the degree of deviation between the actual observed value and the theoretical value. PIC ): A marker relies on the number of detectable alleles and their distribution frequency to obtain the size value of the polymorphism detected by the marker in a population.
[0121] The above describes in detail the preferred embodiments of the present invention. It should be understood that those skilled in the art can make numerous modifications and variations based on the concepts of the present invention without inventive effort. Therefore, any technical solutions that can be derived by those skilled in the art through logical analysis, reasoning, or limited experimentation based on the concepts of the present invention and the prior art should be within the scope of protection defined by the claims.
Claims
1. Application of a set of Oryza melongena SSR primers in evaluating Oryza melongena resources, characterized in that: The primer sequences are SEQ ID NO: 1-SEQ ID NO: 32 and SEQ ID NO: 35-SEQ ID NO: 48, the GC content of the primers is between 50-60%, and the annealing temperature is between 57-63° C.; the application is the genetic diversity analysis of Oryza melongena.
Citation Information
Patent Citations
Special molecular marker for identifying Oryza granulata Nees et Arn.ex Watt., and application thereof
CN102732628A
SSR molecular marker amplification primer combination for simultaneously detecting medicinal wild rice and cultivated rice and application of SSR molecular marker amplification primer combination
CN115873973A